Evaluation of transient expression of AS1 and 4'CGT genes in African violets petals by agroinfiltration for Production new color in the flower

Document Type : Research Paper

Authors

1 Department of Plant Breeding and Biotechnology, University of Zabol, Zabol 98613-35856, Iran

2 Assistant Professor of Department of Plant Breeding and Biotechnology, University of Zabol,

3 Department of Plant Pathology, University of Zabol, Zabol, Iran.

4 Genetic and Agricultural Biotechnology Institute of Tabarestan, University of Agriculture Science and Natural Resources, Sari, Iran

Abstract

The production of ornamental cultivars with new colors is the main goal in the flower and ornamental plants industry. African violet is well known commercially and available in different colors except yellow flower. The aim of this study was to change the color of A. violet petals and to produce the biosynthetic pathway of auron pigment through genetic manipulation of AS1 and 4'CGT genes. To this end, t genes were isolated from Antirrhinum majus petals yellow using PCR with specific primers and ligated into the expression vectors pCAMBIA1304 and pBI121, respectively. Recombinant pBI121+4'CGT and pCAMBIA1304+AS1 vectors were confirmed using colony PCR, enzyme digestion, sequencing and comparative analysis in the database. They were then transferred to Agrobacterium strain LBA4404 by electroporation method and was examined in the petals of A. violet using a temporary expression system. In this system, Agrobacterium suspension carrying the gene structure was injected using a syringe at the base of the petals.. Morphological results after 3 days clearly showed discoloration of white to pale yellow petals and no change was observed in control petals. PCR analysis and light microscopy confirmed gene expression and phenotypic changes, respectively. Also, aureusidin-6-O-glucoside (AOG) was detected in transgenic petals using HPLC-DAD-MSn. By using this system, the gene structure can be transferred to ornamental plants with more confidence for permanent transgenic. In addition, this research can open the way for engineering the creation of yellow color in ornamental plant species that do not have this type of color.

Keywords

Main Subjects

ارزیابی بیان موقت ژن های AS1 و 4'CGT در ﮔﻠﺒﺮگ­ﻫﺎی بنفشه آفریقایی ﺑﺎ سیستم اﮔﺮواﯾﻨﻔﯿﻠﺘﺮﯾﺸﻦ جهت تولید رنگ جدید در گل

امیر رجبی1، لیلا فهمیده2*، مجتبی کیخاصابر3 و ولی­اله قاسمی عمران4

1 ایران، زابل، دانشگاه زابل، دانشکده کشاورزی، گروه اصلاح نباتات و بیوتکنولوژی

2 ایران، گرگان، دانشگاه علوم کشاورزی و منابع طبیعی گرگان، گروه اصلاح نباتات و بیوتکنولوژی

3 ایران، زابل، دانشگاه زابل، دانشکده کشاورزی، گروه گیاهپزشکی

4 ایران، ساری، دانشگاه علوم کشاورزی و منابع طبیعی ساری، پژوهشکده ژنتیک و زیست فناوری طبرستان

تاریخ دریافت: 15/07/1399          تاریخ پذیرش: 24/08/1399

چکیده

تولید ارقام زینتی با رنگ­های جدید هدف اصلی در صنعت گل و گیاهان زینتی است. بنفشه آفریقایی از لحاظ تجاری به خوبی شناخته شده و در رنگ­های مختلفی به جز گل زرد موجود است. این پژوهش با هدف تغییر رنگ گلبرگ­های بنفشه آفریقایی و تولید مسیر بیوسنتزی رنگدانه آئورون از طریق دست­ورزی ژنتیکی ژنهای AS1 و 4'CGT انجام شد. بدین منظور­، این ژن­ها با استفاده از PCR با آغازگرهای اختصاصی از گلبرگ گل میمون زرد جداسازی و بترتیب در ناقل بیانی pCAMBIA1304 وpBI121  اتصال گردید. پلاسمیدهای نوترکیب  pBI121+4'CGTوAS1 ­pCAMBIA1304+ با استفاده از بررسی­های Colony PCR، هضم آنزیم، توالی­یابی و هم­ردیف سازی آن­ها در بانک اطلاعاتی، مورد تایید قرار گرفت. سپس به روش الکتروپوریشن به آگروباکتریوم سویه LBA4404 منتقل و با استفاده از سیستم بیان موقت در گلبرگ­های گیاه بنفشه آفریقایی مورد بررسی قرار گرفت. در این سیستم سوسپانسیون آگروباکتریوم حامل سازه­ ژنی با استفاده از سرنگ در پایه گلبرگ­ها تزریق شد. نتایج مورفولوژیکی پس از 3 روز به وضوح تغییر رنگ گلبرگ­های سفید به زرد کم رنگ را نشان داد و هیچ تغییری در گلبرگ­های شاهد مشاهده نشد. آنالیزPCR  و مشاهده با میکروسکوپ نوری بترتیب بیان ژن و تغییرات فنوتیپی را تایید کردند. همچنین آئوروسیدین-6-او- گلوکزید (AOG) با استفاده از HPLC-DAD-MSn در گلبرگ­های تراریخت شناسایی شد. با بکارگیری این سیستم می­توان سازه ژنی را با اعتماد بیشتری برای تراریختگی دائم به گیاهان زینتی انتقال داد. همچنین این پژوهش می­تواند راهی را برای مهندسی ایجاد رنگ زرد در گونه­های گیاهان زینتی که فاقد این نوع رنگ هستند باز نماید.

واژه­های کلیدی: آئورون، آنتوسیانین، رنگ گل، گیاهان زینتی، مهندسی ژنتیک

* نویسنده مسئول، تلفن: 01732251672 ، پست الکترونیکی: l.fahmideh@gau.ac.ir

مقدمه

 

بنفشه آفریقایی (Saintpaulia ionantha) از خانواده Gesneriaceae، یکی از مهم­ترین گیاهان زینتی تجاری محبوب با ارقام بسیار در سراسر جهان بشمار می­رود (25). امروزه پرورش این گونه گیاهی در حوزه علوم باغبانی به شکل صنعت در آمده است. همچنین تا سال 2017 حدود 25 گونه در این جنس با رنگ­های متنوع گل­ گزارش شده است (24) که فاقد واریته­های زرد رنگ و نارنجی هستند (25). از جمله موفقیت­های حاصل از بکارگیری مهندسی ژنتیک در اصلاح گیاهان زینتی، می­توان به ایجاد رنگ­های ویژه نوین در گل­های زینتی اشاره کرد (17). ﺗﻨﻮع در رﻧﮓ ﮔﻞ ﺑﺎ اﺳﺘﻔﺎده از ﻣﻬﻨﺪﺳﻲ ژﻧﺘﻴـﻚ ﺑـﺮ ایجاد ﺗﻐﻴﻴﺮ در ﻣﺴﻴﺮﻫﺎی ﻣﺘﺎﺑﻮﻟﻴﻜﻲ ﺗﻮﻟﻴﺪ ﻓﻼوﻧﻮﺋﻴﺪﻫﺎ ﻣﺘﻤﺮﻛﺰ ﺷﺪه اﺳﺖ (16). رنگدانه­ها در گیاهان عالی، در چهار گروه بزرگ کلروفیل­ها، کاروتنوئیدها، فلاونوئیدها (آنتوسیانین­ها) و بتالائین­ها قرار دارند (6، 23).

همچنان که در شکل 1 نشان داده شده است، مسیر بیوسنتزی فلاونوئیدها یکی از گسترده­ترین مسیرهای تحقیق در متابولیسم گیاهی است که از مسیر فنیل پروپانوئیدی و از اسیدآمینه فنیل آلانین ساخته می­شوند (5). اولین مرحله در ساخت فلاونوئیدها، تولید ترکیب واسطه­ای مهم، به نام تتراهیدروکسی چالکون (Tetrahydroxy chalcone) (THC) توسط آنزیم چالکون سنتاز (Chalcone synthase)(CHS)  می­باشد. ­تترا هیدروکسی چالکون به وسیله آنزیم چالکون ایزومراز (Chalcone isomerase) (CHI) به نارینجنین (Naringenin) تبدیل می­شود (14). با وجود تعداد زیادی از آنتوسیانین­ها و تنوع رنگ گل، تنها شش کلاس اصلی آنتوسیانیدین وجود دارد: پلارگونیدین، سیانیدین، پونیدین، دلفینیدین، پتونیدین و مالویدین. دارای طیف گسترده­ای از رنگ­ها، از زرد کم رنگ تا آبی هستند (26). گل­های به رنگ آبی/بنفش حاوی آنتوسیانین­های مبتنی بر دلفینیدین 3-گلوکوزید­­، گل­های قرمز/قرمز حاوی آنتوسیانین­های غنی از سیانیدین 3-گلوکوزید و گل­های نارنجی/ قرمز آجری حاوی آنتوسیانین­های مبتنی بر پلارگونیدین 3-گلوکوزید هستند (29).

آئورون (Aurone)، یک کلاس از فلاونوئیدهای کمیاب می­باشد که گل­های زرد روشن­تری را نسبت به چالکون­ها می­دهد و در تعداد محدودی از گونه­ها مانند گل شاه اشرفی یا ستاره (Cosmos bipinnatus)، گُل شَصت‌عَروسان (­لیمونیوم) و گل میمونی (Antirrhinum majus) یافت می­شود (23). تشکیل آئوریسیدین و براکتیاتین بترتیب از تترا هیدروکسیلاز چالکون و پنتا هیدروکسیلاز چالکون مشتق شده است که یک فرایند تک آنزیمی کاتالیز شده توسط همان آنزیم آئوریسیدین سنتاز را نشان می­دهد (18). AS1 (Aureusidin synthase) و4'CGT (Chalcone 4'-O-glucosyltransferase)  ژنهای مهم درگیر در مسیر بیوسنتزی رنگدانه­ها از گیاه گل میمون زرد رنگ است که در فرایند بالا برای بیان مسیر بیوسنتزی آئورون ضروری است (شکل 1).

از آنجا که انتقال ژن و باززایی بیشتر گیاهان عالی زمان­بر و پرهزینه است، بنابراین ﺑﯿﺎن ﻣﻮﻗﺖ ژنﻫﺎی ﺑﯿﮕﺎﻧﻪ در ﺑﺎﻓﺖﻫﺎی ﮔﯿﺎﻫﯽ، روﺷﯽ ارزﺷﻤﻨﺪ در ﺑﯿﻮﺗﮑﻨﻮﻟﻮژی ﮔﯿﺎﻫﯽ اﺳﺖ و ﺑﺮای آﻧﺎﻟﯿﺰ ﻋﻤﻠﮑﺮد ژن در زﻣﺎن ﮐﻮﺗﺎه روش ﮐﺎرآﻣﺪی ﻣﯽﺑﺎﺷﺪ. اﯾﻦ روش ﺳﺮﯾﻊ، اﻧﻌﻄﺎفﭘﺬﯾﺮ، ﺳﺎده، ﺑﯽﻧﯿﺎز ﺑﻪ ﮐﺸﺖﺑﺎﻓﺖ و در ﺑﺎﻓﺖﻫﺎی ﺗﻤﺎﯾﺰ ﯾﺎﻓﺘﻪ ﻗﺎﺑﻞ اﺟﺮا ﺑﻮده و ﻫﻤﭽﻨﯿﻦ ﺗﺤﺖ ﺗﺄﺛﯿﺮ ﻣﺤﯿﻂ ﻧﯿﺴﺖ (7). آزﻣﻮن­ﻫﺎی ﺑﯿﺎن ﻣﻮﻗﺖ ژن (سیستم اﮔﺮواﯾﻨﻔﯿﻠﺘﺮﯾﺸﻦ) بعنوان ﯾﮏ راﻫﮑﺎر ﻣﻨﺎﺳﺐ ﺑﺮای ﭘﯿﺶ­ﺑﯿﻨﯽ وﺿﻌﯿﺖ ﺗﺮارﯾﺨﺘﯽ ﭘﺎﯾﺪار ﺑﮐﺎر ﻣﯽ­رود و اﻣﮑﺎن ﺑﺮرﺳﯽ ﺑﯿﺎن و ﻋﻤﻠﮑﺮد ﺑﺮﺧﯽ از ژن­ﻫﺎ را در ﭼﻨﺪ روز ﻓﺮاﻫﻢ می­نماید (28).

ﻫﺮ ﭼﻨﺪ ﮐﻪ اﻣﺮوزه ﻫﻤﭽﻨﺎن از اﯾﻦ روش ﺑﺮای ﺑﺮرﺳﯽ ﻣﮑﺎﻧﯿﺰم ﺧﺎﻣﻮﺷﯽ ژن ﺑﺎ ﺗﺤﺮﯾﮏ وﯾﺮوس ﺑﻬﺮه­ﮔﯿﺮی ﻣﯽﺷﻮد (31). در حالت بیان پایدار ژن و تراریخت کردن با آگروباکتریوم، T-DNA حامل ژن یا ژن­های مورد نظر با ژنگان میزبان تلفیق می­شود. در حالی که در بیان موقت، نسخه­هایی از T-DNA تلفیق نشده در هسته یاخته­های میزبان وارد شده و می­توانند 1000 مرتبه بیشتر از حالت پایدار بیان شوند (11). همچنین می­توان با این روش میزان بیان ژن­ها را در یک زمان کوتاه بدون نیاز به باززایی یاخته­های تراریخت، ارزیابی کرد. از طرف دیگر این روش برای بیان ژن­های نسبتا بزرگ (بزرگتر از kb 2) هم مناسب است (11). در پژوهشی با استفاده از سیستم بیان موقت اگرواینفیلتریشن و با انتقال دو سازه ژنی فلاونوئید­ʹ­3،ʹ5-هیدروکسیلاز از گل اطلسی و DFR از زنبق در گلبرگ­های ژاله، رنگ آبی در کلاله و دانه­های گرده ایجاد شد (10). در پژوهشی دیگر با استفاده از سیستم بیان موقت و با انتقال سازه­های تک ژنی (حمل­کننده ژن­ فلاونوئید­ʹ­3،ʹ5-­هیدروکسیلاز از گل بنفشه) و دو ژنی (حمل­کننده ژن­ فلاونوئید­ʹ­3،ʹ5- هیدروکسیلاز از گل بنفشه و ژن DFR از زنبق هلندی) به ﮔﻠﺒﺮگ­ﻫﺎی ﮔﻞ ژاﻟﻪ ﺗﻮﻟﯿﺪ دﻟﻔﯿﻨﯿﺪﯾﻦ مشاهده شد (15).

 

شکل 1- مسیر زیست ساخت فلاونوئیدها  (آئورون) از اسید آمینه فنیل آلانین برای ایجاد رنگ گل در گیاهان زینتی (18).

 

با وجود پالت بزرگ رنگی موجود در میان گونه­های بنفشه آفریقایی، تغییر رنگ گل توسط مهندسی ژنتیک هنوز در بنفشه آفریقایی گزارش نشده است. اگر چه منابع غنی در ارقام گیاه زینتی بنفشه آفریقایی با رنگ­های متنوع وجود دارد ولی فاقد واریته زرد رنگ است. بنابراین با توجه به محبوبیت گیاه زینتی بنفشه آفریقایی در میان گل­های زینتی، در صورت موفقیت و دستیابی به گلبرگ­هایی با رنگ نوین زرد، گیاه زینتی مورد نظر از لحاظ تجاری بسیار با ارزش خواهد شد و می­تواند دارای اهمیت قابل توجهی در بازار باشد. لذا این پژوهش به مطالعه‌ی تغییر رنگ گل بنفشه آفریقایی و تولید مسیر بیوسنتزی رنگدانه آئورون با استفاده از سیستم اگرواینفیلتریشن می­پردازد. اهداف این پژوهش عبارتند: جداسازی ژن­های درگیر در مسیر بیوسنتزی آئورون در گل میمون­، ساخت سازه­های ژنی­ pBI121+4'CGT­و pCAMBIA1304+AS1  و انتقال دو سازه ژنی با هم به آگروباکتریوم سویه LBA4404، تغییر مسیر بیوسنتزی به سمت آئورون برای ایجاد رنگ زرد در گلبرگ­های گیاه بنفشه آفریقایی سفید، انتقال سازه­های ژنی از طریق روش انتقال بیان موقت و ارزیابی مولکولی گیاهان تراریخته بنفشه آفریقایی با روش بیان موقت از طریق روش­های آزمون­های PCR و میکروسکوپ نوری.

مواد و روشها

طراحی و ساخت سازه­های ژنی  AS1 و 4'CGT : در این پژوهش که در پژوهشکده ژنتیک و زیست فناوری طبرستان انجام شد از دو سازه ژنی برای ایجاد تغییر رنگ گل به رنگ زرد و تولید مسیر بیوسنتزی رنگدانه آئورون استفاده شد. با استفاده از بانک اطلاعاتی NCBI ­وBLAST ، توالی نوکلئوتیدی و اسید آمینه­ای ژن­های 4'CGT و AS1 در گیاه زینتی گل میمونی بترتیب با شماره دسترسی­AB198665 و AB044884 به همراه سایر ویژگی­ها (ویژگی­های توالی­های مورد بررسی از جمله طولmRNA ،cDNA ، تعداد اگزون و اینترون، طول پروتئین و شماره دسترسی توالی­ها) مورد بررسی قرار گرفت. پس از دریافت تمام توالی­ها، توالی­های تکراری حذف و در نهایت تائید وجود ژن­ها در توالی­های شناسایی شده با استفاده از پایگاه دادهCDD  انجام گردید. پرایمرهای اختصاصی ژن AS1 با توجه به توالی جایگاه­های برشی آنزیم­های Nco I و BstE II در ناقل pCAMBIA1304 و ژن 4'CGT با توالی جایگاه­های برشی آنزیم­های Sac I و BamH I در ناقلpBI121  با استفاده از نرم­افزار Oligo 7 طراحی شدند. به منظور افزایش کارایی هضم توسط آنزیم­های برشی از جدول Cleavage Close to the End of DNA Fragments استفاده شد. رشته­های اولیگونوکلئوتیدی استفاده شده بعنوان آغازگر در این پژوهش در جدول 1 آورده شده­اند. واکنش­های تکثیر ژن­های مورد بررسی به ترتیب بصورت جداگانه با آغازگرهای اختصاصی مربوطه و با برنامه دمایی، واسرشتگی اولیه 5 دقیقه در 95 درجه سانتی­گراد، واسرشتگی 1 دقیقه در دمای 95 درجه سانتی­گراد، اتصال 1 دقیقه در 60 درجه سانتی­گراد، گسترش 4 دقیقه در 72 درجه سانتی­گراد و گسترش نهایی 10 دقیقه در 72 درجه سانتی گراد طی 35 چرخه انجام شد. در واکنش PCR از­cDNA  بعنوان الگو استفاده شد. پس از بررسی نتایج واکنش PCR روی ژل آگاروز یک درصد و تأیید اندازه، قطعات تکثیری با استفاده از کیت استخراج از ژل شرکت طبق دستورالعمل شرکت سازنده جداسازی و خالص سازی شدند. پس از خالص سازی قطعات، واکنش اتصال بین این قطعات و پلاسمید­های مورد نظر توسط آنزیم DNA لیگاز T4 انجام شد. در ادامه پلاسمیدهای نوترکیب حاصل با استفاده از روش شوک حرارتی به باکتری مستعد E. coli سویه DH5α منتقل شدند. بدین ترتیب، ژن­ 4'CGT در ناقل­ pBI121 و ژن AS1 در ناقل­ pCAMBIA1304 در سمت ´5 و ´3 کلون شد و پلاسمیدهای نوترکیب به دست آمده بترتیب pBI121-4'CGT و pCAMBIA1304-AS1 (شکل 2) نامیده شدند. پلاسمیدهای نوترکیب حاصل با استفاده از روش­های کلونی PCR، الگوی هضم آنزیمی توسط آنزیم­های ذکر شده برای هر ناقل و توالی­یابی مورد بررسی صحت همسانه­سازی قرار گرفت.

از اگروباکتریوم سویه LBA4404 برای انتقال ژن به گیاه استفاده شد. پس از تهیه سلول­های مستعد از اگروباکتریوم، انتقال پلاسمیدهای نوترکیب بطور همزمان با همدیگر و با میزان مناسب از هر دو ناقل (ng/µl 100) با استفاده از روش الکتروپوریشن انتقال داده شد و بر روی محیط انتخابی LB آگار حاوی آنتی بیوتیک­های مناسب ریفامپیسین  mgl-150 و کانامایسین  mgl-150 کشت شدند و در 28 درجه سانتی­گراد به مدت 3 شبانه روز در تاریکی انکوبه گردیدند. سپس مجدد درستی تراریخته بودن کلونی­های نوترکیب که بر روی محیط انتخابی رشد کرده بودند با آزمون کلونی­PCR  به تایید رسید.

انتقال سازه ژنی با سیستم بیان زودگذر (اگرواینفیلتریشن) در گلبرگ بنفشه آفریقایی: جهت آماده­سازی محلول اگرواینفیلتریشن برای تزریق، ابتدا آگروباکتریوم­ حاوی سازه ژنی روی محیط­کشت جامد لوریا-برتانی (LB) دارای آنتی­بیوتیک­های ریفامپیسین  mgl-150 و کانامایسین  mgl-150 به مدت 3 روز در تاریکی و در دمای 28 درجه سانتی­گراد کشت شد.

 

جدول 1- پرایمرهای مورد استفاده برای PCR و توالی­یابی

No

پرایمر رفت

توالی  (5'-Sequence-3')

پرایمر برگشت

توالی  (5'-Sequence-3')

1

BamH I -4'CGT-FW

GGGGATCCATGGGAGAAGAATACAAGAAA

 

Sac I - 4'CGT

-RV

GGGAGCTCTTAACGAGTGACCGAGTTGAT

2

Nco I­ - AS1

-FW

GGCCATGGATGTTCAAAAATCCTAATATC

 

BstE II­­ - AS1

-RV

GGGGTTACCTTAGCCATCAAGCTCAATCTT

شکل 2- طرح شماتیک سازه­های ژنی. (الف): pBI121-4'CGT این سازه دارای ژن مقاومت به کانامایسین (KanR)، محل­های برشی BamH I وSac I ، پیشبرنده CaM35S، توالی خاتمه­دهنده نسخه­برداری (NOS)، توالی افزایش دهنده بیانی (Kozak sequence)، توالی­­های مرزی چپ (LB) و راست (RB) و ژن (4'CGT) می­باشد. (­ب):  pCAMBIA1304-AS1 این سازه دارای ژن مقاومت به هیگرومایسین (hpt II)، محل­های برشی Nco I  وBstE II ، پیشبرنده CaM35S، توالی خاتمه­دهنده نسخه­برداری (NOS­)، توالی افزایش دهنده بیانی (Kozak sequence)، توالی­های مرزی چپ (LB) و راست (RB) و ژن (AS1) می­باشد.

 

پس از 3 روز، با بهره­گیری از کلونی­های آگروباکتریوم رشد یافته، 20 میلی­لیتر محیط­کشت مایع LB دارای آنتی­بیوتیک­های ریفامپیسین  mgl-150 و کانامایسین  mgl-150 مایه کوبی شده و یک شبانه روز در دمای 28 درجه سانتی­گراد و در شرایط تاریکی تکان داده شد. با گذشت یک روز، باکتری­های رشد یافته در 20 میلی­لیتر LB، در 3200 دور در دقیقه به مدت 10 دقیقه سانتریفوژ شده و بخش شناور آن را دور ریخته و رسوب چسبیده به ته فالکون را در محیط­کشت AB (22) به همراه 240 میلی­گرم مونوفسفات سدیم (NaH2PO4)، 7/14 گرم 2-(ان-مورفولینو) اتان سولفونیک اسید (MES)، 10 گرم در لیتر گلوکز و 100 میکرومول استوسیرینگون (pH 5/5) رشد تعلیق کرده و به مدت 6 ساعت در دمای اتاق و در تاریکی تکان داده شدند. سپس برای بار دوم این سوسپانسیون باکتری در 3200 دور در دقیقه و به مدت 10 دقیقه سانتریفوژ گردید و رسوب چسبیده به ته فالکون در محیط اینفیلتریشن (گلوکز 1% و 100 میکرومول استوسیرینگون) تعلیق شده و به گونه­ای رقیق شد که چگالی چشمی (OD) آن به 5/0 تا 6/0 رسید. در این مرحله 1 تا 5/1 میلی­لیتر از محلول اگرواینفیلتریشن آماده شده با OD مورد نظر به نمونه­های شاهد (بدون تزریق)، شاهد تزریق شده با محلول اگرواینفیلتریشن بدون سازه ژنی و نمونه تزریق شده با محلول اگرواینفیلتریشن حاوی سازه ژنی در بخش­های پایه گلبرگ­های سفید بنفشه آفریقایی سرنگ بدون سوزن تزریق شد. پس از 3 روز از تزریق محلول اگرواینفیلتریشن و مشاهده چشمی تغییر وضعیت نمونه­ها، گلبرگ­های که تزریق شده بودند جدا شدند و در دمای 80-  نگهداری شدند.

آنالیز میکروسکوپ نوری: گلبرگ­های شاهد و تراریخت موقت (زرد رنگ) به قطعات 5×5 میلی­متر برش عرضی داده شده و در 4% آگارز تعبیه شدند. بخش­های نازک (ضخامت 100 میلی­متر) با میکرو برش­دهنده DTK-1000 (D.S.K.) برش داده شدند. سپس برای بررسی دقیق­تر تغییر رنگ گلبرگ­ها با استفاده از میکروسکوپ نوری مدلVH-Z75 (Keyence) مورد بررسی قرار گرفت.

آنالیزهای مولکولی: گلبرگ­های شاهد و گلبرگ­هایی تراریخته احتمالی تغییر رنگ یافته پس از استخراج DNA ژنومی برای تایید حضور بررسی دو قطعه ژنی با آزمون واکنش زنجیره­ای پلی­مراز و با استفاده از پرایمرهای اختصاصی طراحی شده آنالیز شدند.

آنالیز آئوروسیدین-6-او- گلوکزید (AOG) با استفاده از HPLC-DAD-MSn : ارزیابی AOG­ که محصول نهایی آئورون می­باشد با استفاده از دستگاه HPLC-DAD-MSn مورد آنالیز قرار گرفت. این سیستم HPLC بصورت آنلاین با یک طیف سنج جرمی یونی Bruker (Bremen, Germany) همراه با منبع ESI بود. بدین منظور از گلبرگ­های بنفشه آفریقایی تراریخت تغییر یافته به رنگ زرد، بنفشه آفریقایی سفید (غیر تراریخت) و گل میمونی زرد رنگ عصاره متانولی تهیه گردید. پس از تهیه عصاره غلیظ جهت بررسی کمی و کیفی میزان AOG­ در مسیر بیوسنتزی ­آئورون، آنتوسیانیدین و فلاون­ها به دستگاه تزریق شد. فاز متحرک دستگاه شامل 2 قسمت A و B می­باشد. فاز متحرک A شامل 1/0% TFA⁄water (eluent A) و فاز متحرک B نیز از ml 900 استونیتریل و  ml100 آب تشکیل شده است. نمونه­ها در طول موج­های خاص 400، 360  و 520 نانومتر بطور جداگانه برای پیک­های آئورون، فلاون­ها و آنتوسیانیدین­ها به ترتیب مورد بررسی قرار گرفت و طی زمان 40 دقیقه اندازه­گیری و شناسایی شد. اجزای محلول با بهره­گیری از یک ستون (XDB-C18) با ابعاد mm6/4×150، دتکتور UV با طول موج­های خاص، پمپ Quaternary، سرعت جریان ml /min1، سوزن تزریق کننده همیلتون µl2، حجم تزریق 20 میکرولیتر و نرم افزار ChemStation بررسی گردید. نمونه­های استاندارد (AOG)، نارینجنین و چالکون که ماده­ای پودری است به میزان 1 میلی­گرم بود در cc10 متانول حل نمودیم و به جز چالکون بقیه در آب رقیق گردید. برای بدست آوردن منحنی­های کالیبراسیون دیگر نمونه­ها نیز از کالیبراسیون استاندارد UV استفاده شد. پیک­های مربوط به AOG، نارینجنین و چالکون با استاندارد مقایسه و مقادیر هر یک براساس کروماتوگرام بر حسب میلی­گرم در گرم طیف استاندارد محاسبه شد. جمع آوری و پردازش داده­ها با استفاده از نرم افزار Bruker انجام شد. طیف سنج جرمی در حالت یونی مثبت و خودکار MSn با دامنه اسکن از 100 تا 1000 mz/z عمل می­کند.

نتایج

ساب کلونینگ ژن 4'CGT و AS1  در  ناقل pBI121  و

pCAMBIA1304 : قرار گرفتن دو کاست ژنی4'CGT و AS1 بترتیب در دو پلاسمید pBI121 و pCAMBIA1304 با هضم آنزیمی، واکنش زنجیره­ای پلیمراز و توالی­یابی تایید شدند. بدین صورت که در محیط کشت ­LB حاوی4'CGT ­pBI121+ اکثر کلونی­های مقاوم در محیط انتخابی، باند مربوطه با اندازه (1374 جفت باز) دارا بودند، در حالیکه محیط کشت LB حاوی­AS1 ­pCAMBIA1304+ تنها دو کلونی­های مقاوم در محیط انتخابی، باند با اندازه مورد نظر (1689 جفت باز) را ایجاد کرد (شکل3). نتایج بدست آمده مشخص نمود که انتقال همزمان دو ناقل­های نوترکیب pBI121+4'CGT وAS1 ­pCAMBIA1304+ به سلول­های مستعد اگروباکتریوم موفقیت آمیز بود و کلونی­های نوترکیب بر روی محیط انتخابی مشاهده شدند، که با آزمون PCR تراریخته بودن و وجود پلاسمیدها در اگروباکتریوم اثبات شد. کلونی­های نوترکیب در سطح محیط کشت LB حاوی آنتی­بیوتیک­های (ریفامپیسین mgl-1 100+ کانامایسین  mgl-150) انتخاب شده و سپس با روش Colony PCR و با استفاده از آغارگرهای اختصاصی، حضور دو قطعه ژنی (4'CGT وAS1 ) با همدیگر بترتیب با اندازه­های 1374 و 1689 جفت بازی تایید شد (داده­ها آورده نشده­اند).

انتقال سازه ژنی و بررسی فنوتیپی گلبرگ­های بنفشه آفریقایی ترایخت: گیاهان زینتی بنفشه آفریقایی­(Saintpaulia 'Jolly Diamond') برای تراریخته­سازی موقت استفاده شدند. ابتدا بررسی تغییر رنگ گلبرگ­ها با مشاهده چشمی مورد مطالعه قرار گرفتند.

مشاهده چشمی این آزمایش پس از 3 روز بواضح تغییر رنگ گلبرگ­های سفید بنفشه آفریقایی با هاله­ی زرد کم رنگ را در نمونه تزریق شده با سازه ژنی 4'CGT و AS1 را نشان داد در حالی که هیچ تغییری در گلبرگ­های شاهد و تزریق با محلول اگروایفیلتریشن بدون سازه ژنی مشاهده نشد (شکل 4). این آزمایش دو بار تکرار شد و نتایج مشابهی بدست آمد (داده ها نشان داده نشده­اند).

 

شکل 3- انتخاب کلونی­های مثبت و تایید ساب کلونینگ با استفاده از تکنیک Colony PCR با آغارگرهای اختصاصی ژن و هضم آنزیمی ناقل نوترکیب. (الف): CK-: کنترل منفی (بدون DNA)، CK+: کنترل مثبت (الگوی cDNA)، شماره های 1 تا 6:  نتایج حاصل از ) Colony PCR کلونی­های ترانسفورم شده با (pBI121+4'CGT، M: مارکر وزنی  bp 100. (ب): چاهک 1: نشانگر مولکولی تعیین اندازه KB1، چاهک 2: ناقل هضم نشده،  چاهک 3: هضم آنزیمی ناقل نوترکیب با دو آنزیم BamH I وSac I. (پ) : CK-: کنترل منفی (بدون DNA)،­CK+ : کنترل مثبت (الگوی cDNA)، شماره­های 1 تا 11: نتایج حاصل از (Colony PCR کلونی­های ترانسفورم شده با AS1 ­(pCAMBIA1304+، M: مارکر وزنی   bp100. (ت): چاهک 1: نشانگر مولکولی تعیین اندازه KB1، چاهک 2: ناقل هضم نشده،  چاهک 3: هضم آنزیمی ناقل نوترکیب با دو آنزیم Nco I وBstE II.

شکل 4- نتایج حاصل از نفوذ آگروباکتریوم با سیستم بیان زود گذر در گلبرگ­های بنفشه آفریقایی. (الف): شیوه تزریق محلول اگرواینفیلتریشن آگروباکتریوم در بخش های گلبرگ­های سفید بنفشه آفریقایی با سرنگ بدون سوزن (­فلش سبز: نمونه شاهد­، فلش آبی: نمونه شاهد تزریق شده با محلول اگرواینفیلتریشن بدون سازه ژنی و فلش نارنجی : نمونه تزریق شده با محلول اگرواینفیلتریشن حاوی سازه ژنی­)، (ب): بررسی فنوتیپی گلبرگ­های سفید شاهد (بدون تزریق)، (پ): نمونه تزریق شده با محلول اگرواینفیلتریشن بدون سازه ژنی، (ت): نمونه تزریق شده با محلول اگرواینفیلتریشن حاوی سازه ژنی(­تغییر رنگ با لکه­های زرد کم رنگ در بخش­هایی از گلبرگ­های تزریق یافته حاوی سازه ژنی 4'CGTAS1 نشان داده شده است).

 

 

بررسی گلبرگ­ها بنفشه آفریقایی ترایخت با میکروسکوپ نوری: نتایج میکروسکوپ نوری بطور واضح و کامل تغییر رنگ به سمت زرد کم رنگ در نمونه­های تزریق شده حاوی سازه ژنی را نشان داد و در نمونه­­های تزریق یافته بدون سازه ژنی تغییری مشاهده نشد. همچنین قسمت تزریق شده با فلش مشخص نمود محدود به اپیدرم مایع رنگی ساخت ژن است. بطور کلی نتایج مشخص نمود که نفوذ با سیستم بیان زودگذر در گلبرگ بنفشه آفریقایی با موفقیت انجام گردید (شکل 5). این نشان می­دهد که نه تنها به سطح گلبرگ نفوذ کرده است بلکه کاملا درون ژنوم گیاه وارد شده است.

شکل 5- مشاهده فنوتیپی گلبرگ­ها با میکروسکوپ نوری. (الف و ب): مشاهده فنوتیپی تغییر رنگ گلبرگ­های زیر میکروسکوپ به ترتیب در نمونه­های بدون سازه ژنی و با سازه ژنی، (ب و پ): مشاهده دقیق و واضح تغییر رنگ گلبرگ­های در محل تولید شده بترتیب در نمونه­های بدون سازه ژنی  (رنگ سفید) و با سازه ژنی (رنگ زرد)، (ث و ج): قسمت تزریق شده با فلش محدود به اپیدرم مایع رنگی ساخت ژن است.

آنالیز مولکولی

بررسی گلبرگ­های تراریخت بیان زودگذر با PCR: نمونه­های DNA از گلبرگ­های شاهد سفید بنفشه آفریقایی بدون تزریق، شاهد تزریق شده با محلول اگرواینفیلتریشن بدون سازه ژنی و گلبرگ تزریق شده با محلول اگرواینفیلتریشن حاوی سازه ژنی، استخراج و سپس روی ژل آگارز 8/0% برده شدند (شکل6).

برای ﺗﺄﻳﻴﺪ حضور قطعات ژنی 4'CGT ­و AS1 در گلبرگ­های تراریخته موقت آنالیز PCR با آغارگرهای اختصاصی بصورت با همدیگر انجام گردید. نتایج بدست آمده نشان داد که گیاهان تراریخته موقت مورد مطالعه باند مربوط به هر دو قطعه ژن مورد بررسی را دارا بودند. همچنین این نتایج بررسی وجود دو تا ژن درگیر در مسیر بیوسنتزی آئورون با PCR حضور ژن­های 4'CGT و AS1 را با همدیگر به ترتیب با اندازه 1374 و 1689 جفت­بازی تایید نمود. بدین ترتیب، این نتایج به وضوح حضور و بیان ژن­های 4'CGT AS1­ را برای تولید مسیر بیوسنتزی رنگدانه آئورون جهت تغییر رنگ گلبرگ از سفید به زرد نشان داد لذا می­توان سازه ژنی را با اعتماد بیشتری برای تراریخته شدن دائم به گیاهان زینتی انتقال داد (شکل 6).

تجمع آئوروسیدین-6-او- گلوکزید با استفاده از HPLC-DAD-MSn : نتایج کروماتوگرام HPLC نشان داد که گل­های میمونی زرد رنگ حاوی ترکیبی است که بطور طبیعی در بنفشه آفریقایی تولید نمی­شود (شکل7-ب ، پیک­های 1و 1ʹ)، در حالی پیک­های ایجاد شده در گلبرگ­های بنفشه آفریقایی تراریخته نشان­دهنده وجود این ترکیبات می­باشد (شکل 7-ج، پیک­های 1و 1ʹ).

این ترکیبات در گل­های میمون زرد رنگ در زمان RT 9/3 و 5/2 دقیقه به عنوان فلاونوئید AOG (4 ، 6 ، 3ʹ4ʹ-tetrahydroxyaurone-6-O- گلوکوزید) شناخته شده است (شکل 7-الف، پیک­های 1و 1ʹ). اجزای AOG (پیک 1ʹ ، 9/3  RT دقیقه) در گلبرگ­های بنفشه آفریقایی تراریخت تغییر یافته به رنگ زرد و گل میمونی زرد رنگ به ترتیب 95/2 و 45/3 میلی­­گرم در گرم می­باشد. در حالیکه، در گلبرگ­های سفید بنفشه آفریقایی (غیر تراریخت) پیک مشاهده نشد (جدول 2).

 

شکل 6- بررسی DNA ژنومی استخراج شده از گلبرگ­های تزریق شده و شاهد با استفاده از تکنیک PCR و آغازگرهای اختصاصی­. (الف): نتایج حاصل از PCR: ­CK+: کنترل مثبت (سازه ژنی pBI121-4'CGT و pCAMBIA1304-AS1 تخلیص شده)، چاهک دوم­: CK- (آب مقطر بدون DNA)، چاهک سوم: گلبرگ شاهد (بدون تزریق)، چاهک چهارم: گلبرگ­های شاهد تزریق یافته با محلول بدون اگرواینفیلتریشن بدون سازه ژنی، چاهک پنجم: گلبرگ­های شاهد تزریق یافته با محلول اگرواینفیلتریشن با سازه ژنی، (ب): بررسی جداگانه دقیق­تر وجود دو ژن

 

جدول 2- تجزیه و تحلیل فلاونوئیدها از گلبرگ­ها

No

ژنوتیپ

آئورون در 400 نانومتر

آنتوسیانیدینها در 520 نانومتر

فلاون

ها در 360 نانومتر

فنوتیپ

پیک 1 (2.5 دقیقه)

پیک 1ʹ (3.9 دقیقه)

شاهد

Senk's Alchemy Parakeet’

 

-

-

-

986/0

سفید

بنفشه تراریخته

4ʹCGT+ AS1

528/0

95/2

-

23/1

زرد

گل میمون زرد

cv. Snap Yellow (Endogenous Am4ʹCGT and AmAS1)

632/0

45/3

-

5/1

زرد

فلاونوئیدها در گیاهان تراریخته و غیر تراریخته توسط HPLC شناسایی شدند و داده ها جمع بندی شدند. پیک های 1 و 1ʹ : آئوروسیدین-6-او- گلوکزید (AOG)، پیک­های 2، 3 و 4: آنتوسیانیدین­ها و پیک های 5، 6 و 7 : فلاون (NC: نارینجنین چالکون و مشتقات آن).

 

 

آنالیز MS-MS پیک ʹ1 از m/z  449 مشخص نمود که در جداسازی MS2 یک قطعه گلوکز در 287 m/z به دلیل از دست دادن 162 واحد جرم اتمی بدست آمد (شکل8). همچنین، کروماتوگرام HPLC نشان داد که اجزا از هم دیگر بخوبی جدا شدند. تجمع چالکون باعث تشکیل آئوروسیدین-6-او- گلوکزید در گلبرگ­های بنفشه آفریقایی تراریخته گردید.

 

 

شکل 7- آزمون کروماتوگرافی مایع با کارایی بالا جهت ارزیابی آئوروسیدین-6-او-­گلوکزید. (الف): کروماتوگرام­ HPLC گلبرگ گل میمونی زرد رنگ، (ب): کروماتوگرامHPLC  گلبرگ بنفشه آفریقایی غیر تراریخت، (ج): کروماتوگرامHPLC  گلبرگ بنفشه آفریقایی تراریخت. کروماتوگرام HPLC  گلبرگ­های گل میمونی زرد رنگ و بنفشه آفریقایی تراریخته (AOG) را در پیک­های 1 و 1ʹ در 400 نانومتر نشان می­دهد.

شکل 8- آزمون طیف جرمی و جداسازی MS-MS  از ( m/z= 449) AOG گل میمون

 

بحث

ایجاد صفات جدید مانند رنگ گل در صنعت گیاهان زینتی بطور مستقیم با ارزش تجاری آن مرتبط است (6، 24). استراتژی­های تراریخته دارای پتانسیل عظیمی برای تولید فنوتیپ­های جدیدی هستند که در طبیعت یافت نمی­شوند (19). گزارش شده است که گیاه زینتی بنفشه آفریقایی (25)، شمعدانی، نگون‌سار دارای رنگ­های متفاوت بجز رنگ زرد و نارنجی هستند (9، 29). رنگدانه­های اصلی هدف اصلاح رنگ گل، آنتوسیانین­ها بوده­اند که به تولید رنگ­های مختلف مانند قرمز، صورتی و آبی کمک می­کند، اما مطالعات اخیر نیز از ترکیبات رنگی چالکون و آئورون­ برای تولید گل­های زرد رنگ استفاده کرده­اند (26).

در پژوهش حاضر برای اولین بار با مهندسی ژنتیکی مسیر بیوسنتزی آئورون (AS1­+4'CGT) و با استفاده از سیستم بیان موقت اگرواینفیلتریشن ایجاد رنگ جدید زرد در گلبرگ­های بنفشه آفریقایی سفید انجام شد. این نتایج نشان می­دهد که گلبرگهای بنفشه آفریقایی سفید چالکون تولید می­کنند و وجود مالونیل ترانسفراز باعث تجمع آئورون می­شود. چالکون یک آنزیم کلیدی در بیوسنتز فلاونوئید گیاهان گلدار از جمله آئورون است که به نارینجنین بی­رنگی تبدیل می­شود و نقش مهمی را در ایجاد رنگ در گل­های زینتی ایفا می­کند (12، 27، 30). اخیرا گزارش شده است که به دلیل عدم وجود مونونیل ترانسفراز در کلاله گیاه سفید  (Ipomoea nil)قادر به تجمع رنگدانه آئورون و رنگ زرد در گلبرگ­ها نمی­باشد (9). در پژوهشی آنالیز مولکولی مشخص نمود که دو ژن مجزا چالکون سنتاز SaCHSA و SaCHSD در گیاهان زینتی بنفشه آفریقایی وجود دارد (4). این نتایج وجود چالکون در گیاه زینتی بنفشه آفریقایی برای بررسی پژوهش حاضر بسیار مهم و ضروری می­باشد.

به نقل از انو و همکاران در سال (2006) بیان همزمان ژن­های Am4'CGT و AmAS1 از گل میمون زرد رنگ همراه با خاموشی ژن­های بیوسنتز آنتوسیانین­ (F3H، DFR) با موفقیت باعث تولید اورئوسیدین 6-O-­گلوکوزید و در نتیجه منجر به گلبرگ­های زرد رنگ در گیاهان زینتی تورنیا می­شود (18). در پژوهشی دیگر بیان همزمان ژن­های Am4'CGT و AmAS1 همراه با خاموشی ژن­ چالکون ایزومراز برای ایجاد مسیر بیوسنتزی پیشنهاد داده­اند (9). در حالیکه، در پژوهش حاضر انتقال همزمان ژن­های 4'CGT و AS1 در دو وکتور متفاوت با موفقیت باعث ایجاد آئورون و رنگ زرد در گلبرگ سفید گردید. رزمی و همکاران (1392) در تحقیقاتی ژن لوسیفراز حشره شب تاب گونه ایرانی Lampyris turkestanicus را با استفاده از آگروباکتریوم به گیاه زینتی بنفشه آفریقایی جهت نشر نور قرمز منتقل کردند. حضور ژن در ژنوم گیاه و نسخه­برداری با استفاده از آنالیزهای PCR و PCR-RT تأیید شد. همچنین نتایج حاصل از سنجش لومینومتری، فعالیت آنزیم لوسیفراز را در بافت­های برگی بعضی از گیاهان نشان داد، در حالی که در گیاهان شاهد نشر نوری مشاهده نشد (1).

استفاده از سیستم اگرواینفیلتریشن عملکرد سازه­های ژنی­ مورد بررسی و تغییر رنگ گل را بدون نیاز به کشت بافت، انتخاب گیاهان تراریخت، بدون هزینه و در کوتاهترین زمان امکانپذیر می کند. این سیستم آزمایش سریع تراریخته­ها را در جوانه­های گیاه پامچال بطورت موقت امکان پذیر نمود. بیان GUS در کوتیلدون­، برگ­ها و ریشه جوانه­های گیاه پامچال پس از چند روز مشاهده شد (8). بررسی اﮔﺮواﯾﻨﻔﯿﻠﺘﺮﯾﺸﻦ RNAi ژن ﭼﺎﻟﮑﻮن ﺳﻨﺘﺎز در ﮔﻠﺒﺮگﻫـﺎی ﮔـﻞ ﻣﯿﻤـﻮن مشخص نمود ﮐﻪ ﺑﺎ ﺧﺎﻣﻮﺷﯽ اﯾﻦ ژن، ﻫﯿﭽﮕﻮﻧﻪ رﻧﮕﯿﺰه­ای در ﮔﻠﺒﺮگ­ﻫﺎی ﮔﻞ ﻣﯿﻤﻮن ﺗﻮﻟﯿﺪ ﻧﻤﯽ­ﺷﻮد و رﻧﮓ آن­ﻫﺎ از ﺑﻨﻔﺶ ﺑﻪ ﺳﻔﯿﺪ ﺗﻐﯿﯿﺮ ﻣﯽ­کند (22). انتقال سازه­ دارای ژن­ فلاونوئید­ʹ­3،ʹ5- هیدروکسیلاز از گل اطلسی و ژن DFR از زنبق به گلبرگ­های ژاله با استفاده از این سیستم اﮔﺮواﯾﻨﻔﯿﻠﺘﺮﯾﺸﻦ منجر به تغییر میزان آنتوسیانین­های گلبرگ­های تزریق یافته و ایجاد رنگ آبی در کلاله و دانه­های گرده گردید (10). استفاده از تکنیک RNAi جهت خاموشی ژن چالکون ایزومراز در مسیر بیوسنتزی تولید رنگدانه گل اطلسی (Petunia hybrida) توسط اگرواینفلتریشن سبب تجمع آنتوسیانین و کاهش mRNA­های اندوژن هدف­های مربوطه در ناحیه نفوذی گلبرگ­های چهار رنگ گل گیاه اطلسی شد (13). در پژوهشی جهت تولید آﻧﺘﻮﺳﯿﺎﻧﯿﻦ دﻟﻔﯿﻨﯿﺪﯾﻦ در گلبرگ­های ﮔﻞ ژاﻟﻪ (ژربرا) با استفاده از سیستم بیان موقت اﮔﺮواﯾﻨﻔﯿﻠﺘﺮﯾﺸﻦ به این نتیجه رسیدند که انتقال سازه­های تک ژنی (حمل­کننده ژن­ فلاونوئید­ʹ­3،ʹ5- هیدروکسیلاز از گل بنفشه) و دو ژنی (حمل­کننده ژن­ فلاونوئید­ʹ­3،ʹ5- هیدروکسیلاز از گل بنفشه و ژن DFR از زنبق هلندی) به ﮔﻠﺒﺮگ­ﻫﺎی ﮔﻞ ژاﻟﻪ (ژربرا) به ترتیب منجر به ﺗﻮﻟﯿﺪ دﻟﻔﯿﻨﯿﺪﯾﻦ به میزان 44 و 75 درصد شدند و با موفقیت باعث تغییر در رنگ گلبرگ­ها به رنگ آبی گردید. همچنین میزان تولید آنتوسیانین­ها دلفینیدین، سیانیدین، پلارگونیدین و پئونیدین با دستگاه HPLC آنالیز نمودند و پیشنهاد کردند که رقم Bismarck بهترین رقم برای تراریختی و انتقال پایدار ژن­های درگیر در مسیر بیوسنتزی آنتوسیانین­ها، با هدف تغییر رنگ گل به ویژه تولید دلفینیدین می­باشد (15).

در پژوهشی بررسی خاموشی موقت ژن BBE1 در گیاه شقایق (Papaver somniferum L.)، با تزریق به سطح پشتی برگ این گیاه با سرنگ­های یک میلی­لیتری انجام شد. آنالیزهای PCR و RT-qPCR با موفقیت وجود رونوشت های این ژن ومیزان خاموشی در گیاهان تراریخت در مقایسه با گیاهان شاهد نشان داد (2). در حالیکه در پژوهش حاضر با موفقیت بررسی فنوتیپی تغییر رنگ گلبرگ و حضور بیان ژن­های 4'CGT و­AS1  در گلبرگ­های تراریخت با استفاده از میکروسکوپ نوری و سپس آنالیز  PCRبا موفقیت تایید شد. با توجه به عملکرد سریع و ساده، اقتصادی، این سیستم یک روش مناسب و کارآمدی ﺑﺮای ﭘﯿﺶ­ﺑﯿﻨﯽ وﺿﻌﯿﺖ ﺗﺮارﯾﺨﺘﯽ ﭘﺎﯾﺪار می­باشد که سازه­های ژنی با احتمال خیلی بالایی پس از تایید انتقال شوند. انباشته شدن ترکیب جدیدی AOG که محصول نهایی مسیر آئورون با موفقیت براساس زمان و طیف جرمی در گلبرگ­های تراریخت موقت بنفشه آفریقایی شناسایی شد و در گلبرگ­های غیر تراریخت مشاهده نشد. در پژوهشی (21) با استفاده از سیستم  HPLC-DAD-MSn این ترکیب را در طول مرحله رشد تنباکو تراریخت مشاهده شد و در غیر تراریخت پیک مخصوص به این ترکیب شناسایی نشد. این ترکیب در گلبرگهای تراریخته Ipomoea nil براساس زمان و طیف جرمی شناسایی شد (9). که با نتایج این پژوهش مطابقت دارد. مطالعات آنالیز HPLC توسط انو و همکاران سال (2006) نشان داد که AOG در گیاهان تراریخته (422/0 میلی­­گرم در گرم) تولید شده و در گیاهان غیر تراریخته تولید نشده است (18). تشکیل آنزیمی آئورون­ها در عصاره گل­های زرد گل میمون با استفاده از HPLC مشخص نمود که مسیر رنگدانه­های اصلی در گل­ها برای ایجاد آئوروسیدین-6-او- گلوکزید باز است و به دنبال آن درPHC -گلوکوزید، براکتاتین 6-گلوکوزید و THC4-گلوکوزید به ترتیب کاهش می­یابد (20).

نتیجه­گیری کلی

با انجام پژوهش حاضر آشکار شد ﮐﻪ روش اﮔﺮواﯾﻨﻔﯿﻠﺘﺮﯾﺸﻦ روﺷﯽ ﻣﻨﺎﺳﺐ ﺑﺮای ﺑﺮرﺳﯽ ﺑﯿﺎن ﻣﻮﻗﺖ ژن­های رنگ گل با صرف وقت کمتر و هزینه خیلی کمتر در گلبرگ گیاه زینتی بنفشه آفریقایی می­باشد، زیرا انتقال این ژن­ها به صورت پایدار و نیازمند بررسی بیشتر بوده و گزینش گیاهان تراریخت احتمالی نیز وقت گیر بوده و به هزینه بالایی نیاز دارد. همچنین نتایج این پژوهش می­تواند راهی را برای مهندسی ایجاد رنگ زرد در گونه­های گیاهان زینتی که فاقد این نوع رنگ هستند باز نماید. از طرفی با کاربردی شدن این گیاهان با رنگ نوین زرد و عرضه آن بصورت تجاری و با توجه به اهمیت اقتصادی قابل توجه گیاهان زینتی در جهان و محبوبیت گیاه زینتی بنفشه آفریقایی در ­میان گل­های زینتی، از لحاظ تجاری بسیار با ارزش خواهد بود و دارای اهمیت قابل توجهی در بازار گل و گیاه می­باشد. از ﻃﺮف دﻳﮕﺮ ﻗﻮاﻧﻴﻦ آزاد ﺳﺎزی ﮔﻴﺎﻫﺎن ﺗﺮارﻳﺨﺘﻪ ﺧﺼﻮﺻـﺎ در ﻣﻮرد ﮔﻴﺎﻫﺎن زﻳﻨﺘﻲ در ﺑﻌﻀﻲ از ﻛﺸﻮرﻫﺎ ﺗﺼﻮﻳﺐ و در ﺑﻌﻀـﻲ کشورهای دﻳﮕﺮ در ﺣﺎل ﺗﺼﻮﻳﺐ ﻣﻲ ﺑﺎﺷﻨﺪ، ﻟﺬا در آﻳﻨﺪه ﺷﺎﻫﺪ ﻧﻘﺶ ﻣـﻮﺛﺮﺗﺮ در اﺻـﻼح ﮔـﻞ و ﮔﻴﺎﻫـﺎن زﻳﻨﺘـﻲ ­ﺧﻮاﻫﻴﻢ ﺑﻮد.

 

سپاسگزاری

این پژوهش با کمک مالی شماره 980901 ستاد توسعه زیست فناوری انجام شده است. بدینوسیله از حمایت مالی توسعه زیست فناوری جهت انجام تحقیق حاضر قدردانی می شود.

  • رزمی، آ.، جلالی جواران، م. و حسین خانی، س. 1392. انتقال ژن لوسیفراز حشره شب تاب گونه ایرانی Lampyris turkestanicus با نشر نور قرمز به گیاه بنفشه آفریقایی ­(Saintpaulia ionantha). مجله پژوهش­های سلولی و مولکولی (مجله زیست شناسی ایران). جلد 26، شماره 3، ص 314-325.
  • سهرابی، س.م.، اسماعیل، ا. و نظریان فیروزآبادی ، ف. 1397. جداسازی، همسانه­سازی و خاموشی موقت ژنBBE1 با استفاده از تکنیک خاموشی ژن القا شده توسط ویروس (VIGS) در ژنوتیپ ایرانی گیاه شقایق (Papaver somniferum. L). مجله پژوهش­های سلولی و مولکولی (مجله زیست شناسی ایران). جلد 31، شماره 3، ص 325-336.

 

  • Azadi, P., Bagheri, H., Nalosi, AM,. Nazari F., Chandler SF., 2016. Current status and biotechnological advances in genetic engineering of ornamental plants. J Biotechnology Advances 34(6): 1073–1090. https://doi.org/https://doi.org/10.1016/j.biotechadv.2016.06.006.
  • Caro, S.E., Stampfle, J.M., Greene, M.J., Kotarski, M.A., 2006. Using a chalcone synthase Gene to Infer Phylogenies in the Genus Saintpaulia. Bios. 77(3): 72–76.
  • Falcone Ferreyra, M.L., Rius, S.P., Casati, P., 2012. Flavonoids: biosynthesis, biological functions, and biotechnological applications. Frontiers in Plant Science. 3: 222.
  • Gandía-Herrero, F., García-Carmona, F., 2013. Biosynthesis of betalains: yellow and violet plant pigments. Trends in Plant Science. 18(6): 334–343.
  • Goodin, M.M., Dietzgen, R.G., Schichnes, D., Ruzin, S., Jackson, A.O., 2002. pGD vectors: versatile tools for the expression of green and red fluorescent protein fusions in agroinfiltrated plant leaves. The Plant 31(3): 375–383.
  • Hayta, S., Smedley, M.A., Li, J., Harwood, W.A., Gilmartin P.M., 2018. Agrobacterium-mediated transformation systems of Primula vulgaris. Plant Methods. 14: 93.
  • Hoshino, A., Mizuno, T., Shimizu, K., Mori, S., Fukada-Tanaka, S., Furukawa, K., Ishiguro, K., Tanaka, Y., Iida, S., 2019. Generation of Yellow Flowers of the Japanese Morning Glory by Engineering Its Flavonoid Biosynthetic Pathway toward Aurones. Plant and Cell Physiology. 60(8):1871-1879.
  • Hussein, G.M., Abu El-Heba, G.A., Abdou, S.M., Abdallah, N.A., 2013. Optimization of transient gene expression system in Gerbera jemosonii petals. GM Crops & Food. 4(1): 50–57.
  • Kapila, J., De Rycke, R., Van Montagu, M., Angenon, G., 1997. An Agrobacterium-mediated transient gene expression system for intact leaves. Plant 122(1): 101–108.
  • Kazemian, M., Kazemi, E.M., Kolahi M., Omran, V.G., 2020. Floral ontogeny and molecular evaluation of anthocyanin biosynthesis pathway in pinwheel phenotype of Saintpaulia inontha Wendl. periclinal chimera. Scientia Horticulturae. 263, 109142.
  • Keykha, F., Bagheri, A., Moshtaghi, N., Bahrami, A.R., Sharifi, A., 2016. RNAi-induced silencing in floral tissues of Petunia hybrida by Agroinfiltration: A rapid assay for chalcone isomerase gene function analysis. Cellular and Molecular Biology (Noisy-Le-Grand, France). 62: 26–31.
  • Li, F., Jin, Z., Qu, W., Zhao, D., Ma, F., 2006. Cloning of a cDNA encoding the Saussurea medusa chalcone isomerase and its expression in transgenic tobacco. Plant Physiology and Biochemistry : PPB / Société Française de Physiologie Végétale. 44: 455–461.
  • Nazari, F., Khoshkhui, M., Azadi, P., 2017. Production of Delphinidin Anthocyanin in the Flower Petals of Gerbera by Agroinfiltration of Flower Color Gene Constructs. Journal of Plant Production Research. 23(4): 145–164. (In Persian).
  • Nishihara, M., Nakatsuka, T., 2011. Genetic engineering of flavonoid pigments to modify flower color in floricultural plants. Biotechnology Letters. 33(3): 433–441.
  • Noman, A., Aqeel, M., Deng, J., Khalid, N., Sanaullah, T., Shuilin, H., 2017. Biotechnological Advancements for Improving Floral Attributes in Ornamental Plants. Frontiers in Plant Science. 8: 530.
  • Ono, E., Fukuchi-Mizutani, M., Nakamura, N., Fukui, Y., Yonekura-Sakakibara, K., Yamaguchi, M., Nakayama, T., Tanaka, T., Kusumi, T., Tanaka, Y., 2006. Yellow flowers generated by expression of the aurone biosynthetic pathway. Proceedings of the National Academy of Sciences. 103(29): 11075-11080.
  • Roberts, WR., Roalson, EH., 2017. Comparative transcriptome analyses of flower development in four species of Achimenes (Gesneriaceae). BMC Genomics 18(1): 240. https://doi.org/10.1186/s12864-017-3623-8
  • Sato, T., Nakayama, T., Kikuchi, S., Fukui, Y., Yonekura-Sakakibara, K., Ueda, T., Nishino T., Tanaka, Y., Kusumi, T., 2001. Enzymatic formation of aurones in the extracts of yellow snapdragon Plant Science. 160(2): 229–236.
  • Shakya, R., Ye, J., Rommens, C.­M., 2012. Altered leaf colour is associated with increased superoxide-scavenging activity in aureusidin-producing transgenic plants. Plant Biotechnology Journal. 10(9): 1046–1055.
  • Shang, Y., Schwinn, K.E., Bennett, M.­J., Hunter, D.­A., Waugh, T.­L., Pathirana, N.­N., Brummell, D.­A., Jameson, P.­E., Davies, K.­M., 2007. Methods for transient assay of gene function in floral tissues. Plant Methods. 3(1): 1-12.
  • Tanaka, Y., Sasaki, N., Ohmiya, A., 2008. Biosynthesis of plant pigments: Anthocyanins, betalains and carotenoids. Plant Journal. 54(4): 733–749.
  • The plant List. , 2017. Saintpaulia. http://www. theplantlist. org/tpl1.1/search?q= Saintpaulia.
  • Teixeira da Silva, J., Dewir, Y., Wicaksono, A., Sahijram, L., Kim, H.H., Zeng, S., Chandler, S., Hosokawa, M., 2017. African violet (Saintpaulia ionantha Wendl.): Classical breeding and progress in the application of biotechnological techniques. Folia Horticulturae. 29: 99–111.
  • To, K.Y., Wang, C.K., 2006. Molecular Breeding of Flower Color. In Floriculture, Ornamental and Plant Biotechnology (Vol. 1). 300-310.
  • WU, Y., Zhu, M., Jiang, Y., Zhao, D., Tao, J., 2018. Molecular characterization of chalcone isomerase (CHI) regulating flower color in herbaceous peony (Paeonia lactiflora Pall.). Journal of Integrative Agriculture. 17(1): 122–129.
  • Yasmin, A., Debener, T., 2010. Transient gene expression in rose petals via Agrobacterium Plant Cell, Tissue and Organ Culture (PCTOC). 102: 245–250.
  • Yoshida, K., Mori, M., Kondo, T., 2009. Blue flower color development by anthocyanins: from chemical structure to cell physiology. Natural Product Reports. 26(7): 884–915.
  • Zhao, D., Jiang, Y., Ning, C., Meng, J., Lin, S., Ding, W., Tao, J., 2014. Transcriptome sequencing of a chimaera reveals coordinated expression of anthocyanin biosynthetic genes mediating yellow formation in herbaceous peony (Paeonia lactiflora Pall.). BMC Genomics. 15(1): 689.
  • Zottini, M., Barizza, E., Costa, A., Formentin, E., Ruberti, C., Carimi, F., Lo Schiavo, F., 2008. Agroinfiltration of grapevine leaves for fast transient assays of gene expression and for long-term production of stable transformed cells. Plant Cell 27(5): 845–853.
Volume 35, Issue 2
June 2022
Pages 367-381
  • Receive Date: 06 October 2020
  • Revise Date: 14 November 2020
  • Accept Date: 21 December 2020
  • First Publish Date: 06 January 2021