نوع مقاله : مقاله پژوهشی

نویسندگان

1 ایران، گنبدکاوس، دانشگاه گنبد کاووس، دانشکده کشاورزی و منابع طبیعی، گروه تولیدات گیاهی

2 ایران، رشت، سازمان تحقیقات، آموزش و ترویج کشاورزی، موسسه تحقیقات برنج کشور

چکیده

برنج یکی از مهم‌ترین گیاهان زراعی جهان می‌باشد و غذای اصلی و منبع تأمین کربوهیدرات کثیری از مردم جهان بوده است. در این آزمایش، ارتباط بین خصوصیات مرفوفنولوژیک 90 ژنوتیپ برنج (اصلاح شده و بومی) با 11 نشانگر ریزماهواره (SSR ) پیوسته به تحمل تنش خشکی بررسی شد. این بررسی در قالب طرح لاتیس با سه تکرار در دانشکده کشاورزی و منابع طبیعی دانشگاه کنبد کاووس بررسی شد. تجزیه رگرسیون چندگانه بین صفات اندازه‌گیری شده و آلل‌های نشانگرهای SSR ارتباط معنی‌داری را نشان داد. نتایج تجزیه خوشه-ای برای صفات زراعی در شرایط نرمال و تنش خشکی ژنوتیپ‌ها را به ترتیب به چهار و سه گروه تقسیم کرد. نتایج تجزیه رگرسیون نشان داد که در شرایط نرمال و خشکی به ترتیب تعداد خوشه‌چه ثانویه و باروری بیشترین درصد از تغییرات عملکرد را توجیه می‌کند. از نتایج این تحقیق می‌توان برای برنامه‌های به‌نژادی و انتخاب ارقام مناسب و متحمل به تنش خشکی استفاده نمود.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Relationship of microsatellite molecular markers with morphophonological traits in rice under flooding conditions and drought stress

نویسندگان [English]

  • somayeh miri 1
  • Hossein Sabouri 1
  • Ali akbar Ebadi 2
  • Sayed Javad Sajjadi 1

1 Gonbad Kavous University

2 The Rice Research Institute of Iran, Agricultural Research, Education and Extension Organization (AREEO), Rasht, I.R. of Iran

چکیده [English]

Rice is one of the most important crops in the world. Also, It is the main source of food and carbohydrates in the world. In this research, the relationship between the characteristics of 90 rice genotypes (Traditional and improved) with 11 SSR markers evaluated. This research was conducted as a lattice design with three replications in 2015-2016 at Gonbad Kavous University under normal and drought conditions. Multiple regression analysis between measured traits and SSR markers showed a significant relationship between data. The results of cluster analysis for agricultural traits in normal and drought stress genotypes were divided into four and three groups. The results of multiple regression analysis showed that the number of secondary branches and fertility, the most percentage of variation of explanation of yield variation, under normal and drought conditions, respectively. The results of this research can be used for breeding programs and selection of suitable and tolerant cultivar.

کلیدواژه‌ها [English]

  • Rice
  • SSR Marker
  • drought stress
  • Association analysis
  • regression

ارتباط نشانگر­های مولکولیSSR  با صفات مرفوفنولوژیک در برنج تحت شرایط غرقاب و تنش خشکی

سمیه میری1، حسین صبوری1، علی اکبر عبادی2 و سید جواد سجادی1

1 ایران، گنبدکاوس،دانشگاه گنبد کاووس، دانشکده کشاورزی و منابع طبیعی، گروه تولیدات گیاهی

2 ایران، رشت، سازمان تحقیقات، آموزش و ترویج کشاورزی، موسسه تحقیقات برنج کشور

تاریخ دریافت: 29/9/97                تاریخ پذیرش:27/1/98

چکیده

برنج یکی از مهم­ترین گیاهان زراعی جهان می­باشد و غذای اصلی و منبع تأمین کربوهیدرات کثیری از مردم جهان بوده است. در این آزمایش، ارتباط خصوصیات 90 ژنوتیپ برنج با 11 نشانگر  SSR پیوسته  به تحمل تنش خشکی، در قالب طرح لاتیس در دانشکده کشاورزی و منابع طبیعی دانشگاه کنبد کاووس بررسی شد. نتایج تجزیه خوشه­ای برای صفات زراعی در شرایط نرمال و تنش خشکی ژنوتیپ­ها را به ترتیب به چهار و سه گروه تقسیم کرد. تجزیه رگرسیون چندگانه بین صفات اندازه­گیری شده و آلل­های  نشانگرهای SSR ارتباط معنی­داری را بین برخی از آلل­های تکثیر شده نشان داد. همچنین، نتایج تجزیه رگرسیون نشان داد که در شرایط نرمال  و خشکی به ترتیب تعداد خوشه­چه ثانویه و باروری بیشترین درصد از تغییرات عملکرد را توجیه می­کند. از نتایج این تحقیق می­توان برای برنامه­های به­نژادی و انتخاب ارقام مناسب و  متحمل به تنش خشکی استفاده نمود.

واژه­های کلیدی: برنج، نشانگرSSR، تنش خشکی، تجزیه ارتباط، رگرسیون.

* نویسنده مسئول، تلفن: 01733228883 ، پست الکترونیکی: hos.sabouri@gmail.com

مقدمه

 

برنج ((Oryza sativa L یکی از مهمترین محصولات غذای اصلی است که 27 درصد از انرژی تغذیه­ای جهان و 20 درصد پروتئین تغذیه­ای را در اختیار دارد (11). علاوه بر این، بیش از 3 میلیارد نفر در جهان به برنج به عنوان ماده غذایی وابسته هستند. این محصول تحت شرایط زیست محیطی متنوعی کشت می شود (10). خشکسالی به عنوان یک دوره بدون بارش باران تعریف شده است. به طور کلی، تنش خشکسالی زمانی رخ می دهد که آب موجود در خاک کاهش یابد (15). خشکسالی مهمترین عامل محدود کننده تولید محصول در بسیاری از مناطق جهان است که به شدت بر تولید و کیفیت دانه اثر می­گذارد (17). به ویژه، شرایط خشکسالی منجر به کاهش رشد گیاه توسط تأثیر بر فرآیندهای فیزیولوژیکی و بیوشیمیایی مختلف می­شود (14). بیشتر گونه­های کشت شده برنج حساس به خشکسالی هستند، بنابراین نیازمند بهبود مستمر برای غلبه بر این مشکل است (22). برنج به­عنوان یک گیاه غرقابی یکی از حساس­ترین گیاهان در برابر کمبود آب است و بیشترین نیاز آبی را در بین غلات دارد (21). این گیاه تا رسیدگی فیزیولوژیکی دانه­ها به حدود 8 تا 20 هزار مترمکعب آب نیاز دارد. عملکرد در گیاه برآیند صفات مختلف است. تأثیر در هر یک از مراحل رشد بر عملکرد برنج ثابت ‌شده است. تحقیقات نشان داده است که گیاه در 20 روز قبل از خوشه­دهی و تا حدود 10 روز بعد از خوشه­دهی به استرس آب حساس است. استرس خشکی اثر قابل ‌ملاحظه‌ای روی رشد پنجه­ها دارد. تعداد روز تا گلدهی در مناطقی که خشکی تا گلدهی و تا آخر فصل زراعی گسترش یافته است برای کشاورزان بیشترین اهمیت را دارا است (13). ماهگوب (2014) گزارش داد که هیچ پیشرفتی در رابطه با افزایش سطح کشت و بهبود ارقام جدید به دست نیامده است و این به طور عمده به عدم شناخت مکانیسم­های مرتبط با بهبود خشکسالی در برنج مربوط است. توسعه نشانگرهای مولکولی و استفاده از آنها برای جداسازی ژنتیکی صفات مهم زراعی به عنوان یک ابزار قدرتمند برای مطالعه ویژگی­های گیاهی پیچیده مانند تحمل به خشکی شناخته شده است (19). به ویژه، نشانگرهای مولکولی مبتنی بر DNA با استفاده از تعداد زیادی از نشانگرهای پلی مورفیکی که امکان طبقه بندی دقیق ارقام را دارند، قابل اعتماد است (20). از نشانگرهای مولکولی می­توان در انتخاب ژنوتیپ­های برتر در برنامه­های انتخاب به کمک نشانگر  بهره جست. این به این دلیل است که نشانگرهای مولکولی به طور مداوم از نسلی به نسل دیگر منتقل می شوند و تحت تاثیر محیط قرار نمی‍گیرند (9). کریم کشته و همکاران (1394) از نشانگرهای SSR برای شناسایی ژنوتیپ­های برنج متحمل به شرایط تنش خشکی استفاده کردند. امینی­نسب و همکاران (1391) نیز از نشانگرهای ریزماهواره پیوسته با ژن­های کنترل کننده تحمل به خشکی برای بررسی تنوع ژنتیکی مجموعه­ای ار20 رقم برنج ایرانی استفاده نمودند. همچنین شاخص مقاومت به خشکی به عنوان یک صفت تکمیلی مهم در مرحله رسیدگی دانه در 20 رقم و دو محیط (تحت تنش و بدون تنش آبی)، مورد ارزیابی قرار گرفت. نظر به وجود تنش کمبود آب در کشور و اهمیت برنج، بررسی تنوع فنوتیپی و مولکولی برای صفات مذکور در ژنوتیپ­های برنج جدید وارداتی و اصلاح شده داخلی در شرایط تنش خشکی ضروری است. برای این منظور آزمایشی با هدف بررسی ارتباط نشانگر­های مولکولی با صفات مرفوفنولوژیک در گیاه برنج تحت شرایط نرمال و تنش خشکی , شناسایی نشانگر­های آگاهی بخش موثر بر صفات برنج با استفاده از تجزیه ارتباطی انجام شد.

مواد و روشها

ارزیابی­های فنوتیپی: این مطالعه در سال زراعی 95-1394 در مزرعه تحقیقاتی دانشگاه گنبد کاووس واقع در شرق استان گلستان در طول جغرافیایی °55 و 11 دقیقه شرقی و عرض جغرافیایی °57 و 15 دقیقه شمالی و با 45 متر ارتفاع از سطح دریای آزاد، در قالب طرح لاتیس در 3 تکرار  (هر رقم در کرتی به مساحت 6 متر مربع (2×3) با فاصله ردیف 25 سانتی­متر) کاشته شد. بدین منظور از 90 ژنوتیپ برنج (در قالب تفاهم نامه مشترک بین دانشگاه گنبد کاووس و موسسه تحقیقات بین المللی برنج و همچنین در قالب تفاهم نامه مشترک بین دانشگاه گنبد کاووس و دانشگاه آبردین اسکاتلند، ارقام بومی ایران و همچنین لاین­های اصلاح شده دانشگاه گنبد کاووس) استفاده شد. در این پژوهش سعی شد، تنوع خوبی از ارقام و لاین­ها وجود داشته باشد (جدول 3). مزرعه نرمال از همان ابتدا طبق روال معمول در شرایط غرقاب تا پایان دوره رشد قرار داشت و برای اعمال تنش خشکی نیز بعد از اینکه گیاهان به مرحله حداکثر پنجه­زنی رسیدند، هر 15 روز یک بار آبیاری انجام شد. مطابق نتایج منحنی رطوبتی خاک میزان پتانسیل خاک پس از 15 روز تنش 10- بار و پس از 30 روز از اعمال تنش 15- بار گزارش شد. در این آزمایش 14 صفت فنوتیپی مورد ارزیابی قرار گرفت که عبارتند از: طول خوشه، تعداد خوشه­چه، دانه پوک، طول خروج خوشه از غلاف، دانه کل خوشه، ارتفاع بوته، تعداد کل خوشه بوته، وزن کل خوشه، وزن کل دانه، باروری، تعداد دانه پرخوشه، وزن دانه پرخوشه، عملکرد در هکتار، تعداد روز تا گلدهی. از هر واحد آزمایشی 5 بوته به طور تصادفی با حذف اثر حاشیه انتخاب شدند.

استخراج DNA : آزمایشات مولکولی نیز در آزمایشگاه ژنتیک دانشگاه گنبد کاووس انجام شد. به این منظور از هر ژنوتیپ نمونه برگی تهیه و با ازت مایع آسیاب شد. استخراج DNA نمونه­ها طبق روش CTAB  انجام  گرفت

(18).

واکنش زنجیره‌ای پلی مراز: برای این منظور، 11 نشانگر SSR (جدول 3) در حجم 10 میکرولیتر برای هر نمونه DNA در دستگاه ترموسایکلر مدل iCycler (BIORAD ساخت کشور آمریکا) انجام پذیرفت. چرخه‌های حرارتی برای نشانگر‌های SSR، شامل یک مرحله واسرشت‌سازی اولیه به مدت 5 دقیقه در دمای 94 درجه سانتی‌گراد، 35 چرخه با واسرشت‌سازی در دمای 94 درجه سانتی‌گراد به مدت یک دقیقه، اتصال آغاز‌گر به مدت یک دقیقه در دمای اختصاصی آن‌ها و بسط در دمای 72 درجه سانتی‌گراد به مدت 2 دقیقه و نهایتاً مرحله تکثیر نهایی به مدت 5 دقیقه در دمای 72 درجه سانتی‌گراد بود. فرآورده‌های واکنش زنجیره‌ای پلی‌مراز با استفاده از الکتروفورز ژل پلی اکریل آمید واسرشته‌ساز شش درصد تفکیک، و نمایان‌سازی باند‌ها با روش موسوم به روش سریع رنگ‌آمیزی نقره  (Caetano Anolles and Gresshoff 1994) انجام شد.

امتیاز دهی و تجزیه داده­ها : امتیاز­دهی نوار­های حاصل بر روی ژل به صورت صفر (عدم وجود آلل) و یک (وجود آلل) انجام شد. برای محاسبه همبستگی­ها و تجزیه کلاستر (به روش Ward‌)، محاسبه ضرایب رگرسیون چندگانه و تعیین رابطه بین داده­های ریزماهواره و داده­های فنوتیپی از نرم افزار SPSS v19.0 (اس پی اس اس، 1994) استفاده شد.  برای محاسبه مقایسه میانگین­ها و تجزیه واریانس صفات از نرم افزار SAS v9.1 (سس، 1994) استفاده گردید.

 

 

1     2    3    4     5    6     7    8     9   10  11  12 13 14  15 16 17 18  19  20  21  22 23 24 25 26   L

 

 

 

 

 

 

 

 

 


شکل 1- نمونه یک ژل پلی اکریل آمید رنگ­آمیزی شده  مربوط به مارکر RM5558

 

 

جدول 1 - برنامه حرارتی برای تکثیر جایگاه­های ریز ماهواره

 

مرحله

دما(C)

زمان (دقیقه) و (ثانیه)

تعداد چرخه

 

واسرشته سازی اولیه DNA

95

'5

1

 

واسرشته سازی DNA

95

''45

 

اتصال آغازگرها

-

''45

10

 

سنتز

72

''45

 

واسرشته سازی DNA

95

''45

25

 

اتصال آغازگرها

-

''45

 

سنتز

72

''45

1

 

تکثیر نهایی

72

'5

جدول 2 - مواد مورد استفاده در واکنش زنجیره­ای پلی­مراز در نشانگرSSR

 

غلظت مواد

مقدار مواد(میکرولیتر)

اجزای واکنش

 

1X

1

بافرPCR 10X

 

50 میلی­مولار

48

MgCl2

 

10 میلی­مولار

6

dNTP

 

 

12

آنزیم Taq DNA پلی­مراز

 

60 نانوگرم

75/0 میکرولیتر

آغازگر رفت

 

60 نانوگرم

75/0 میکرولیتر

آغازگر برگشت

 

5/0 – 75/0 نانوگرم

2/5 میکرولیتر

DNA رقیق شده

 

 

3/8 میکرولیتر

H2O

 

 

10 میکرولیتر

حجم نهایی

 

                 

 

جدول 3- لیست و توالی نشانگرهای پیوسته به QTLهای مرتبط با کیفیت برنج

نشانگرMarker

توالی رفتForward

توالی برگشت Reverse

منبعReferences

RM587

ACGCGAACAAATTAACAGCC

CTTTGCTACCAGTAGATCCAGC

Mei et al ,2012

RM3370

GTGTCTTAGAGCATATAACG

AAATCTTGAAAAATTCTTCT

Cho et ai ,2014

RM217

ATCGCAGCAATGCCTCGT

GGGTGTGAACAAAGACAC

Cho et ai ,2014

RM589

ATCATGGTCGGTGGCTTAAC

CAGGTTCCAACCAGACACTG

Cho et ai ,2014

RM529

CCCTCCCTTCTGTAAGCTCC

GAAGAACAATGGGGTTCTGG

Sato et al ,2004

RM5642

CCGTTTGTATGTAAGTACAG

AGAGAGAGAACTATTCGATG

Cho et ai ,2014

RM484

TCTCCCTCCTCACCATTGTC

TGCTGCCCTCTCTCTCTCTC

Cho et ai ,2014

RM333

GTACGACTACGAGTGTCACCAA

GTCTTCGCGATCACTCGC

Cho et ai ,2014

RM5558

GCTGACTTCACACTGCGATC

GGCCACTTTCCAAACATCAG

Mo et al., 2013

RM1161

AAACTGTTTTACCCCTGGCC

ATCCCCTTCTGCGGTAAAAC

Cho et ai ,2014

RM3498

GTGAAAGTCGGTGACGATGG

ACTTAGGGGATCAGGGGATG

Cho et ai ,2014

RM6349

CGTCCACTCGTGACAATGAC

TGATCTCCTCCTCCTCCTCC

Cho et ai ,2014

 

جدول4- ژنوتیپ­های برنج مورد مطالعه

منشا

Origin

نام یا شجره

Name or Pedigree

شماره

Number

منشا

Origin

نام یا شجره

Name or Pedigree

شماره

Number

IRRI

HHZ 1-DT3-Y1-Y1

23

Iran

SANGJO

1

IRRI

IR71739-24-3-5

24

IRRI

Dolar

2

IRRI

HHZ 1-DT7-LI2-LI1

25

IRRI

229L

3

IRRI

HHZ 21-SAL13-Y1-Y1

26

IRRI

USEN

4

IRRI

HHZ 21-Y4-Y2-Y1

27

IRRI

RestorerN5

5

IRRI

HHZ 22-Y3-DT1-Y1

28

IRRI

CANTURPANTA

6

IRRI

HHZ 23-DT16-DT1-DT1

29

IRRI

216L

7

IRRI

HHZ 26-SAL12-Y1-Y1

30

Iran

Sang Tarom

8

IRRI

HHZ 2-SUB2-DT1-DT1

31

Iran

Zerieh

9

IRRI

HHZ 3-SAL13-Y2-DT1

32

Iran

MOHAMMADI

10

IRRI

HHZ 3-SAL6-Y1-Y1

33

Scotland- Improved line

AZUCENA.BALA.21

11

IRRI

HHZ 4-DT3-Y1-Y1

34

Scotland- Improved line

AZUCENA.BALA.88

12

IRRI

HHZ 4-DT6-LI2-LI1

35

Scotland- Improved line

AZUCENA.BALA.111

13

IRRI

HHZ 4-SAL12-LI1-LI1

36

Scotland- Improved line

AZUCENA.BALA.114

14

IRRI

HHZ 4-SAL5-LI1-LI1

37

Scotland- Improved line

AZUCENA.BALA.169

15

IRRI

HHZ 4-SAL5-Y2-Y1

38

Scotland- Improved line

AZUCENA.BALA.189

16

IRRI

HHZ 6-DT1-LI1-LI1

39

Scotland- Improved line

AZUCENA.BALA.225

17

IRRI

IRRI 104

40

Scotland- Improved line

AZUCENA.BALA.265

18

IRRI

HHZ 10-DT5-LI1-LI1

41

Scotland- Improved line

AZUCENA.BALA.285

19

IRRI

HHZ 15-DT7-SAL2

42

Scotland- Improved line

AZUCENA.BALA.292

20

IRRI

HHZ 15-SAL13-Y1

43

IRRI

HHZ 15-SAL13-Y1

21

IRRI

HHZ 15-SAL13-Y3

44

IRRI

HHZ 18-Y3-Y1-Y1

22

 

ادامه جدول4

منشا

Origin

نام یا شجره

Name or Pedigree

شماره

Number

منشا

Origin

نام یا شجره

Name or Pedigree

شماره

Number

IRRI

IR75489-75-2-1

68

IRRI

HHZ 1-DT13-Y1-Y1

45

IRRI

IR 11C123

69

IRRI

HHZ 21-SAL13-Y1-Y1

46

Iran- Improved line

AHLNAD.2

70

IRRI

HHZ 21-Y4-Y2-Y1

47

Iran- Improved line

AHLNAD.8

71

IRRI

IR59673-93-2-3

48

Iran- Improved line

AHLNAD.18

72

IRRI

HHZ 26-SAL12-Y1-Y1

49

Iran- Improved line

AHLNAD.27

73

IRRI

HHZ 3-SAL4-Y1-Y1

50

Iran- Improved line

AHLNAD.34

74

IRRI

HHZ 4-DT3-Y1-Y1

51

Iran- Improved line

GHBNAM.2

75

IRRI

HHZ 4-DT6-LI2-LI1

52

Iran- Improved line

GHBNAM.140

76

IRRI

HHZ 4-SAL12-LI1-LI1

53

Iran- Improved line

GHBNAM.22

77

IRRI

HHZ 6-DT1-LI1-LI1

54

Iran- Improved line

GHBNAM.105

78

IRRI

IR14L110

55

Iran- Improved line

GHBNAM.111

79

IRRI

IR14L103

56

Iran- Improved line

AHLSPD.4

80

IRRI

IR12L353

57

Iran- Improved line

AHLSPD.92

81

IRRI

IR12L356

58

Iran- Improved line

AHLSPD.11

82

IRRI

IR747719-145-2-3-3

59

Iran- Improved line

AHLSPD.14

83

IRRI

IR13L382

60

Iran- Improved line

AHLSPD.16

84

IRRI

IR74721-199-1-3-2

61

Iran- Improved line

ANBNAD.1

85

IRRI

IR74481-146-3-2

62

Iran- Improved line

ANBNAD.3

86

IRRI

IR 10F221

63

Iran- Improved line

ANBNAD.7

87

IRRI

IR 11A410

64

Iran- Improved line

ANBNAD.21

88

IRRI

IR 11A534

65

Iran- Improved line

ANBNAD.29

89

IRRI

IR6962B

66

Iran- Improved line

ANBNAD.22

90

IRRI

IR75481-108-3-3

67

 


نتایج و بحث

تجزیه رگرسیون صفات زراعی اندازه­گیری شده در شرایط غرقاب و تنش خشکی:  جهت انتخاب صفاتی که نقش مهمی در توجیه عملکرد و سایر صفات زراعی داشتند، از روش تجزیه رگرسیون استفاده شد. برای این منظور عملکرد به عنوان متغیر وابسته و سایر صفات به عنوان متغیر مستقل در نظر گرفته شد. نتایج نشان داد که در شرایط نرمال تعداد خوشه­چه ثانویه بیشترین درصد از تغییرات عملکرد (14/0) را توجیه می­کند. ضرایب رگرسیون مثبت و معنی­دار برای صفات خوشه­چه اولیه، طول خروج خوشه از غلاف و تعداد خوشه­چه ثانویه (به ترتیب**887/185 ، **109/115 و**423/331) نیز دلالت بر اهمیت آن­ها در توجیه تغییرات عملکرد دارد. در شرایط خشکی صفت ارتفاع بوته بیشترین درصد از تغییرات عملکرد (46/0) را توجیه کرد. ضرایب رگرسیون برای صفات باروری و ارتفاع بوته (به ترتیب**647/13 و **947/14) در تغییرات عملکرد تأثیر داشتند (جداول 5 و 6). در پژوهش گیلوایی و همکاران (1396) تجزیه رگرسیون برای عملکرد دانه به عنوان متغیر وابسته و بقیه صفات به عنوان متغییر مستقل نشان داد که در شرایط تنش صفات دمای کانوپی، تعداد خوشه در بوته، طول برگ پرچم، میزان کلروفیلb، تعداد دانه پر در خوشه، شاخص کلروفیل، تعداد روز تا گلدهی، میزان پرولین و طول خوشه با ضریب تبیین 60 درصد و در شرایط تنش میزان پرولین، دمای کانوپی و تعداد دانه پر خوشه با ضریب تبیین 57 درصد سهم موثرتری در توجیه عملکرد دانه داشتند.

 

 

جدول 5- تجزیه رگرسیون برای عملکرد به عنوان متغیر تابع و سایر صفات به عنوان متغییر مستقل تحت شرایط غرقاب

R2

R

F

خطای معیار

ضریب رگرسیون

متغییر وارد شده در مدل

0.05

0.23

5.143*

67.739**

185.887**

تعداد خوشچه اولیه

0.10

0.32

5.074**

43.904*

115.109*

طول خروج خوشه ازغلاف

0.14

0.38

4.843**

165.131*

331.423**

تعداد خوشچه ثانویه

 

 

 

 

1379.980

عرض از مبداء

**و* معنی دار در سطح احتمال 1و5 درصد  

جدول 6- تجزیه رگرسیون برای عملکرد به عنوان متغیر تابع و سایر صفات به عنوان متغییر مستقل تحت شرایط تنش خشکی

R2

R

F

خطای معیار

ضریب رگرسیون

متغییر وارد شده در مدل

0.13

0.36

13.188**

3.924**

13.647**

باروری

0.46

0.46

12.161**

4.771**

14.947**

ارتفاع بوته

 

 

 

 

-45.684

عرض از مبداء

**و* معنی دار در سطح احتمال 1و5 درصد  

             

 


تجزیه خوشه­ای صفات زراعی مورد بررسی تحت شرایط غرقاب و تنش خشکی: نتایج حاصل از تجزیه خوشه­ای نشان داد که برای صفات زراعی در شرایط نرمال  و تنش به ترتیب چهار و سه گروه تشکیل شد. در پژوهشی که اله قلی پور و همکاران (1392) به منظور ارزیابی تنوع مولکولی ژنوتیپ­های برنج با استفاده از نشانگرها انجام دادند، منجر به طبقه­بندی 94 ژنوتیپ برنج در 9 گروه متفاوت گردید (جداول 7، 8، 9 و 10) و (شکل 2 و 3).

 

 

جدول7- تجزیه خوشه­ای ژنوتیپ­های مورد بررسی از نظر صفات زراعی در چهار گروه شرایط غرقاب

شماره ژنوتیپ­ها

گروه­ها

14-59-64-52-26-66-62-33-53-36-55-18-60-57-58-54-30-29-37-43-21-28-27-22-45-41-24-23-74-44-12-32-48-49-46-39-25

گروه اول

63-16-51-47-56-40-31-61-50-42-65-35-38-34

گروه دوم

6-9-68-4-8-79-7-88-87-19-75-67-2-17-15-10-3-11-69-20

گروه سوم

86-77-81-85-76-83-5-82-71-89-72-73-84-7-80-70-90-78-13

گروه چهارم

نام ژنوتیپ­های مورد بررسی در جدول 2 آمده است

 

گروه اول

گروه چهارم

گروه سوم

گروه دوم

شکل2- دندوگرام تجزیه خوشه­ای صفات زراعی تحت شرایط غرقاب

 

 

 

گروه­های ایجاد شده در نقطه برش نشان داد که گروه­های مختلف ایجاد شده از نظر آماره­هایPillai,s Trace ،Willk,s Lambda،Hotelling,s Trace وRoy,s Largest Root (به ترتیب841/1-041/0-804/6 و462/4) با سطح احتمال یک درصد معنی­دار هستند. برای صفات زراعی در شرایط نرمال همه صفات اختلاف معنی­دار داشتند. عملکرد گروه اول، دوم و سوم معنی­دار نبود اما گروه اول و چهارم باهم معنی­دار بودند. صفت طول خوشه گروه­های اول، دوم و سوم با هم معنی­دار نبود (جدول8).

 

جدول8- میانگین گروه­های حاصل از تجزیه خوشه­ای برای صفات زراعی تحت شرایط غرقاب

گروه چهارم

گروه سوم

گروه دوم

گروه اول

صفات

0.720A

0.103A

0.599A

0.965B

وزن اندام هوایی(گرم)

56.193A

62.400B

70.381C

74.324C

روز تا گلدهی(روز)

25.289B

22.400A

22.517A

23.477A

طول خوشه(سانتی متر)

1.596A

2.111B

2.249B

3.036C

وزن خوشه اصلی(گرم)

24.543AB

38.900C

21.964A

26.319B

تعدادخوشه در کل بوته

76.570A

109.116B

126.357B

156.824C

تعداددانه پر

1.476A

1.860B

1.182AB

2.629C

وزن دانه پر(گرم)

76.283A

84.625C

78.526A

78.526AB

باروری(روز)

3932.684A

4295.366AB

4377.690AB

4872.522B

عملکرددرهکتار(تن)

7.543A

8.833B

10.654C

11.265C

تعدادخوشچه اولیه

1.798A

2.075A

2.178A

2.855B

تعدادخوشچه ثانویه

106.524D

99.058C

78.125A

85.538B

ارتفاع بوته(سانتی متر)

اختلاف هر دو گروه که دارای حداقل یک حرف مشترک هستد معنی دار نیست

 

جدول9- تجزیه خوشه­ای ژنوتیپ­های مورد بررسی از نظر صفات زراعی در سه گروه شرایط تنش خشکی

شماره ژنوتیپ­ها

گروه­ها

42-65-50-16-29-34-30-39-31-38-24-66-56-69-21-62-35-36-53-33-47-60-25-40-55-32-64-28-51-43-63-26

گروه اول

37-14-18-17-58-52-45-41-57-44-22-48-23-49-46

گروه دوم

81-72-70-89-75-79-10-2-82-71-74-20-19-15-61-12-27-90-54-88-9-67-59-5-78-76-85-86-80-87-83-77-84-13-11-7-68-3-4-8-6-73-1

گروه سوم

نام ژنوتیپ­های مورد بررسی در جدول 2 آمده است

 


تجزیه ارتباط: از میان 92 آلل موثر بر صفات مورد ارزیابی، هفت آلل با صفات مربوط به عملکرد و اجزای عملکرد مرتبط بودند جداول (11 و 12). آلل RM3370-B درشرایط نرمال در کنترل پنج صفت (وزن اندام هوایی، وزن خوشه اصلی، تعداد دانه پر، وزن دانه پر، تعداد خوشه چه اولیه،) اثر گذار بود. آلل RM484-A در شرایط نرمال بر روی سه صفت (روز تاگلدهی، وزن خوشه اصلی، وزن دانه پر) اثرگذار بود. در شرایط تنش خشکی صفت وزن اندام هوایی تحت تأثیر 9 آلل بود. آلل­های RM587-A، RM6349-A، RM1161-C و RM5558-A هر کدام کنترل کننده چهار صفت بودند. از نظر میزان اثر گذاری آلل­ها بر روی صفات مورد بررسی در شرایط خشکی، آللRM1161-C با 93/9 درصد توجیه برای صفت وزن اندام هوایی دارای بیشترین میزان اثر گذاری را دارا بود. در پژوهشی (5 و 6) مکان ژنی کنترل­کننده روی کروموزوم 6 شناسایی شد و اثر افزایشی آن 614/4- بود. برای ارتفاع بوته نیز یک QTL روی کروموزوم 6 در حد فاصل نشانگر­های461RM-162RM شناسایی شد. برای طول خروج خوشه از غلاف و طول خوشه، دو مکان ژنی کمی کنترل­کننده روی کروموزوم 6 قرار داشت. برای تعداد دانه پر در خوشه، سه مکان ژنی کمی روی کروموزوم­های 1 و 6 با اثر افزایشی آلل 28IR شناسایی شد. مکان­های ژنی کمی شناسایی شده برای وزن دانه و وزن خوشه روی کروموزوم­های 1 و 6 قرار داشتند. برای میزان سوختگی برگ، دو QTL دیده شد. برای میزان لوله شدن برگ سه QTL تشخیص داده شد که از بین آنها1-qROL بیش از سایر QTL ها توانست تغییرات میزان لوله شدن برگ را کنترل کند. برای درصد باروری، سه QTL ردیابی شد که بیشترین تغییرات را QTL روی کروموزوم 6 توجیه نمود. نتایج تحقیق کاتوزی و همکاران (1396) که برروی شناسایی ژن­های کنترل کننده صفات گیاهچه­ای برنج بود نیز نشان داد که چهار QTL در تنش خشکی بر روی کروموزوم3 و 7 مکان­یابی شد. qDRW-3 و qDBM-3 به ترتیب با LOD 518/2 و 727/2 اثر افزایشی بر صفات وزن ریشه و زیست توده داشتند و توانستند به ترتیب 4/11 و 3/12 درصد تغییرات را توجیه نمایند. رضایی و همکاران 1396(3) در پژوهشی از میان 20 آلل موثر بر صفات ارزیابی آلل DO-D با اثر گذاری بر روی سه صفت تعداد دانه در سنبله، تعداد خوشه بارور و عملکرد( دربوته) دارای بیشترین اثرگذاری بر روی عملکرد و اجزای آن بود.

 

 

گروه سوم

گروه دوم

گروه اول

شکل 3- دندوگرام تجزیه خوشه­ای صفات زراعی تحت شرایط خشکی

 

گروه­های ایجاد شده در نقطه برش نشان داد که گروه­های مختلف از نظر آماره­­هایPillai,s Trace  ،Willk,s Lambda،Hotelling,s Trace وRoy,s Largest Root (به ترتیب413/1، 076/0، 745/5 و213 /4) با سطح احتمال یک درصد معنی­دار هستند. از نظر صفت طول خوشه و تعداد کل خوشه­ها در بوته گروه­ها معنی­دار نبودند (جدول 10).

 

 

جدول10- میانگین گروه­های حاصل از تجزیه خوشه­ای برای صفات زراعی تحت شرایط تنش خشکی

گروه سوم

گروه دوم

گروه اول

صفات

0.550A

0.872B

0.618A

وزن اندام هوایی(گرم)

55.472A

67.955B

72.989C

روز تا گلدهی(روز)

21.800A

22.166A

20.580A

طول خوشه(سانتی متر)

1.183A

2.473B

1.290A

وزن خوشه اصلی(گرم)

21.062A

20.466A

18.619A

تعدادخوشه در کل بوته

73.887A

117.736B

81.892A

تعداددانه پر

0.987A

2.080B

0.943A

وزن دانه پر(گرم)

65.213B

67.461B

51.648A

باروری(روز)

2121.938AB

2460.666B

1590.719A

عملکرددرهکتار(تن)

7.166A

10.866B

10.038B

تعدادخوشچه اولیه

1.724A

2.266B

1.765A

تعدادخوشچه ثانویه

90.011C

79.688B

69.328A

ارتفاع بوته(سانتی متر)

3.858B

1.066A

0.817A

طول خروج خوشه از غلاف(سانتی متر)

اختلاف هر دو گروه که دارای حداقل یک حرف مشترک هستد معنی دار نیست.

 

جدول11- نتایج تجزیه ارتباط بین نشانگرهایSSR و صفات مختلف اندازه گیری شده در شرایط غرقاب

ضریب تبیین

(R2)

آماره

(F)

خطای استاندارد

(STD.ERROR)

ضریب رگرسیون

(B)

آلل

عرض از مبدا

صفات

2.87

6.84*

0.008

0.021**

RM3370- B

0.0063

وزن اندام هوایی

4.78

7.33*

0.017

0.067**

RM5558 –A

6.90

11.13**

0.008

0.026**

RM3498 –B

7.86

12.85**

0.010

0.025**

RM589 -A

3.76

10.22**

2.282

16.00**

RM3498 –C

6.667

روز تاگلدهی

7.08

19.37**

2.025

13.33**

RM5642 –E

8.56

29.64**

4.070

20.66**

RM5558 –E

9.20

40.07**

3.892

-13.00**

RM484 -A

4.34

13.05**

0.577

-2.466**

RM5558 –D

23.727

طول خوشه

6.41

14.29**

1.245

4.373**

RM484 –D

7.64

16.14**

0.895

-2.494**

RM3370 –A

4.81

15.76**

0.210

0.908**

RM3370 –B

1.811

وزن خوشه اصلی

6.03

12.12**

0.454

1.422**

RM5558 –E

7.53

15.25**

0.247

0.746**

RM484 -A

2.28

5.02*

2.819

-1.168**

RM589 –A

35.372

تعدادکل خوشه ها

4.40

6.29*

1.856

-6.390**

RM6349 –B

5.82

6.59*

2.983

-6.722**

RM217 -B

3.85

10.66*

3.616

12.517**

RM333 –C

20.133

وزن کل خوشه­ها

5.52

9.86**

3.616

8.828*

RM3370 –B

4.51

13.95**

14.143

73.357**

RM3370 –B

96.972

تعداددانه پر

6.06

12.30**

30.836

-95.330**

RM333 –D

7.05

11.97**

15.393

-34.653*

RM1161 -D

3.69

9.95**

0.231

0.729**

RM3370 –B

1.525

وزن دانه پر

5.10

8.31**

0.271

0.749*

RM484 –A

6.76

10.34**

0.499

1.386*

RM5558 -E

2.93

7.04*

18.310

50.323*

RM5558 –A

39.177

تعدادانه پوک

4.56

6.70*

13.322

-29.177**

RM3370 –A

4.05

11.57**

0.304

1.346**

RM6349 –D

3.707

وزن کل دانه در10مترمربع

5.87

11.38**

0.333

0.884*

RM1161 -D

4.05

11.57**

303.757

1345.784**

RM6349 –D

37.7.212

عملکرددرهکتار

5.87

11.38**

332.749

884.365**

RM1161 -D

2.37

5.27**

1.736

-5.712*

RM5642 –D

9.286

تعدادخوشه چه اولیه

5.14

8.45**

0.804

2.426**

RM3370 –B

2.83

6.705*

0.373

-1.443**

RM484 –D

2.963

تعدادخوشچه ثانویه

6.08

12.409**

0.325

-1.297**

RM589 –A

7.23

130.80**

0.190

-0.520*

RM3370 –C

7.99

13.920**

0.168

-0.386*

RM5642 -B

2.77

6.51*

4.442

-11.886**

RM333 –B

84.419

ارتفاع بوته

4.49

6.51**

5.502

20.164**

RM3498 –D

6.74

10.31**

3.392

10.900**

RM3498 -B

3.23

8.46*

2.536

8.729**

RM5642 –D

2.208

طول خروج خوشه از غلاف

4.88

7.62**

1.389

3.062*

RM3498 -A

4.55

14.19**

0.262

1.101**

RM217 –B

1.913

شکل دانه قهوه­ای

4.64

15.79**

0.234

-0.738**

RM3498 -A

4.55

14.19**

0.262

1.101**

RM217 –B

1.913

شکل دانه سفید

6.64

15.79**

0.234

-0.738**

RM3498 -A

**و* معنی دار در سطح احتمال 1و5 درصد  

 

جدول12- نتایج تجزیه ارتباط بین نشانگرهایSSR و صفات مختلف اندازه گیری شده در شرایط تنش خشکی

ضریب تبیین

(R2)

آماره

(F)

خطای استاندارد

(STD.ERROR)

ضریب رگرسیون

(B)

آلل

عرض از مبدا

صفات

3.41

8.81**

0.006

0.153**

RM1161 –B

0.029

وزن اندام هوایی

5.62

10.27**

0.006

0.122**

RM6349 –D

7.81

17.87**

0.006

-0.122**

RM589 –E

8.63

22.02**

0.010

0.153**

RM587 –A

9.08

25.67**

0.010

-0.017**

RM5558 –A

9.56

43.71**

0.013

-0.101**

RM6349 –A

9.72

54.14**

0.006

0.042**

RM333 –C

9.82

68.85**

0.005

-0.023**

RM5558 –D

9.93

149.03**

0.005

0.019**

RM1161 -C

97.3

11.20**

2.655

-14.948**

RM5642 –C

59.523

روز تا گلدهی

7.12

19.80**

2.655

13.615**

RM587 –B

7.82

17.98**

5.520

12.144*

RM6349 -A

2.98

7.22*

0.834

-2.194*

RM6349 –B

21.649

طول خوشه

4.93

7.76*

1.736

4.306*

RM484 -D

3.61

9.61**

1.442

-6.178**

RM587 –C

19.606

تعدادکل خوشه ها

6.18

12.93**

1.613

5.286**

RM1161 -B

2.21

4.81*

3.136

-14.202**

RM337 –C

29.305

وزن کل خوشه ها

3.93

5.18*

4.065

-17.363**

RM589 –A

5.82

6.59**

2.845

7.229*

RM5642 –B

7.04

8.31**

4.655

11.191*

RM5558 -C

3.47

9.02**

8.36

42.376**

RM1161 –B

66.573

تعداددانه پر

5.01

8.03**

6.004

31.086**

RM3498 –B

6.54

9.44**

14.554

70.101**

RM5558 –E

7.81

12.49**

7.943

-21.340*

RM6349 –B

5.66

16.82**

7.462

28.862**

RM484 –A

9.05

19.14**

7.251

-16.186**

RM5558 -D

2.41

5.39*

14.182

32.086**

RM3370 –B

30.839

تعداد دانه پوک

4.18

5.75*

14.182

31.314**

RM6349 -D

2.42

5.43*

10.791

25.162*

RM3370 -A

56.130

باروری

3.08

7.57*

0.239

-0.657*

RM1161 -C

2.246

وزن دانه در10مترمربع

3.08

7.57*

238.824

-657.259*

RM1161 -C

2245.926

عملکرد در هکتار

4.45

13.60**

0.236

0.872**

RM5642 -E

1.295

تعدادخوشچه ثانویه

3.21

8.02*

4.051

-21.778**

RM3498 –A

96.917

ارتفاع بوته

6.49

14.76**

4.023

-24.361**

RM3498 –C

7.41

14.28**

3.831

-12.750**

RM5642 –E

8.19

15.08**

3.577

-8.778*

RM6349 -B

2.54

5.80*

1.980

5.969**

RM5642 –D

1.031

طول خروج خوشه از غلاف

4.84

7.50*

1.440

3.844**

RM3370 -A

3.33

8.50**

0.217

-0.553*

RM5642 –C

3.125

شکل دانه قهوه­ای

5.54

9.95**

0.224

-1.395**

RM5558 –E

7.32

13.63**

0.249

0.960**

RM5642-E

8.26

16.66**

0.193

-0.535*

RM6349 -B

3.33

8.50**

0.217

-0.553*

RM5642 –C

3.125

شکل دانه سفید

5.54

9.95**

0.224

-1.395**

RM5558 –B

7.32

13.63**

0.249

0.960**

RM5642 –E

8.26

16.66**

0.193

-0.535*

RM6349 -B

**و* معنی دار در سطح احتمال 1و5 درصد  

 


نتیجه گیری

اطلاعات این مطالعه می­تواند برای انتخاب والدین مناسب جهت توسعه ژنوتیپ­ها و جمعیت­های جدید منحمل به تنش خشکی، مورد استفاده قرار گیرد. نشانگرهای SSR مورد استفاده در این مطالعه می­تواند برای سایر مطالعات ژنتیکی برنج مورد استفاده قرار گیرد، زیرا آنها قادر به نشان دادن تنوع ژنتیکی حتی در میان ژنوتیپ­های نزدیک بودند. تجزیه خوشه­ای با گروه­بندی لاین­ها ارزش هر یک از گروه­ها را از نظر صفات مورد ارزیابی شناسایی کرد. نتایج تجزیه ارتباط نشان داد از میان 92 آلل موثر بر صفات مورد ارزیابی، هفت آلل با صفات مربوط به عملکرد و اجزای عملکرد مرتبط هستند. نتایج تجزیه رگرسیون نشان داد که در شرایط نرمال تعداد خوشه­چه ثانویه بیشترین درصد از تغییرات عملکرد (14/0) را توجیه می­کند.

تشکر و قدردانی

بدینوسیله از موسسه بین المللی تحقیقات برنج، معاونت علمی و فناوری ریاست جمهوری و دانشگاه گنبد کاووس جهت حمایت های مالی و معنوی تشکر می گردد.

1-امینی نسب، ر.، و همکاران، بررسی تنوع ژنتیکی ارقام برنج ایرانی با استفاده از نشانگر­های ریز ماهواره پیوسته با ژن­های مقاومت به خشکی، مجله علمی پژوهشی زیست فناوری گیاهان زراعی (سال دوم، بهار و تابستان 1391).

2-رضایی، م.، صبوری، ح.، قلی­زاده، ع.، و محمدی، ر.، 1396. تغییرات آللی، تجزیه ارتباط و تنوع هاپلوتایپی برای نشانگر­های ریز ماهواره­ی پیوسته به ژن­های تحمل به اسیدیته خاک در جو. مجله علمی- پژوهشی  زیست فناوری گیاهان زراعی – سال هفتم- شماره22- (39-27).

3-ربیعی، ب و صبوری، ح. 1387. مکان­یابی ژن­های کنترل کننده صفات کمی. انتشارات دانشگاه گیلان،193صفحه

4-صبوری، ع. صبوری، ح. محمدی نژاد، ق و بیابانی، ع. 1389، تجزیه ژنتیکی اجزای عملکرد و صفات زراعی برنج با استفاده از روش QTL mapping ، یازدهمین کنگره علوم زراعت و اصلاح نباتات، تهران، دانشگاه شهید بهشتی

5-قلی زاده، رو 1397. تنوع آللی برای نشانگرهای پیوسته به QTL هایمرتبط با تحمل خشکی در برنج پایان نامه کارشناسی ارشد. دانشکده کشاورزی و منابع طبیعی؛ دانشگاه گنبد.115ص.

6-کاتوزی، م.، رحیم­زاده خوثی، رضایی، م.، یارنیا، م.، و صبوری، ح. 1395. تعیین مناسب­ترین رقم برنج در تنش حاصل از مدیریت­های مختلف آبیاری. تحقیقات کاربردی اکوفیزولوژی گیاهی3(1): 44-

7-کریم کشته، ر.، و صبوری، ح.، 1394. شناسایی ژنوتیپ­های برنج متحمل به تنش خشکی با تجزیه و تحلیل چند متغیره. مجله بوم­شناسی گیاهان زراعی. جلد11، شماره 4، صفحات 24-13، زمستان 1394.

8-گیلوایی، م.، سمیع زاده، ح.، و ربیعی، ب.، 1396. ارزیابی تجزیه علیت بر روی عملکرد  و اجزای عملکرد در برنج تحت شرایط نرمال و تنش خشکی. پژوهشنامه اصلاح گیاهان زراعی/ سال نهم/ شماره 24/ زمستان 1396.

 

9-Afiukwa, C. A., Faluyi, J. O., Atkinson, C. J., Ubi, B. E., Igwe, D. O., and Akinwale, RO. (2016). Screening of some rice varieties and landraces cultivated in Nigeria for drought tolerance based on phenotypic traits and their association with SSR polymorphism. African Journal of Agricultural Research, 11(29), 2599-2615

10-Awasthi, S., and Prakash Lal, J. (2014). Marker assisted selection for the improvement of Sarjoo-52 for drought tolerance by introgression of MQTL1. 1 from the source Nagina–22. Journal of Plant Molecular Breeding, 2(2), 43.55

11-Bashir, K., Khan, N. M., Rasheed, S., and Salim, M. (2007). Indica rice varietal development in Pakistan: an overview. Paddy and Water Environment, 5(2), 73-81

12-Caetano–Anolles G, Gresshoff PM (1994) Staining Nucleic Acids with silver An Alternative to Radioisotopic and Fluorescent Labeling. Promege Notes Magazine 45:13–21.

13-Cooper, M. 1999. Concepts and strategies for plant adaptation research inrainfed lowland rice. Field Crops Res 64: 13-34.

14-Farooq, M., Basra, S. M. A., Wahid, A., Cheema, Z. A., Cheema, M. A., and Khaliq, A. (2008). Physiological role of exogenously applied glycinebetaine to improve drought tolerance in fine grain aromatic rice (Oryza sativa L.). Journal of Agronomy and Crop Science, 194(5), 325-333.

15-Jaleel, C. A., Manivannan, Paramasivam, Wahid, A., Farooq, M., Al-Juburi, H. J., Somasundaram, Ramamurthy, and Panneerselvam, R. (2009). Drought stress in plants: a review on morphological characteristics and pigments composition. Int. J. Agric. Biol, 11(1), 100-105.

16-Mahgoub, F. (2014). Current status of agriculture and future challenges in Sudan. Nordiska Afrikainstitutet. 57: 7-12.

17-Ndjiondjop, M. N., Cisse, F., Futakuchi, K., Lorieux, M., Manneh, B., Bocco, R., and Fatondji, B. (2010). Effect of drought on rice (Oryza spp.) genotypes according to their drought tolerance level. In Second Africa Rice Congress, Bamako, Mali (Vol. 1, pp. 1-1).

18-Saghi Maroof MA, Biyaoshev RM, Yang GP, Zhang Q, Allard RW (1994) Extra ordinarily polymorphic microsatellites DNA in barley species diversity, chromosomal location, and population dynamics. Proceeding of the National Academy of Sciences of the United States of America 91:5466–5470.

19-Sajib, A. M., Hossain, M., Mosnaz, A. T. M. J., Hossain, H., Islam, M., Ali, M., and Prodhan, S. H. (2012). SSR marker-based molecular haracterization andgeneticdiversity analysis of aromatic landreces of rice (Oryza sativa L.). Journal of BioScience & Biotechnology, 1(2).

20-Sohrabi M., Rafii M.Y., Hanafi M.M. and Latif M.A., (2013). Genetic divergence of Malaysian upland rice revealed by microsatellite markers. POJ, 6(3): 175182

21-Tao, H., Brueck, H., Dittert, K., Kreye, C., Lin, S. and Sattelmacher, B. 2006. Growth and yield formation for rice (Oryza sativa L.) in the water-saving ground cover rice production system (GCRPS). Field Crops Research 95: 1–12.

22-Uphoff, N., Fasoula, V., Iswandi, A., Kassam, A., and Thakur, A. K. (2015). Improving the phenotypic expression of rice genotypes: Rethinking “intensification” for production systems and selection practices for rice breeding. The Crop Journal, 3(3), 174-189

23-Yang,J.C., Liu, K., Zhang, S.F., Wang, X.M., Wang, ZH. Q., and Liu, L.J.2008. Hormones in rice spikelets to water stress during meiosis Acta Agronomica Sinica, 34(1): 111-118.

24-Yashito، T. M. Sandarm، R. biradar، S. Thirumuragau، K. 2004. Sequence specific PCR. Marker for disting uishing rmice line at the basis of wild abortive cytoplasm for their congatc maintir lin. Crop seientific، 44: 920-924