Molecular study of icaD biofilm gene expression by extract of ginger and artichoke in Staphylococcus aureus

Document Type : Research Paper

Authors

1 Department of Biology, Faculty of Basic Sciences, Rasht Branch, Islamic Azad University

2 Department of Plant Protection, Faculty of Agriculture, Rasht Branch, Islamic Azad University.

Abstract

Biofilm is an accumulation of bacteria that increase binding to biological and non-biological levels and causes pathogenicity and infection in Staphylococcus aureus. The icaABCD operon genes are involved. The icaD gene plays an important role in the maximal expression of the enzyme N-acetylglucosamine transferase and leads to the phenotypic expression of extracellular polysaccharide in S. aureus. In this study, based on antibiogram test, the antimicrobial effect of ginger and artichoke extract on two strains of S. aureus was studied. Also, in the studied strains, after the minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) tests, using real time PCR technique, the expression of icaD biofilm gene under the treatment of artichoke and ginger extracts was evaluated. The results of disk diffusion test showed that the concentration of 100 mg/ml of ginger and artichoke extracts in the standard and the pathogen strains of Staphylococcus aureus, create a inhibition zone of 15 mm and about 9 mm, respectively. MIC test also showed that the studied strains can grow at a concentration of 5000 µg/ml of plant extracts. The results of icaD gene expression under the influence of artichoke and ginger extracts in the standard strain showed an increase in the expression of this gene. However, in the pathogen strain of Staphylococcus aureus, ginger and artichoke extracts led to a significant reduction (P

Keywords

Main Subjects

مطالعه­ی مولکولی بیان ژن بیوفیلم icaD  تحت اثر عصاره گیاهان  زنجبیل و کنگر فرنگی در باکتری Staphylococcus aureus

متین قدرت۱، هادی حبیب‌الهی1 و محمد رضا صفری مطلق2*

۱ ایران، رشت، دانشگاه آزاد اسلامی، واحد رشت، دانشکده علوم پایه، گروه زیست­شناسی

2 ایران، رشت، دانشگاه آزاد اسلامی، واحد رشت، دانشکده علوم کشاورزی، گروه گیاهپزشکی

تاریخ دریافت: 13/06/1399          تاریخ پذیرش: 24/10/1399

چکیده

بیوفیلم تجمعی از باکتری­ها می‌باشد که باعث افزایش اتصال به سطوح بیولوژیکی و غیربیولوژیکی شده و در باکتری Staphylococcus aureus باعث ایجاد بیماری­زایی و عفونت می­گردد. ژن­های اپرونی icaABCD  در این امر دخالت دارند. ژن icaD نقش مهمی در حداکثر بیان آنزیم N – استیل گلوکزآمین ترانسفراز دارد و منجر به بیان فنوتیپیک پلی­ساکارید خارج­سلولی در S. aureus می­شود. گیاهان دارویی بسیاری دارای خاصیت ضد باکتریایی هستند. در این تحقیق، تأثیر ضد میکروبی عصاره زنجبیل و کنگر فرنگی روی دو سویه از باکتری  S. aureus بر اساس تست آنتی­بیوگرام مطالعه گردید. همچنین پس از آزمون­های پایین‌ترین غلظت مهارکنندگی (MIC) و پایین‌ترین غلظت باکتری­کشی (MBC)، با استفاده از تکنیک Real time PCR، میزان بیان ژن بیوفیلم icaD تحت تیمار عصاره کنگر فرنگی و عصاره زنجبیل در سویه­های مورد مطالعه ارزیابی شد. نتایج حاصل از آزمون انتشار از دیسک نشان داد که غلظت 100 میلی‌گرم بر میلی‌لیتر عصاره زنجبیل و نیز کنگر فرنگی در سویه استاندارد و پاتوژن S. aureus، به­ترتیب هاله عدم رشد 15 میلی‌متری و حدود 9 میلی‌متری ایجاد می‌کند. آزمون MIC نیز نشان داد که سویه‌های مورد مطالعه در غلظت 5000 میکروگرم بر میلی‌لیتر عصاره‌های گیاهی نیز توان رشد دارند. نتایج حاصل از بررسی میزان بیان ژن icaD تحت تأثیر عصاره‌های کنگر فرنگی و زنجبیل در سویه استاندارد بیانگر افزایش بیان این ژن بود ولی در سویه پاتوژن S. aureus، عصاره­های زنجبیل و کنگر فرنگی با اختلاف معنی­دار P<0.01 به­ترتیب منجر به کاهش قابل­توجه بیان ژن icaD به حدود 28 درصد و 10 درصد نمونه کنترل شدند.

واژه­های کلیدی: بیوفیلم، Staphylococcus aureus، ژن icaD، زنجبیل، کنگر فرنگی.

* نویسنده مسئول، تلفن:  ۰۹۱۱۱۳۸۴۱۶۸ ، پست الکترونیکی: ssafarimotlagh@yahoo.com

مقدمه

 

Staphylococcus aureus یکی از پاتوژن­های مهم و شایع عفونت­های بیمارستانی است که با داشتن آنزیم­های مختلف قادر است در همه جای بدن عفونت ایجاد کند. این باکتری از نظر ایجاد عفونت­های بیمارستانی در مرتبه دوم  پس از Pseudomonas aeruginosa قرار دارد (۳۴). این باکتری قابلیت زنده ماندن در بدن و محیط­های خارج از بدن میزبان طبیعی خود مانند هوا، گرد و خاک و آب را دارا است و این توانایی به دلیل انطباق و سازگاری بسیار زیاد این باکتری با شرایط مختلف محیطی و مقاومت زیاد در برابر خشکی و با فشارهای اسمزی می­باشد (۱۴). به علت پیدایش سویه­های مقاوم به آنتی­بیوتیک در باکتری S. aureus برخی از سویه­ها حتی نسبت به تعداد زیادی از ترکیبات ضد میکروبی اعم از آنتی­بیوتیک­ها و ضدعفونی­کننده­ها، مقاومت نشان داده­اند (۲۷). سویه­هایی از S. aureus که این مواد را تولید می­کنند، ظرفیت کلونیزاسیون بالایی نسبت به سویه­هایی که این دو عامل را تولید نمی­کنند دارند که این امر منجر به مقاومت بالا نسبت به درمان با آنتی­بیوتیک­ها می­شود (۱۹).

بیوفیلم را می‌توان یک اجتماع باکتریایی نامید که در آن باکتری­ها به یک سطح زنده و یا غیرزنده اتصال داشته و در یک لایه خارج­سلولی محصور شده­اند (۹). ماهیت آب­گریزی سطح خارجی باکتری در اتصال غیراختصاصی آن به سطوح پلاستیکی، اتصال به فاگوسیت­ها و دیگر سلول­های پستانداران و نیز در رشد سلول­ها روی لایه­های نامحلول آب­گریز مثل هیدروکربن­ها اهمیت دارد (۶، ۳۰ و ۳۱). تشکیل بیوفیلم می­تواند باعث ایجاد مشکلاتی در زمینه پزشکی از جمله عفونت وسایل خارجی مانند کاتترها، لوله­های حلقی و لنزهای تماسی و نیز عفونت بافت­های زنده مانند عفونت اندوکارد، عفونت زخم و عفونت اپی­تلیوم ریه مخصوصا در بیماران مبتلا به فیبروز کیستی شود (۳۵). تولید بیوفیلم ناشی از فعالیت اپرانی تحت عنوان icaABCD می­باشد که مهم­ترین عامل برای تشکیل ماتریکس اگزوپلی‌ساکاریدی است که از عوامل چسبندگی بین­سلولی بوده و پروتئین­های عوامل اتصالی بین­سلولی icaA ،icaB ،icaC  وicaD در تولید آن دخالت دارند (۱۲، ۲۲ و 3۲). این پلی­ساکارید پلیمری از واحدهای گلیکوز آمینوگلیکان می­باشد که توسط آنزیم ان-استیل گلوکز آمینیل ترانسفراز سنتز می­شود. بیان این آنزیم توسط لوکوس­های ica انجام می­شود (۴) .از میان ژن­های لوکوس ica (Intracellular adhesin) بیان هم­زمان دو ژن icaA و icaD در S. aureus موجب افزایش مقاومت آنتی­بیوتیکی و بیماری­زایی می­شود­ (۱۰).

محرک­های ایمنی عواملی هستند که با هدف قرار دادن ایمنی غیراختصاصی موجود سبب افزایش مقاومت میزبان در برابر بیماری می­شوند (۲۸). یکی از محرک­های ایمنی موثر و قوی، گیاهان و ترکیبات آنها هستند که می‌توانند جایگزین داروهای شیمیایی شوند (۳۳). به­منظور کاهش زیان­های اقتصادی و خطرات جانی ناشی از عوامل  بیماری­زای میکروبی، استفاده از مواد طبیعی به­عنوان ترکیبات ضدمیکروبی می‌تواند روشی مؤثر برای کنترل باکتری­های بیماری­زا باشد (۳). استفاده بی­رویه و بدون تجویز پزشک از آنتی بیوتیک­ها، مقاومت­های روبه گسترش میکروارگانیسم­ها نسبت به آنتی بیوتیک­های رایج درمانی، عوارض نامطلوب و جانبی ناشی از استفاده آنها و از طرفی مقرون به صرفه­نبودن ساخت برخی داروهای شیمیایی باعث سوق صنعت داروسازی به گیاهان دارویی شده است تا دوباره توجه جوامع پزشکی و محققین به پزشکی سنتی، فیتوتراپی و مواد مؤثره موجود در گیاهان دارویی (فنل، فلاونوئیدها، فلاون­ها، ترپن­ها و (... معطوف گردد (۲۹). عصاره گیاهان دارویی مختلفی همچون زردچوبه برای درمان سرطان کولون (۲) به­کار رفته­اند. همچنین فعالیت ضدباکتریایی عصاره هیدروالکلی گیاهان آویشن و به­لیمو علیه باکتری Pseudomonas syringae در شرایط آزمایشگاهی به اثبات رسیده است (۱).

زنجبیل از قدیم برای درمان عفونت­های نای و مهار طیف وسیعی از میکروارگانیسم­ها از قبیل باکتری­های گرم مثبت، گرم منفی و قارچ­ها استفاده می­شده است. مطالعات متعددی نقش ضد میکروبی این گیاه در مقابل باکتری­های گرم مثبت و گرم منفی را نشان داده­اند (۲۷). کنگرفرنگی در منابع مختلف به­عنوان گیاهی دارویی معرفی شده­ و فرآورده­های حاصل از آنها در پیشگیری و درمان بسیاری از بیماری‌­های ناشی از قارچ­ها و باکتری­ها مورد استفاده قرار می­گیرد (۲۰).

مطالعات انجام­شده اثرات ضد باکتریایی پیاز و زنجبیل روی باکتری­های Escherichia coli، Bacillus subtilis و Salmonella typhimurium را به اثبات رسانده­اند. نتایج نشان داد که زنجبیل حاوی مواد ضد میکروبی فلاونوئیدی است (۲۳). بررسی خاصیت ضد باکتریایی عصاره خام آبی و الکلی پیاز و زنجبیل در برابر S. aureus، Pseudomonas aeruginosa ، E. coli و Candida albicans جداشده از ادرار، نشان داد که عصاره الکلی زنجبیل بیشترین اثر مهارکنندگی رشد میکروبی را دارا بود (۲۱).

در  مطالعه­ای اثر  عصاره برگ گیاه کنگر فرنگی در برابر باکتری­های Bacillus subtilis ، S. aureus، Agrobacterium tumefaciens، Micrococcus luteus، E. coli، S. typhimurium و P. aeruginosa، مخمرهای C. albicans، C.

lusitaniae، Saccharomyces cerevisiae و S. carlsbergensis، قارچ­های Aspergillus niger، Penicillium oxalicum، Mucor mucedo و Cladosporium cucumerinum مورد بررسی قرار گرفت و اثرات ضد میکروبی آنها به اثبات رسید (۳۷).

در مطالعه دیگری خاصیت ضد باکتریایی و اثر ضد چسبندگی ۲۵ گونه گیاه روی باکتری Helicobacter pylori بررسی گردید که از میان آنها زیره سبز، زیره سیاه، زنجبیل، چیلی، شیرین بیان، گل گاو زبان و پونه کوهی اثر قطعی ضدباکتریایی نشان دادند (۲۶). اضافه کردن عصاره کنگر فرنگی به محیط برخی از باکتری­های گونه سودوموناس که به پنی سیلین G و اریترومایسین مقاوم بودند، سبب توقف رشد باکتری­ها گردید (۸). در بررسی خواص ضد باکتریایی اسانس­های گیاهان خانواده Zingiberaceae گیاه زنجبیل بیشترین کارآیی را در بازدارندگی باکتری­هایS. aureus ،Bacillus cereus  وListeria monocytogenes داشت (۲۵).

در بررسی اثر ضد باکتریایی عصاره اتانولی، کلروفرمی و پترولیوم اتری زنجبیل بر ۱۳ نوع باکتری و سه نوع قارچ با استفاده از روش دیسک دیفیوژن، حلال اتانولی زنجبیل بیشترین تاثیر فعالیت عصاره روی قارچ­ها و باکتری­ها به­ویژه Vibrio parahemolyticus  را نشان داد (۱۶).

در تحقیقی اثر عصاره زنجبیل روی دو گونه از باکتری­های گرم منفی Vibrio alginolyticus و V. parahemolyticus آزمایش گردید و نتایج نشان داد که این عصاره بر V. alginolyticus بیش­ترین اثر ضد باکتریایی را دارد (۷).

بررسی خواص ضد میکروبی ضایعات کارخانه کنسرو کنگرفرنگی نشان داد که حداکثر فعالیت ضد میکروبی در عصاره متانولی فنل­های متصل  (برگچه­ها  و گل­ها) علیه باکتری­های گرم منفی به­دست می­آید (۱۱).

خسروی درانی و همکاران (۱۷) در بررسی خاصیت ضد میکروبی سه نوع عسل در ایران به همراه عصاره الکلی نعناع، آویشن و نیز عصاره و نشاسته زنجبیل درS. aureus ، Pseudomonas aeruginosa ،  E. coli و C. albicansبه این نتیجه رسیدند که  اثر مهاری عصاره آویشن بر باکتری­ها بیشتر از قارچ کاندیدا بود و عصاره زنجبیل به­طور معنی­داری بیشتر از مواد دیگر در مهار رشد باکتری­ها موثر بود.

هدف از این تحقیق مطالعه­ی مولکولی بیان ژن بیوفیلم icaD تحت اثر عصاره گیاهان زنجبیل و کنگر فرنگی در باکتری S. aureus بود.

مواد و روشها

تهیه عصاره گیاهان: کپسول 400 میلی­گرمی گیاه کنگر فرنگی با نام تیشوک (Tichoke capsule) و  کپسول 250 میلی­گرمی عصاره خشک ریشه گیاه زنجبیل با نام زینتوما (Zintoma capsule) از شرکت داروسازی گل دارو تهیه گردید. هر کپسول زینتوما محتوی 250 میلی‌گرم گرانول پودر ریزوم زنجبیل بود که معادل با 5/2 میلی‌گرم اسانس در هر کپسول است. مواد مؤثره این عصاره شامل جین‌جرول و شوگال و گلیکوزیدها شامل آماروپانین، اناروزورین می‌باشد. هر کپسول تیشوک نیز حاوی 400 میلی‌گرم عصاره خشک کنگر فرنگی (Cynara scolymu) مشتمل بر 20- 14 میلی‌گرم ماده مؤثره کلروژنیک اسید بود. از هر یک از مواد مذکور، محلول‌های آبی استوک 100 میلی­گرم در میلی­لیتر و 10 میلی­گرم در میلی­لیتر تهیه گردید.

کشت و جداسازی باکتری S. aureus  مورد مطالعه: کشت باکتری S. aureus  از دو سویه استاندارد (ATCC 25923) و سویه نمونه­گیری شده از پاتوژن به صورت کشت چمنی روی محیط کشت مولر هینتون آگار روی پلیت انجام گرفت. پلیت­های حاوی باکتری در انکوباتور به­مدت ۲۴ ساعت نگهداری و سپس در محیط مولر هینتون براث کشت داده شدند. 24 ساعت پس از کشت، کدورتی معادل محیط نیم مک فارلند آماده گردید.

آزمون اثر ضد میکروبی عصاره‌ها: برای این منظور از دیسک‌های بلانک استفاده گردید. هر دیسک بلانک در 50 میکرولیتر از عصاره گیاهی با غلظت 100 میلی­گرم در میلی­لیتر زنجبیل و کنگر فرنگی به­طور جداگانه آغشته شد و در محیط کشت مولر هینتون آگار حاوی باکتری، دیسک­گذاری انجام گردید. علاوه بر این از ترکیب 100 میلی‌گرم عصاره‌های زنجبیل و کنگر فرنگی با نسبت مساوی 1:1 نیز برای آغشته­سازی و دیسک­گذاری استفاده شد. سپس پلیت‌ها به مدت 24 ساعت در دمای 37 درجه سانتی‌گراد انکوبه شدند و قطر هاله عدم رشد اندازه­گیری گردید.

آزمون حداقل غلظت مهاری Minimum Inhibitory Concentration (MIC): آزمون میکروبیMIC  از عصاره گیاهی با استفاده از محیط مولر هینتون براث انجام شد. برای تهیه مولر هینتون براث، 1/2 گرم از پودر براث به ۱ لیتر آب مقطر انتقال یافت و بعد از حل شدن کامل با هیتر مغناطیسی به مقدار ۲ میلی­لیتر در هر یک از ۳۰ لوله آزمایش ریخته و اتوکلاو شد. سپس در لوله شماره ۱، به میزان 2 میلی­لیتر از عصاره  10 میلی­گرم در میلی لیتر (10000 میکروگرم بر میلی لیتر) گیاه مورد نظر (زنجبیل یا کنگر فرنگی) ریخته شد که در این حالت غلظت ۵۰۰۰ میکروگرم بر میلی­لیتر برای لوله شماره یک ایجاد گردید. ۲ میلی لیتر از لوله شماره ۱ به لوله شماره ۲، ۲ میلی­لیتر از لوله شماره ۲ به لوله شماره ۳ و به­ترتیب تا لوله شماره 8 انتقال یافت و عملیات رقیق­سازی سریالی انجام شد. لوله‌های شماره 9 و 10 نیز به­ترتیب به­عنوان کنترل منفی و مثبت در نظر گرفته شدند. به غیر از لوله کنترل منفی به بقیه لوله‌ها 200 میکرولیتر از محیط براث حاوی باکتری با کدورت معادل نیم مک فارلند اضافه گردید و در نهایت این لوله­ها در انکوباتور به مدت ۲۴ ساعت نگهداری شدند. از ۳۰ لوله آزمایش، ۱۰ لوله برای عصاره گیاه زنجبیل، ۱۰ لوله برای عصاره گیاه کنگر فرنگی و در نهایت ۱۰ لوله برای ترکیبی از عصاره­های هر دو گیاه در نظر گرفته شد. این مراحل برای دو سویه باکتری S. aureus  در نظر گرفته شد. 

آزمون حداقل غلظت کشندگی Minimum Bactericidal Concentration (MBC): بعد از ۲۴ ساعت از آزمون MIC، آزمون MBC انجام شد. در این آزمایش از نمونه­های لوله­های شماره 1 تا 8 استفاده گردید. این نمونه­ها در هشت پلیت جداگانه حاوی محیط کشت مولر هینتون آگار به صورت چمنی و یک­دست کشت داده شدند و بعد از آن به مدت ۲۴ ساعت پلیت‌ها از لحاظ رشد باکتری مورد بررسی قرار گرفتند.

استخراج DNA: برای استخراج DNA از دو سویه مورد مطالعه رشدیافته در محیط مولر هینتون براث استفاده گردید. مراحل کار با استفاده از کیت استخراج DNA باکتری‌های گرم مثبت شرکت پیشگامان و طبق دستورالعمل این کیت انجام گرفت.

بررسی وجود ژن icaD در سویه‌های مورد مطالعه: برای این منظور با استفاده از آغازگرهای اختصاصی از روش PCR استفاده گردید. توالی‌های جفت آغازگر مورد نظر در جدول ۱ آمده است (۵).

 

جدول ۱- توالی‌های آغازگرهای مورد مطالعه

نام آغازگر

توالی

Icad-F

ACCCAACGCTAAAATCATCG

Icad-R

GCGAAAATGCCCATAGTTTC

 

واکنش PCR ژن icaD با استفاده از مواد واکنش­گر و برنامه دمایی که به­ترتیب در جداول ۲ و 3 آمده است، صورت گرفت.

ارزیابی محصول PCR: برای این منظور، الکتروفورز انجام شد. با استفاده از بافر TBE و پودر آگارز، ژل ‌آگارز ۱٪ تهیه گردید و 5 میکرولیتر از محصولPCR  با پاورلود مخلوط و  به درون چاهک­ها  تزریق شد. در یک چاهک نیز 100 bp DNA Ladder تزریق شد. پس از الکتروفورز در ولتاژ 150 ولت، با قرار دادن ژل بر روی دستگاه UV Transilluminator، باندهای محصول PCR رؤیت و ارزیابی گردید.

جدول ۲- مواد واکنش‌گر مورد استفاده در PCR ژن‌ icaD

حجم (میکرولیتر)

واکنش­گر

15.5

آب مقطر

2.5

PCR  بافر (10X)

 1.5

MgCl2 (10mM)

1

dNTPs (10mM)

0.5

آغازگر مستقیم (10p.mol)

0.5

آغازگر معکوس  (10p.mol)

3

DNA الگو  

0.5

Taq polymerase (100U/

25

حجم کل

 

 

 

جدول 3- شرایط بهینه دمایی PCR ژن‌ icaD

دما

زمان

برنامه

94°C

5 دقیقه

واسرشت اولیه

35 سیکل

94°C

45 ثانیه

واسرشت

59°C

60 ثانیه

دمای اتصال آغازگر

72°C

45 ثانیه

گسترش آغازگر

72°C

5 دقیقه

گسترش نهایی

 

 

استخراج RNA: بر اساس نتایج حاصل از MIC و MBC، حداکثر غلظت عصاره‌های زنجبیل و کنگر فرنگی که باعث مهار و کشتن سویه‌های باکتریایی نمی‌شدند برای تیمار دو سویه مورد نظر در محیط براث باکتریایی معادل نیم مک فارلند استفاده گردید و پس از انکوباسیون در دمای 37 درجه سانتی‌گراد، استخراج RNA با استفاده از ترایزول شرکت ROJETechnologies، طبق دستورالعمل کیت و با رعایت شرایط استریل و در دمای پایین انجام شد.

سنتز cDNA: با استفاده از RNA­های استخراج شده و با استفاده از کیت سنتز شرکت Parstous biotechnology و طبق پروتکل این کیت، سنتز cDNA انجام شد. سنتز  cDNA با استفاده از آغازگرهای تصادفی هگزامر انجام شد و محصول این سنتز به­منظور بررسی میزان بیان ژن  icaD تحت تأثیر عصاره زنجبیل و کنگر فرنگی در هر دو سویه مورد نظر برای ریل تایم به­کار گرفته شد. در این روش از ژن 16s rRNA به­عنوان ژن مرجع استفاده گردید.

واکنش Real time PCR : برای این منظور 10 میکرولیتر SYBR Green Premix به هر میکروتیوب اضافه گردید. سپس ۱ میکرولیتر از آغازگر مستقیم و معکوس، 2 میکرولیتر از محلول cDNA و نیز 4 میکرولیتر  ROX Reference Dyeبه میکروتیوب­ها افزوده شد. برای رسیدن به حجم نهایی 20 میکرولیتر، 6 میکرولیتر آب فاقد نوکلئاز اضافه و مخلوط گردید و 18 میکرولیتر از این مخلوط به میکروتیوب‌های استریپ اضافه شد. آنالیز نسبی در سطح mRNA با سه تکرار انجام شد و برای تجزیه و تحلیل نتایج ریل تایم PCR از روش Pfaffian با e-DDCT و با مقایسه با ژن مرجع 16SrRNA استفاده گردید. جدول ۴ توالی آغازگرهای مربوط به ژن‌های icaD و 16SrRNA را نشان می­دهد (۵).

 

 

جدول ۴- آغازگرهای مورد استفاده ‌ژن مرجع 16SrRNA و ژن icaD (۳)

آغازگر

توالی

اندازه محصول

icaD-F

ACCCAACGCTAAAATCATCG

211  bp

icaD-R

GCGAAAATGCCCATAGTTTC

16SrRNA-F

GGGACCCGCACAAGCGGTGG

191  bp

16SrRNA-R

GGGTTGCGCTCGTTGCGGGA

 

 

نتایج

اثر ضد میکروبی عصاره­های گیاهی زنجبیل و کنگر فرنگی: برای انجام این آزمایش، روش دیسک­گذاری و آغشته­سازی دیسک­ها با محلول 100 میلی­گرم بر میلی­لیتر عصاره­های گیاهان زنجبیل و کنگر فرنگی و نیز ترکیبی از هردو عصاره برای هر دو سویه استاندارد و پاتوژن باکتری S. aureus   با دو تکرار به­کار رفت. قطر هاله عدم رشد در جدول ۵ نشان داده شده است.

 

 

جدول ۵- قطر هاله عدم رشد سویه­های مورد مطالعه باکتری تحت تیمار به روش دیسک­گذاری

قطر هاله عدم رشد (میلی­متر)

نوع تیمار با غلظت 100 میلی­گرم بر میلی­لیتر

نوع سویه S. aureus  

15

زنجبیل

سویه استاندارد

15

کنگر فرنگی

15

ترکیبی از هر دو گیاه

9

زنجبیل

سویه پاتوژن

8

کنگر فرنگی

0

ترکیبی از هر دو گیاه

 

 

آزمون MIC و MBC  تحت تیمار عصاره­های زنجبیل و کنگر فرنگی: با انجام این آزمون­ها مشخص شد که هر دو سویه استاندارد و پاتوژن S. aureus  مورد مطالعه در بالاترین غلظت به­کار رفته از عصاره­های زنجبیل و کنگر فرنگی یعنی غلظت 5000 میکروگرم بر میلی­لیتر، توان رشد دارند. بنابراین نتایج، غلظت 5000 میکروگرم بر میلی­لیتر عصاره­های زنجبیل و کنگر فرنگی برای بررسی بیان ژن icaD مورد استفاده قرار گرفت (شکل 1).

بررسی وجود ژن icaD : به­منظور اثبات وجود ژن icaD در سویه­های S. aureus  مورد مطالعه، آغازگرهای اختصاصی این ژن مورد استفاده قرار گرفت و پس از انجام PCR در شرایط بهینه دمایی و زمانی مطلوب، باندی در محدوده 210 جفت بازی  که مطابق با مقاله  (Atshan et al., 2012) بود، حاصل گردید.

 

 

شکل 1- (الف): سویه پاتوژن  استافیلوکوکوس اورئوس + عصاره کنگر فرنگی (T)

لوله شماره 1: غلظت 5000 میکروگرم بر میلی‌لیتر عصاره، لوله شماره 8: غلظت 39 میکروگرم بر میلی‌لیتر عصاره، لوله شماره 9: کنترل منفی (عصاره کنگر فرنگی بدون باکتری) لوله شماره 10: کنترل مثبت (باکتری بدون عصاره کنگر فرنگی)

 

شکل 1- (ب): سویه استاندارد استافیلوکوکوس اورئوس + کنگر فرنگی (T)

لوله شماره 1: غلظت 5000 میکروگرم بر میلی‌لیتر عصاره، لوله شماره 8: غلظت 39 میکروگرم بر میلی‌لیتر عصاره، لوله شماره 9: کنترل منفی (عصاره کنگر فرنگی بدون باکتری) لوله شماره 10: کنترل مثبت (باکتری بدون عصاره کنگر فرنگی)

 

شکل 1- (ج): سویه استاندارد استافیلوکوکوس اورئوس + زنجبیل (Z)

لوله شماره 1: غلظت 5000 میکروگرم بر میلی‌لیتر عصاره، لوله شماره 8: غلظت 39 میکروگرم بر میلی‌لیتر عصاره، لوله شماره 9: کنترل منفی (عصاره زنجبیل بدون باکتری) لوله شماره 10: کنترل مثبت (باکتری بدون عصاره زنجبیل)

 

شکل 1 - (د): سویه استاندارد استافیلوکوکوس اورئوس – کنگر فرنگی (T)  + زنجبیل (Z)

لوله شماره 1: غلظت 5000 میکروگرم بر میلی‌لیتر از ترکیب 1:1 هر دو عصاره، لوله شماره 8: غلظت 39 میکروگرم بر میلی‌لیتر ترکیب 1:1 هر دو عصاره، لوله شماره 9: کنترل منفی (نسبت مساوی دو عصاره گیاه بدون باکتری) لوله شماره 10: کنترل مثبت (باکتری بدون عصاره گیاه)

 

بررسی کیفیت استخراج RNA: پس از تیمار هر دو سویه استاندارد و پاتوژن S. aureus  با غلظت 5000 میکروگرم بر میلی لیتر عصاره زنجبیل، کنگر فرنگی و تیمار توأم عصاره­های زنجبیل و کنگر فرنگی، RNA کل استخراج گردید. شکل 2 کیفیت استخراج چند نمونه روی ژل آگارز را نشان می­دهد.

 

شکل 2- باندهای حاصل از استخراج RNA

بررسی بیان ژن   icaDدر سویه استاندارد: مقایسه میزان بیان ژن icaD در سویه استاندارد بین نمونه­های تیمار شده با عصاره زنجبیل، تیمار شده با کنگر فرنگی و تیمار توأم عصاره زنجبیل وکنگر فرنگی در نمودار حاصل از آنالیز نتایج ریل تایم نشان داد که  تمام تیمارهای مورد نظر باعث افزایش بیان ژن بیوفیلم icaD در سویه استانداردS. aureus  گردید. تیمار سویه استاندارد با عصاره زنجبیل منجر به افزایش  8/7 برابری بیان ژن icaD و تیمار این باکتری با کنگر فرنگی باعث افزایش 3/7 برابری بیان این ژن بیوفیلم شد. استفاده همزمان از عصاره زنجبیل و کنگر فرنگی، میزان بیان ژن بیوفیلم icaD را 8/2 برابر نمونه بدون تیمار افزایش داد (شکل 3).

 

شکل 3- اطلاعات حاصل از آنالیز نتایج ریل تایم سویه استاندارد S. aureus

بررسی بیان ژن   icaDدر سویه پاتوژن : بر اساس داده­های حاصل از آنالیز نتایج ریل تایم، میزان بیان ژن icaD در سویه پاتوژن بین نمونه­های تیمار شده با عصاره زنجبیل، تیمار شده با کنگر فرنگی و تیمار توأم عصاره زنجبیل و کنگر فرنگی،  بیان ژن icaD تحت تیمار عصاره زنجبیل در این سویه، تا  28درصد نمونه کنترل کاهش نشان داد. بیان این ژن تحت تیمار عصاره کنگر فرنگی، کاهش 90 درصدی نشان داد. به عبارت دیگر بیان این ژن به حدود 10 درصد نمونه کنترل رسید. تیمار همزمان سویه پاتوژن باکتری  S. aureusبا عصاره­های زنجبیل و کنگر فرنگی، کاهش 97 درصدی در بیان این ژن بیوفیلم نشان داد و بر این اساس باعث مهار بیان ژن بیوفیلم icaD تقریبا به­طور کامل گردید. آنالیز واریانس ANOVA داده‌های حاصل از بیان نسبی ژن با استفاده از آزمون دانکن در سطح احتمال 01/0 صورت گرفت. نتایج آنالیز ANOVA نشان داد که کاهش بیان ژن icaD در سویه پاتوژن تحت تأثیر عصاره‌های کنگر فرنگی و زنجبیل دارای اختلاف معنی دار (P<0.01) نسبت به نمونه کنترل می‌باشد (شکل 4).

 

 

شکل 4- اطلاعات حاصل از آنالیز نتایج ریل تایم سویه پاتوژن S. aureus

بحث

گیاهان دارویی از دیرباز برای درمان عفونت­های باکتریایی استفاده شده­اند. اخیرا به دلیل بروز مقاومت­های دارویی، به منابع گیاهی به­عنوان مخازن طبیعی توجه بیشتری شده است.

در این تحقیق، بررسی اثر ضد باکتریایی عصاره زنجبیل و کنگر فرنگی به روش انتشار از دیسک روی سویه استاندارد و نیز سویه پاتوژن باکتری S. aureus نشان داد که سویه استاندارد نسبت به عصاره­های مذکور از حساسیت بیشتری برخوردار است درحالی که سویه پاتوژن مقاومت بیشتری را نشان می­دهد. در مطالعه­ای که مؤمنی و زمانزد (۲۱) به بررسی اثرات ضد میکروبی زنجبیل بر روی چند نمونه باکتری از جمله S. aureus پرداختند نشان داده شد که S. aureus نسبت به عصاره الکلی زنجبیل حساس است ولی نسبت به عصاره آبی زنجبیل نیمه­حساس می­باشد.

در پژوهشی دیگر مشخص گردید که عصاره زنجبیل قادر است در محیط کشت S. aureus، هاله عدم رشدی به قطر حدود 12 – 8 میلی­متر ایجاد نماید (۱۵). همچنین فعالیت ضد باکتریایی عصاره الکلی زنجبیل و ایجاد هاله عدم رشد به قطر حدود 14 – 13 میلی­متر در مطالعه یاسن و ابراهیم (۳۶) گزارش شده است. این مطالعات با تحقیق حاضر هم­سو بودند. کادر و همکاران (۱۶) با بررسی اثر ضد باکتریایی عصاره اتانولی، کلروفرمی و پترولیوم اتری زنجبیل بر ۱۳ نوع باکتری و سه نوع قارچ با استفاده از روش دیسک دیفیوژن، تاثیر زنجبیل بر فعالیت عصاره روی قارچ­ها و باکتری­ها به­ویژه Vibrio parahemolyticus  را نشان دادند.  کووان (۷) نیز در تحقیق خود اثر عصاره زنجبیل روی دو گونه از باکتری­های گرم منفی Vibrio alginolyticus و V. parahemolyticus را اثبات نمود. در مورد تأثیر ضد باکتریایی کنگر فرنگی در مطالعه­ای (۳۸) به تأثیر عصاره الکلی کنگر فرنگی بر رشد باکتری S. aureus، اشاره شد که با تحقیق حاضر سازگار است.

در تحقیق حاضر عصاره­های زنجبیل و کنگر فرنگی با غلظت 100 میلی‌گرم بر میلی‌لیتر باعث ایجاد هاله عدم رشد به قطر 15 میلی­متر در محیط حاوی سویه استاندارد S. aureus شدند. در مورد سویه پاتوژن نیز هاله­ای به قطر حدود 9 – 8 میلی­متر مشاهده گردید. طبق نتایج به­دست آمده از آزمون MIC در این پژوهش، بالاترین غلظت به­کار رفته یعنی 5000 میکروگرم بر میلی­لیتر عصاره­های زنجبیل و کنگر فرنگی اثرات بازدارندگی رشدی بر سویه استاندارد و پاتوژن نداشتند. با توجه به این که در آزمون دیسک­گذاری از غلظت 100 میلی­گرم بر میلی­لیتر (100000 میکروگرم بر میلی­لیتر) عصاره­ها استفاده شد و هاله عدم رشد در این غلظت مشاهده گردید بنابراین حداقل غلظت بازدارندگی این عصاره­ها احتمالا در غلظت­های بالاتر از 5000 میکروگرم بر میلی­لیتر خواهد بود. از آنجا که هدف اصلی این پژوهش، بررسی اثر عصاره­های مذکور بر بیان ژن­های بیوفیلم بود، با این آزمون اطمینان حاصل شد که غلظت 5000 میکروگرم بر میلی­لیتر عصاره­ها منجر به مرگ باکتری­های مورد نظر نشده و امکان بررسی تغییرات بیان ژن وجود خواهد داشت و به همین دلیل بررسی MIC در غلظت­های بالاتر عصاره­ها غیرضروری به نظر رسید.

هدف اصلی این تحقیق، بررسی تأثیر عصاره زنجبیل و کنگر فرنگی بر میزان بیان ژن بیوفیلم icaD بود. طبق تحقیقات نیکولیک و همکاران (۲۴)، اثر ضد بیوفیلمی عصاره الکلی زنجبیل روی باکتری­هایی نظیر Pseudomonas aeruginosa، Proteus mirabilis و E. coli به اثبات رسیده است. کیم و پارک (۱۸) به تأثیر ضد بیوفیلمی عصاره زنجبیل روی P. aeruginosa اشاره کردند. گاد و همکاران (۱۲) اذعان داشتند که تمام سویه­های S. aureus تولیدکننده بیوفیلم، دارای ژن­های icaA و icaD هستند. همچنین در مطالعه دیگری (۱۳) اثر ضد بیوفیلمی زنجبیل روی 25 سویه از S. aureus بررسی و نشان داده شد که 23 سویه از آنها دارای توانایی تولید بیوفیلم و واجد ژن icaD می­باشند. تحقیقات بیشتری در زمینه اثر ضد بیوفیلمی زنجبیل و نیز بررسی وجود ژن­های مرتبط با تولید بیوفیلم وجود دارد ولی در مورد تأثیر عصاره­های زنجبیل و کنگر فرنگی بر تغییرات بیان ژن بیوفیلم icaD گزارشی دیده نشد.

در پژوهش حاضر با استفاده از تکنیک PCR و آغازگرهای اختصاصی، وجود ژن icaD در هر دو سویه S. aureus مورد مطالعه، اثبات شد. بررسی نتایج حاصل از Real time PCR  نشان داد که میزان بیان ژن icaD در سویه پاتوژن به­ترتیب تحت تیمار زنجبیل به 28 درصد، تحت تیمار کنگر فرنگی به 10 درصد و تحت تاثیر ترکیبی از این دو عصاره به ۳۰ درصد کاهش یافت که این نتایج در مورد سویه استاندارد بسیار متفاوت است زیرا در سویه استاندارد تیمار زنجبیل، کنگر فرنگی و ترکیبی از این دو گیاه به­ترتیب باعث افزایش 8/7 ، 3/7 و 8/2 برابری شدند. علاوه بر این در این پژوهش، تفاوت ژنتیکی دو سویه ATCC 25923 و سویه پاتوژن در مورد ژن icaD و در مورد توالی‌های تنظیمی این ژن اثبات گردید که این تفاوت در میزان بیان ژن می‌تواند ناشی از جهش در ژن icaD یا جهش در نواحی تنظیمی این ژن باشد. سویه‌های پاتوژن نسبت به سویه‌های استاندارد S. aureus می‌توانند تفاوت‌های ژنتیکی بسیار زیادی داشته باشند که این تفاوت عمدتا حاصل جهش‌های ژنتیکی است. لازم به ذکر است که ژن icaD از جمله ژن‌های حیاتی باکتری نیست بنابراین ممکن است غلظت بالای عصاره‌ها در هر دو سویه استاندارد و پاتوژن مانع رشد و تکثیر باکتری شود ولی این احتمال وجود دارد که سویه‌های استاندارد و پاتوژن بر اثر جهش توالی‌های خاص از جمله ژن icaD یا نواحی تنظیمی این ژن دچار تفاوت شده باشند و پاسخ ژن icaD نسبت به عصاره‌های گیاهی در سویه استاندارد و پاتوژن باکتری مورد مطالعه نیز متفاوت باشد و عصاره‌های گیاهی به­کار رفته در سویه استاندارد به­عنوان فعال کننده و در سویه پاتوژن به­عنوان مهارکننده ژن بیوفیلم icaD عمل نمایند.

با توجه به این که یکی از راه‌های کسب مقاومت باکتری‌ها نسبت به آنتی‌بیوتیک، تولید بیوفیلم است شاید استفاده از عصاره‌های گیاهی زنجبیل و کنگر فرنگی بتواند در اثربخشی آنتی‌بیوتیک‌ها بسیار مؤثر واقع شود.

نتیجه گیری کلی

در مجموع بر اساس نتایج این پژوهش می­توان گفت که زنجبیل به­عنوان یک عامل ضد باکتریایی برای درمان  S. aureus سویه پاتوژن عمل کرده و از بیان ژن icaD و در نتیجه تشکیل بیوفیلم جلوگیری می­کند. عصاره کنگر فرنگی خواص ضد میکروبی خوبی از خود نشان داد. این عصاره طبیعی روی S. aureus هم اثربخش بود. عصاره کنگر فرنگی همانند عصاره زنجبیل توان کاهش بیان ژن بیوفیلم icaD را داشت اما ترکیب عصاره­های کنگر فرنگی و زنجبیل قدرت بیان ژن بیوفیلم icaD را به­طور قابل­توجهی کاهش داد. با توجه به این که تولید بیوفیلم باعث مقاومت باکتری نسبت به مواد ضد میکروبی می­شود، استفاده همزمان عصاره کنگر فرنگی و زنجبیل در کاهش تولید بیوفیلم و از بین بردن این باکتری پاتوژن بسیار ارزشمند خواهد بود.

  • ۱- اطمینانی، ف.، اطمینانی، ا. ۱۳۹۹. فعالیت ضد باکتریایی عصاره­های هیدروالکلی گیاه آویشن و به لیمو بر باکتری  Pseudomonas syringae در شرایط آزمایشگاهی. مجله پژوهش­های سلولی و ملکولی مجله، جلد ۳۳، شماره ۱، ۱-۸.

    ۲- چوری، م.، بوذرپور، س.، مرادی، ع.، جرجانی، ع. ۱۳۹۷. بررسی اثر نانوکورکومین دندروزومی بر بیان ژن­های POU5F1و NANOG در رده سلولی Caco-2 سرطان کولون. مجله پژوهش­های سلولی و ملکولی مجله، جلد ۳۱، شماره ۳، ۲۹۲-۳۰۱.

     

    3- Anuar, N.S., Zahari, S.S., Taib, I.A., Rahman, M.T. 2008. Effect of green and ripe Carica papaya epicarp extracts on wound healing and during pregnancy. Food and Chemical Toxicology 46 (7): 2384-2389.

    4- Archer, N.K., Mazaitis, M.J., Costerton, J.W., Leid, J.G., Powers, M.E., Shirtliff, M.E. 2011. Staphylococcus aureus biofilms: properties, regulation, and roles in human disease. Virulence 2 (5): 445-459.

    5- Atshan, S.S., Nor Shamsudin, M., Sekawi, Z., Than. L.T.L., Awang Hamat, R., Karunanidhi, A., Alreshidi, M.A., Ghaznavi-Rad, E., Ghasemzadeh-Moghaddam, H., Chong Seng, J.S., Jeevajothi Nathan, J., Chong, P.P. 2012. Prevalence of adhesion and regulation of biofilm-related genes in different clones of Staphylococcus aureus. Journal of Biomedicine and Biotechnology DOI: 10.1155/2012/976972.

    6- Cerca, N., Pier, G.B., Vilanova, M., Oliveira, R., Azeredo, J. 2005. Quantitative analysis of adhesion and biofilm formation on hydrophilic and hydrophobic surfaces of clinical isolates of Staphylococcus epidermidis. Research in Microbiology 156 (4): 506-514.

    7- Cowan, M.M. 1999. Plant products as antimicrobial agents. Clinical Microbiology Reviews 12 (4): 564-582.

    8- Darwish, R.M., Aburjai, T., Al-Khalil, S., Mahafzah, A. 2002. Screening of antibiotic resistant inhibitors from local plant materials against two different strains of Staphylococcus aureus. Journal of Ethnopharmacology 79 (3): 359-364.

    9- Donlan, R.M., Costerton, J.W. 2002. Biofilms: survival mechanisms of clinically relevant microorganisms. Clinical Microbiology Reviews 15 (2): 167-193.

    • Fitzpatrick, F., Humphreys, H., O'Gara, J.P. 2005. Evidence for icaADBC-independent biofilm development mechanism in methicillin-resistant Staphylococcus aureus clinical isolates. Journal of Clinical Microbiology 43(4): 1973-1976.

    11- Gaafar, A., Salama, Z. 2013. Phenolic compounds from artichoke (Cynara scolymus L.) by-products and their antimicrobial activities. Journal of Biology, Agriculture and Healthcare 3: 1-6.

    12- Gad, G.F.M., El-Feky, M.A., El-Rehewy, M.S., Hassan, M.A., Abolella, H., El-Baky, R.M.A. 2009. Detection of icaA, icaD genes and biofilm production by Staphylococcus aureus and Staphylococcus epidermidis isolated from urinary tract catheterized patients. The Journal of Infection in Developing Countries 3 (05): 342-351.

    13- Hamasalih, R.M., Abdulrahman, Z.F.A. 2020. Antibiofilm potency of Ginger (Zingeber officinale) and quercetin against Staphylococcus aureus isolated from urinary catheterized  patients. Applied Ecology and Environmental Research 18(1), 219-236.

    14- Harvey, J., Gilmour, A. 1988. Isolation and characterization of staphylococci from goats milk produced in northern Ireland. Letters in Applied Microbiology 7:79–82.

    15- Islam, K., Rowsni, A.A., Khan, M.M., & Kabir, M.S. 2014. Antimicrobial activity of ginger (Zingiber officinale) extracts against food-borne pathogenic bacteria. International Journal of Science, Environment and Technology 3(3): 867-871.

    16- Kader, G., Nikkon, F., Rashid, M.A., Yeasmin, T. 2011. Antimicrobial activities of the rhizome extract of Zingiber zerumbet Linn. Asian Pacific Journal of Tropical Biomedicine 1(5): 409-412.

    17- Khosravi-Darani, K., Khaksar, R., Esmaeili, S., Seyed-Reihani, F., Zoghi, A., Shahbazizadeh, S. 2013. Antifungal and anti-bacterial synergistic effects of mixture of honey and herbal extracts.  Zahedan Journal of Research in Medical Sciences 15 (8): 30-33.

    18- Kim, H.S., Park, H.D. 2013. Ginger extract inhibits biofilm formation by Pseudomonas aeruginosa PA14. PloS One 8(9): e76106.

    19- McCarthy, H., Rudkin, J.K., Black, N.S., Gallagher, L., O'Neill, E., O'Gara, J.P. 2015. Methicillin resistance and the biofilm phenotype in Staphylococcus aureus. Frontiers in Cellular and Infection Microbiology 5(1): 1-9.

    20- Mocelin, R., Marcon, M., Santo, G.D.,  Zanatta, L., Sachett, A., Schönell, A.P., Bevilaqua, F., Giachini, M., Chitolina, R., Wildner, S.M. 2016. Hypolipidemic and antiatherogenic effects of Cynara scolymus in cholesterol-fed rats. Revista Brasileira de Farmacognosia 26 (2): 233-239.

    21- Momeni, L., Zamanzad, B. 2010. Evaluation of antimicrobial effects of onion and ginger extracts on some bacteria and Candida albicans isolated infected urinary systems. Journal of Shahrekord University of Medical Sciences 11 (4): 81-87.

    23- Nelson, C., Regiland, A. 2007. Antimicrobial properties of extracts of Allium cepa and Zingiber officinale (ginger) on Escherchia coli, Salmonella typhi and Bacillus subtilis. International Journal of Tropical Medicine 3 (2): 1540-1470.

    24- Nikolić, M., Vasić, S., Đurđević, J., Stefanović, O., Čomić, L. 2014. Antibacterial and anti-biofilm activity of ginger (Zingiber officinale (Roscoe)) ethanolic extract. Kragujevac Journal of Science (36), 129-136.

    25- Norajit, K., Laohakunjit, N., Kerdchoechuen, O. 2007. Antibacterial effect of five Zingiberaceae essential oils. Molecules 12 (8): 2047-2060.

    26- O’Mahony, R., Al-Khtheeri, H., Weerasekera, D., Fernando, N., Vaira, D., Holton, J., Basset, C. 2005. Bactericidal and anti-adhesive properties of culinary and medicinal plants against Helicobacter pylori. World Journal of Gastroenterology 11(47): 7499-7507.

    27- Omoya, F., Akharaiyi, F. 2011. Mixture of honey and ginger extract for antibacterial assessment on some clinical isolates. International Journal of Pharmaceutical and Biomedical Research 2 (1): 39-47.

    28- Rajasekar, T., Usharani, J., Sakthivel, M., Deivasigamani, B. 2011. Immunostimulatory effects of Cardiospermum halicacubum against Vibrio parahaemolyticus on tiger shrimp Penaeus monodon. Journal of Chemical and Pharmaceutical Research 3 (5): 501-513.

    29- Raphael, T., Kuttan, G. 2003. Immunomodulatory activity of naturally occurring monoterpenes carvone, limonene, and perillic acid. Immunopharmacology and Immunotoxicology 25 (2): 285-294.

    30- Roberts, S., O'Shea, K., Morris, D., Robb, A., Morrison, D., Rankin, S. 2005. A real-time PCR assay to detect the Panton Valentine Leukocidin toxin in staphylococci: screening Staphylococcus schleiferi subspecies coagulans strains from companion animals. Veterinary Microbiology 107(1-2): 139-144.

    31- Rosenberg, M. 1981. Bacterial adherence to polystyrene: a replica method of screening for bacterial hydrophobicity. Applied and Environmental Microbiology 42 (2): 375-377.

    33- Srinivasan, D., Nathan, S., Suresh, T., Perumalsamy, P.L. 2001. Antimicrobial activity of certain Indian medicinal plants used in folkloric medicine. Journal of Ethnopharmacology 74 (3): 217-220.

    34- Stehling, E.G., da Silveira, W.D., da Silva Leite, D. 2008. Study of biological characteristics of Pseudomonas aeruginosa strains isolated from patients with cystic fibrosis and from patients with extra-pulmonary infections. Brazilian Journal of Infectious Diseases 12 (1): 86-88.

    35- Taj, Y., Essa, F., Aziz, F., Kazmi, S.U. 2012. Study on biofilm-forming properties of clinical isolates of Staphylococcus aureus. The Journal of Infection in Developing Countries 6 (05): 403-409.

    36- Yassen, D., Ibrahim, A.E. 2016. Antibacterial activity of crude extracts of ginger (Zingiber officinale Roscoe) on Escherichia coli and Staphylococcus aureus: A study in vitro. Indo American Journal of Pharmaceutical Research 6 (06): 5830-5835.

    37- Zhu, X., Zhang, H., Lo, R. 2004. Phenolic compounds from the leaf extract of artichoke (Cynara scolymus L.) and their antimicrobial activities. Journal of Agricultural and Food Chemistry 52(24): 7272-7278.

    38- Zhu, X., Zhang, H., Lo, R., Lu, Y. 2005. Antimicrobial activities of Cynara scolymus L. leaf, head, and stem extracts. Journal of Food Science 70 (2): 149-152.

Volume 35, Issue 3
October 2022
Pages 405-415
  • Receive Date: 03 September 2020
  • Revise Date: 11 November 2020
  • Accept Date: 13 January 2021
  • First Publish Date: 18 January 2021