نوع مقاله: مقاله پژوهشی

نویسنده

استادیار گروه بیوتکنولوژی، پژوهشکده علوم محیطی، پژوهشگاه علوم، تکنولوژی پیشرفته و علوم محیطی، دانشگاه تحصیلات تکمیلی صنعتی و فناوری پیشرفته، کرمان، ایران.

چکیده

چکیده
در گیاهان مریستم های انتهای شاخه و ریشه، نواحی دارای سلول‌ های بنیادی هستند. مریستم نوک شاخه سلول های مورد نیاز برای توسعه ساختار های هوایی گیاه مانند برگ‌ها، گل‌ها، شاخه‌ها و فواصل بین Node ها را تامین می کند و مریستم نوک ریشه مسئول ایجاد اندام های زیر زمینی گیاه می باشد. علاوه بر این ریشه از اجزای اصلی تغذیه و استفاده از آب در گیاه می‌باشد. بنابراین رشد و توسعه گیاه وابسته به عمل نواحی مریستمی در ریشه و شاخه می‌باشد. در این مطالعه ترانسکریپتوم نوک شاخه و ریشه گیاه سویا مورد بررسی قرار گرفت تا ژن هایی که در هر یک از این نواحی بیان بالاتری را دارند و احتمالا نقش اساسی در این نواحی دارند شناسایی شوند. به این منظور داده های حاصل از RNA-seq به وسیله نرم افزار CLC Genomic workbench مورد آنالیز واقع شدند. نتایج نشان داد 1956 ژن به طور اختصاصی در نوک شاخه و 1725 ژن به طور اختصاصی در نوک ریشه بیان می شوند. علاوه بر این در نوک شاخه در مقایسه با نوک ریشه 3750 ژن دارای یک افزایش دو یا بیش از دو برابر و 3710 ژن از ژن‌های با کاهش بیان، کاهش بیانی در حد دو و یا بیش از دو را در نوک شاخه داشتند. آنالیز عملکردی ژن متمایز بیان شده نشان داد که این ژن‌ها در فعالیت‌های کاتالیتیک، رونویسی، سیگنالینگ و تنظیم کننده آنزیمی نقش دارند.

کلیدواژه‌ها

عنوان مقاله [English]

Transcriptome profiling of shoot and root tip of soybean

نویسنده [English]

  • Saeid Mirzaei

Department of Biotechnology, Institute of Science, High technology and Environmental Sciences, Graduate University of Advanced Technology, Kerman, Iran‫.‬

چکیده [English]

Abstract
Shoot apical meristem (SAM) and root apical meristem (RAM) are regions in the plant which contain stem cells. SAM provides cells for development of all above-ground structures such as leaves, flowers, branches and inter nodes and RAM is responsible for formation of plant underground organs. Furthermore, root is major component of plant nutrient and use of water in the plant. Therefore, the growth and development of the plant depends on the function of meristematic regions in shoot and root apex. In this study, the transcriptome of the shoot and root tip of soybean were investigated to identify genes that are highly expressed in this regions and likely to have major role in these areas. Hence, RNA-seq data were analyzed using the CLC Genomics workbench. Results revealed 1956 and 1725 genes were specifically expressed in the shoot and root tip, respectively. Moreover in the shoot tip in comparison with the root tip, 3750 genes of differentially expressed genes had a fold change of two or greater and 3710 of down-regulated genes in the shoot tip had a fold change of two or greater. Functional analysis of differentially expressed genes revealed that these genes are involved in catalytic, transcription, signaling and enzyme regulator activities.

کلیدواژه‌ها [English]

  • Transcriptome
  • Shoot tip
  • Root tip
  • Soybean
  • RNA-seq

پروفایل ترانسکریپتوم نوک شاخه و ریشه گیاه سویا

سعید میرزایی

کرمان، دانشگاه تحصیلات تکمیلی صنعتی و فناوری پیشرفته، پژوهشگاه علوم، تکنولوژی پیشرفته و علوم محیطی، گروه بیوتکنولوژی

تاریخ دریافت: 20/2/95                تاریخ پذیرش: 24/7/95 

چکیده

در گیاهان مریستمهای انتهای شاخه و ریشه، نواحی دارای سلولهای بنیادی هستند. مریستم نوک شاخه سلولهای مورد نیاز برای توسعه ساختارهای هوایی گیاه مانند برگها، گلها، شاخه‌ها و فواصل بین Node ها را تأمین می کند و مریستم نوک ریشه مسئول ایجاد اندامهای زیر زمینی گیاه می باشد. علاوه بر این ریشه از اجزای اصلی تغذیه و استفاده از آب در گیاه می‌باشد. بنابراین رشد و توسعه گیاه وابسته به عمل نواحی مریستمی در ریشه و شاخه می‌باشد. در این مطالعه ترانسکریپتوم نوک شاخه و ریشه گیاه سویا مورد بررسی قرار گرفت تا ژنهایی که در هر یک از این نواحی بیان بالاتری را دارند و احتمالاً نقش اساسی در این نواحی دارند شناسایی شوند. به این منظور داده های حاصل از RNA-seq به وسیله نرم افزار CLC Genomic workbench مورد آنالیز واقع شدند. نتایج نشان داد 1956 ژن به طور اختصاصی در نوک شاخه و 1725 ژن به طور اختصاصی در نوک ریشه بیان می شوند. علاوه بر این در نوک شاخه در مقایسه با نوک ریشه 3750 ژن دارای یک افزایش دو یا بیش از دو برابر و 3710 ژن از ژنهای با کاهش بیان، کاهش بیانی در حد دو و یا بیش از دو را در نوک شاخه داشتند. آنالیز عملکردی ژن متمایز بیان شده نشان داد که این ژنها در فعالیتهای کاتالیتیک، رونویسی، سیگنالینگ و تنظیم کننده آنزیمی نقش دارند.

واژه های کلیدی: ترانسکریپتوم، نوک شاخه، نوک ریشه، سویا و RNA-seq

نویسنده مسئول، تلفن: 03433776613 ، پست الکترونیکی: mirzaei56@gmail.com

مقدمه

 

در گیاهان عالی مریستم انتهای شاخه، ناحیه دارای سلولهای ‌بنیادی در سطح خاک می‌باشد (9) که در برگیرنده سلولهای تجدید شونده پلوری‌پوتنت (Pluripotent) در ناحیه مرکزی و سلولهای دختری در حاشیه است (40). این ناحیه سلولهای مورد نیاز برای توسعه ساختار های هوایی گیاه مانند برگها، گلها، شاخه‌ها و فواصل بین Node ها را تأمین می کند (32). دو فعالیت متفاوت، جایگزینی جمعیت سلولهای بنیادی و به کارگیری این سلولها در اندامهای جانبی در مریستم انتهای شاخه بایستی در تعادل باشد. بنابراین مریستم انتهایی شاخه نقش اساسی در رشد اندام هوایی و اندام‌زایی گیاه دارد (1 و 39). مریستم انتهایی ریشه نیز ناحیه‌ای در ریشه‌های در حال رشد می‌باشد که دارای سلولهای مریستمی (بنیادی) می‌باشد (5). این ناحیه معادل مریستم انتهایی شاخه در ریشه است و مسئول ایجاد اندامهای زیر زمینی گیاه می‌باشد. بنابراین رشد و توسعه ریشه وابسته به عمل مریستم ریشه می‌باشد (5). لذا مطالعه دقیق مریستمهای نوک شاخه و ریشه چه از نظر ساختار و چه از نظر عوامل مؤثر ژنتیکی و غیر ژنتیکی می‌تواند نقش مهمی در درک هر چه بهتر رشد و توسعه گیاهان ایفاء کند و این می‌تواند در بهبود گیاهان برای مصارف و کاربردهای خاص در کشاورزی به کار گرفته شود.

سویا با نام علمی Glycine max (L.) Merrill و از خانواده لگوم ها (Leguminosae) می­باشد که دارای 2n=40 کروموزوم است (6). لگوم ها در حقیقت سومین خانواده بزرگ گیاهی از گیاهان گلدار، بعد از Orchidaceae و Asteraceae می باشند و گیاهانی با جثه های گوناگون از بسیار کوچک تا درختانی بزرگ را در خود جای داده است (11 و 38). چندین گونه از گیاهان این خانواده به وسیله بشر اهلی شده اند. در این میان سویا (Glycine max)، نخود (Pisum sativum)، لوبیا (Phaseolus vulgaris) و یونجه (Medicago sativa) مهم ترین گیاهان متعلق به این خانواده می باشند که بعد ازگرامینه (غلاتی مانند گندم، برنج و ذرت) در جایگاه دوم تأمین غذا و علوفه جهان قرار دارند. یک سوم پروتئینهای رژیم غذایی و یک سوم روغنهای گیاهی فرآوری شده برای مصرف انسان، به وسیله لگوم ها تولید می‌شود. لگوم ها همچنین، به عنوان گیاهان علوفه ای (یونجه و شبدر) دارای اهمیت می باشند (12، 14 و 17). علاوه بر این روغنی که از بذرهای لگومی مانند Pongamia pinnata و سویا به دست می آید می تواند برای تولید سوخت زیستی (Biofuel) استفاده شوند و جایگزینی سبز برای سوختهای فسیلی باشند (34).

لذا با توجه به اهمیت ویژه سویا در تغذیه انسان و دام در این مطالعه سعی بر آن است تا با مطالعه ترانسکریپتوم نوک شاخه و ریشه سویا، ژنهایی که در این نواحی بیان متمایزی را دارند شناسایی شوند تا درک بهتری از ژنهای مؤثر در این نواحی به دست آید.

مواد و روشها

رشد گیاه: بذور سویا رقم فارست (Forrest) در این تحقیق مورد استفاده قرار گرفت. ابتدا بذور به وسیله الکل 70 درصد به صورت سطحی ضدعفونی شدند و سپس چندین بار به وسیله آب مقطر استریل شستشو داده شدند. در مرحله بعد بذر ها بین دو کاغذ صافی درون پتری دیش قرار گرفتند و به درون انکوباتور تاریک با دمای 25 درجه منتقل شدند.

نمونه برداری: نوک شاخه و ریشه بذور جوانه زده  بعد  از

گذشت 48 ساعت از زمان انتقال آنها به انکوباتور جمع‌آوری گردید. برای گرفتن نمونه ها از یک اسکالپل استریل استفاده گردید. به این صورت که برای نوک ریشه حدود 2 میلی متر از انتهای ریشه جدا گردید و بلافاصله به ازت مایع منتقل شد. برای نمونه برداری از نوک شاخه ابتدا دو نیمه بذر (کوتیلدون ها) از هم جدا شد و بعد به کمک یک استریو میکروسکوپ و با استفاده از اسکالپل در حدود یک میلی متر از نوک شاخه جدا و سریعاً وارد ازت مایع گردید و در نهایت تا زمان انجام آزمایش بیان ژن به فریزر 80- منتقل گردیدند.

استخراج RNA: RNA کل از نوک ریشه و شاخه تهیه شده با استفاده از ترایزول (TRIzol; Invitrogen) بر اساس روش ارائه شده از سوی کمپانی استخراج گردید. به طور خلاصه ابتدا بافت گیاهی در یک هاون در مجاورت با ازت مایع پودر گردید و بعد از انتقال به یک لوله یک و نیم میلی لیتری، یک میلی لیتر محلول ترایزول به آن اضافه و به مدت 5 دقیقه در دمای اتاق نگهداری گردید. سپس 200 میکرولیتر کلروفرم به نمونه ها اضافه شد و بعد از سه دقیقه نگهداری در دمای اتاق، نمونه ها به مدت 15 دقیقه در دمای چهار درجه با سرعت g 12000 سانتریفیوژ شدند. در مرحله بعد فاز مایع رویی که حاوی RNA است به یک لوله جدید منتقل و 500 میکرولیتر ایزوپروپانول به آن اضافه گردید و در دمای اتاق به مدت 10 دقیقه نگهداری گردیدند. سپس نمونه ها در دمای چهار درجه به مدت 10 دقیقه با سرعت  g12000 سانتریفیوژ شدند. سپس فاز رویی حذف و پلت RNA با اتانول 75 درصد شستشو گردید و در آخر پلت RNA خشک گردید و در 40 میکرولیتر آب بدون RNase حل گردید.

سنتز cDNA: برای حذف آلودگی DNA احتمالی، نمونه‌ها به وسیله آنزیم DNaseI تهیه شده از کمپانی فرمنتاز (Fermentase; Lithuania) تیمار شدند. تقریباً حدود یک میکروگرم از RNA با یک واحد از DNaseI در دمای 37 درجه به مدت 40 دقیقه تیمار شد. به منظور غیر فعال سازی واکنش فوق یک میکرولیتر از EDTA 50 میلی‌ مولار به نمونه ها اضافه و در دمای 65 درجه سانتی گراد به مدت 10 دقیقه نگهداری شدند. برای تبدیل RNA به cDNA یک واکنش 20 میکرولیتری آماده گردید. واکنش تبدیل که شامل: 5 میکرولیتر RNA که آلودگی DNA آن حذف شده بود، 7 میکرولیتر آب استریل بدون RNase، یک میکرولیتر الیگو تی (Oligo(T))، یک میکرولیتر dNTP، 4 میکرولیتر بافر رشته اول، یک میکرولیتر RNase block و یک میکرولیتر آنزیم Reverse transcriptase بود، در دمای 50 درجه سانتی گراد به مدت 60 دقیقه انجام شد. در نهایت نمونه‌های cDNA با استفاده از پرایمر های GmCons6 (25) با انجام PCR تأیید شدند.

Quantitative Real Time PCR (qRT-PCR): توالی DNA ژن مورد نظر برای طراحی پرایمر از بانک ژنومی سویا (Phytozome; http://www.phytozome.net) گرفته شد. به منظور طراحی پرایمر برای qRT-PCR از برنامه طراحی پرایمر اینترنتی، پرایمر 3 (قابل دسترسی در: http://frodo.wi.mit.edu) استفاده شد. توالی های پیشرو و پسرو پرایمر های استفاده شده در جدول 1 آورده شده است.

 

جدول1 - اسامی و مشخصات پرایمرهای استفاده شده در مطالعه

پرایمر پسرو 5’-3’

پرایمر پیشرو5’-3’

نام ژن

AGTGACTGGATCGGTTCACA

GGATACAACTGACACGGCTC

Glyma06g20400

GCAAGGTTTCAGCTCCCAAC

GCTTGAAGGTTGGATTGGAAGTAG

Glyma18g0956

 

برای تعیین فراوانی ترانسکریپت‌های (Transcripts) ژنهای مورد نظر از رنگ سایبر گرین (SYBR Green; Invitrogen) و دستگاه ترمو سایکلر Corbett استفاده گردید. آزمایش شامل سه تکرار بیولوژیک و دو تکرار تکنیکی برای هر یک و کنترل منفی بود. برنامه PCR به این صورت بود: جداسازی اولیه در 95 درجه سانتی گراد به مدت 10 دقیقه؛ 45 سیکل شامل: 95 درجه سانتی گراد به مدت 15 ثانیه، 60 درجه سانتی گراد به مدت یک دقیقه و در ادامه یک مرحله dissociation برای تعیین اختصاصی بودن PCR انجام شد. سطح بیان ژنها نسبت به سطح بیان ژن GmCons6 (25) نرمال سازی گردید.

بیوانفورماتیک و آنالیز داده های توالی یابی: قطعات توالی یابی شده (Reads) ترانسکریپتوم نوک شاخه و ریشه از دانشگاه کوئینزلند استرالیا تهیه گردید. کیفیت قطعات توالی یابی شده با استفاده از نرم افزار Fastx tool kit تعیین گردید. قطعات توالی یابی شده شاخه و ریشه با استفاده از نرم افزار CLC Genomics Workbench بر روی ژنوم سویا جایابی (Map) شدند. عمل جایابی با استفاده از عمل (قابلیت) RNA-seq نرم افزار مذکور با شرایط حداقل اندازه قطعه 9/0 و حداقل تشابه قطعه 8/0 انجام شد. فراوانی نسبی ترانسکریپت ها به صورت تعداد قطعه در کیلوباز اگزون بر میلیون قطعه جایابی شده (Read Per Kilobase of exon model per Million mapped reads (RPKM)) به دست آمد.

ژنهای متمایز بیان شده با مقایسه سطح بیان ژنها بین نمونه ریشه و ساقه و با استفاده از آزمایش Kal(22) شناسایی شدند. ژنهایی که بیش از دو برابر افزایش یا کاهش بیان داشتند و ارزش p آزمایش Kal کمتر از 05/0 بود به عنوان ژنهای با بیان متمایز تعیین گردیدند. تجزیه و تحلیل عملکردی (Functional analysis) ژنهای متمایز بیان شده با استفاده از نرم افزار Blast2GO انجام پذیرفت. به این منظور ابتدا آنتولوژی ژن (Gene Ontology) برای فهرست ژنهای با بیان متمایز استخراج گردید و سپس در نرم افزار مذکور وارد گردیده و گروه بندی عملکردی ژنها ترسیم گردید (10).

نتایج

جایابی قطعات توالی یابی شده بر روی ژنوم: برای درک اینکه نحوه بیان ژنها در نوک شاخه و ریشه سویا (نواحی در بر گیرنده مریستمهای انتهایی گیاه) چگونه است و چه ژنهایی بیان بیشتری در این نواحی دارند پروفایل ترانسکریپتی نوک شاخه و ریشه گیاه سویا با هم مقایسه گردید. سنجش کیفیت قطعات توالی یابی شده با استفاده از نرم افزار FastX tool kit نشان داد که قطعات توالی یابی شده از کیفیت بالایی (Phred score بیش از 33) برخوردار هستند. لذا جایابی کل قطعات بر روی ژنوم انجام شد. از مجموع 39284610 قطعه توالی یابی شده در نوک شاخه، 34063809 قطعه به طور اختصاصی بر روی ژنوم سویا جایابی شدند و 5220801 قطعه بر روی ژنوم جایابی نشدند و یا به طور غیر اختصاصی جایابی شدند. در نوک ریشه از مجموع 34169345 قطعه توالی یابی شده، 28999578 قطعه به طور اختصاصی بر روی ژنوم جایابی گردیدند و بقیه قطعات (5169768) بر روی ژنوم جایابی نشدند و یا به طور اختصاصی جایابی نشدند.

ترانسکریپتوم نوک شاخه و ریشه سویا: بیان ژنها در آنالیز داده های توالی یابی RNA به صورت "قطعه در کیلوباز اگزون بر میلیون قطعه جایابی شده (Read per Kilobase of exon model per Million mapped reads; RPKM) اندازه گیری شد (29). در مقایسه نوک شاخه با نوک ریشه و با در نظر گرفتن اینکه حداقل یک قطعه بر روی ژن جایابی شده باشد، مشخص شد که 1956 ژن به طور اختصاصی در نوک شاخه و 1725 ژن به طور اختصاصی در نوک ریشه بیان می شوند. با در نظر گرفتن شرایط سخت تر (حداقل تعداد قطعه برای هر ژن 100 در نظر گرفته شود) تعداد ژنهایی که به طور اختصاصی در شاخه بیان می شوند به 83 ژن و ژنهای اختصاصی ریشه به 93 ژن کاهش می یابند. اسامی 10 ژن از ژنهای اختصاصی شاخه و ریشه که بیشترین تعداد قطعه را به خود اختصاص داده بودند در جدول های 2 و 3 آورده شده است. شایان ذکر است که لیست کامل ژن­ها در یک گزارش تحقیقاتی ارائه گردیده است (2). مقایسه بیان ژنها در نوک شاخه و ریشه گیاه سویا نیز نشان داد که حدود 9713 ژن در نوک شاخه در مقایسه با نوک ریشه بیان متمایزی (تست کال؛ p 05/0) را داشتند.

 

 

جدول 2- اسامی 10 ژن اختصاصی شاخه با بیشترین تعداد قطعه جایابی شده

 

کد ژن

تعداد قطعات

بهترین معادل کارکرد ژن بر اساس آرابیدوپسیس

1

Glyma12g08270

1102

BEL1-like homeodomain 8

2

Glyma02g43760

894

KNOX/ELK homeobox transcription factor

3

Glyma20g04240

828

myb domain protein 106

4

Glyma07g35560

793

myb domain protein 16

5

Glyma04g05210

788

KNOTTED-like from Arabidopsis thaliana

6

Glyma19g34410

701

photosystem II reaction center W

7

Glyma05g07800

681

RNI-like superfamily protein

8

Glyma09g34190

676

Ankyrin repeat family protein

9

Glyma17g12200

668

plant-specific transcription factor YABBY family protein

10

Glyma08g09380

625

F-box family protein

جدول 3- اسامی 10 ژن اختصاصی ریشه با بیشترین تعداد قطعه جایابی شده

 

کد ژن

تعداد قطعات

بهترین معادل کارکرد ژن بر اساس آرابیدوپسیس

1

Glyma07g04320

1911

germin 3

2

Glyma14g03300

781

sucrose phosphate synthase 3F

3

Glyma16g33000

678

Protein of unknown function (DUF1442)

4

Glyma19g01120

609

Oxidoreductase, zinc-binding dehydrogenase family protein

5

Glyma04g08300

512

calmodulin like 43

6

Glyma09g12330

512

PLATZ transcription factor family protein

7

Glyma12g00540

503

NAC domain containing protein 70

8

Glyma18g52680

489

Uncharacterised protein family (UPF0497)

9

Glyma11g20460

476

glycosyltransferase family protein 2

10

Glyma07g17170

472

Laccase/Diphenol oxidase family protein

 

 

بسیاری از این ژنها (4967؛ حدود 51 درصد ژنهای متمایز بیان شده) افزایش بیان معنی دار و حدود 4746 ژن (حدود 49 درصد از ژنهای متمایز بیان شده) کاهش بیان معنی داری در نوک شاخه در مقایسه با نوک ریشه داشتند. از ژنهایی که افزایش بیان نشان دادند، 3750 ژن (5/75 درصد) دارای یک افزایش دو یا بیش از دو برابر بودند و 3710 ژن از ژنهای با کاهش بیان (حدود 78 درصد) کاهش بیانی در حد دو و یا بیشتر از دو را در نوک شاخه داشتند.

ژنهایی با بیان بسیار بالا در نوک شاخه یا ریشه: علاوه بر ژنهایی که کاملاً به طور اختصاصی در نوک شاخه و نوک ریشه بیان می‌شوند، همان طور که در بالا گفته شد ژنهای فراوان دیگری هستند که از نظر میزان بیان در این دو ناحیه بسیار متفاوت هستند. برای تعیین ژنهایی که با دامنه اختصاصی بیشتری در نوک شاخه یا ریشه بیان می شوند می‌توان تفاوت سطح بیان (fold change) معنی دار را بالاتر، مانند 10 یا حتی 100 برابر در نظر گرفت. با در نظر گرفتن 10 برابری تفاوت سطح بیان در این دو ناحیه مشاهده شد که 2083 ژن افزایش یا کاهش بیان معنی دار 10 برابری در نوک شاخه در مقایسه با نوک ریشه داشتند. از این تعداد 1103 ژن کاهش بیان و 980 ژن افزایش بیان را نشان دادند. با احتساب تفاوت سطح بیان معنی دار در حد 100 برابر افزایش یا کاهش در نوک شاخه مشاهده شد که حدود 452 ژن دارای این افزایش و کاهش بیان بودند. از این 452 ژن 200 ژن افزایش بیان و 252 ژن کاهش بیان در نوک شاخه در مقایسه با نوک ریشه نشان دادند (جدول4). در نوک شاخه این افزایش بیان به بیش از 2000 برابر برای ژن Glyma18g09560 و کاهش بیان به بیش از 3500 برابر برای ژن Glyma20g04830 می‌رسید.

آنالیز تجزیه و تحلیل عملکردی ژنهای متمایز بیان شده نشان داد که این ژنهای متمایز بیان شده بیشترین نقش را به ترتیب در فعالیتهای بیولوژیک: کاتالیتیک، فعالیت متصل شوندگی (binding)، فعالیت آنتی اکسیدانی، فعالیت فاکتور نسخه برداری، فعالیت انتقال دهنده (transporter activity)، فعالیت تنظیم کننده آنزیمی، فعالیت مبدل مولکولی (molecular transducer activity)، فعالیت ذخیره غذایی (nutrient reservoir activity) و فعالیت انتقال دهنده الکترون دارند (شکل 1).

تأیید بیان بعضی از ژنها که به طور متمایزی در شاخه بیان شدند: برای تأیید بیان ژنها، دو ژن از ژنهایی که بیان متمایزی در نوک شاخه و ریشه داشتند انتخاب گردیدند (جدول 5). qRT-PCR برای تأیید بیان ژنهای انتخاب شده مورد استفاده قرار گرفت.

 

 

 

جدول 4- یک لیست انتخابی از ژنهایی با بیشترین افزایش و کاهش بیان در نوک شاخه. ردیفهای به رنگ خاکستری بیانگر ژنهای با کاهش بیان در شاخه می باشد.

 

کد ژن

بهترین معادل برای کارکرد ژن بر اساس آرابیدوپسیس

نسبت افزایش یا کاهش بیان

مقدار احتمال

1

Glyma18g09560

UDP-Glycosyltransferase superfamily protein

2/2066

00001/0>

2

Glyma17g05760

germin 3

9/1990

00001/0>

3

Glyma17g14710

Plant-specific transcription factor YABBY family protein

2/1794

00001/0>

4

Glyma09g31640

alpha/beta-Hydrolases superfamily protein

3/1607

00001/0>

5

Glyma05g04260

Plant-specific transcription factor YABBY family protein

1/1389

00001/0>

6

Glyma17g34810

homeobox gene 1

4/1177

00001/0>

7

Glyma07g01740

HAD superfamily, subfamily IIIB acid phosphatase

9/1020

00001/0>

8

Glyma19g37890

PEBP (phosphatidylethanolamine-binding protein) family protein

8/811

00001/0>

9

Glyma03g32820

 

2/801

00001/0>

10

Glyma10g39720

Homeobox-leucine zipper family protein / lipid-binding START domain-containing protein

9/783

003/0

11

Glyma20g04830

Ribonuclease T2 family protein

5/3594-

00001/0>

12

Glyma06g20400

BANQUO 3

3/2294-

00001/0>

13

Glyma03g02760

 

7/1652-

00001/0>

14

Glyma11g20710

Late embryogenesis abundant (LEA) protein-related

8/1586-

00001/0>

15

Glyma18g02200

Pollen Ole e 1 allergen and extensin family protein

2/1254-

00001/0>

16

Glyma12g07350

Late embryogenesis abundant (LEA) protein-related

5/1221-

00001/0>

17

Glyma08g04040

 

1/1213-

00001/0>

18

Glyma18g06220

Peroxidase superfamily protein

9/1084-

00001/0>

19

Glyma10g02090

Pollen Ole e 1 allergen and extensin family protein

6/1077-

00001/0>

20

Glyma11g03130

Predicted AT-hook DNA-binding family protein

4/1053-

00001/0>

 

جدول 5- میزان بیان ژنهای انتخاب شده برای آزمایش qRT-PCR.

کد ژن

مشخصات

تغییرات بیان

Glyma06g20400

BANQUO 3

2294-

Glyma18g09560

UDP-Glycosyltransferase superfamily protein

2066

 

 

شکل 1- کارکرد مولکولی ژنهای متمایز بیان شده با استفاده از نرم افزار Blast2GO

 

نتایج نشان داد که بیان ژنهای انتخاب شده سازگار با نتایج RNA-seq بود (شکل های 2 و 3). همان طور که در شکل دیده می‌شود بیان ژن Glyma06g20400 (BANQUO 3) که در نوک شاخه بیان کمتری داشت در نتایج حاصل از qRT-PCR نیز به شدت در ریشه بیان می‌شود در حالی که بیان ناچیزی در نوک شاخه دارد (شکل 2). ژن Glyma18g09560 (UDP-Glycosyltransferase superfamily protein) که در شاخه بیان بالایی داشت نیز به طور مشابهی در نوک شاخه به شدت بیان می شود در حالی که در ریشه بیان چندانی ندارد (شکل 3).

بحث 

تکنیک RNA-seq یک روش جدید برای مطالعات بیان ژن می باشد که افق جدیدی را برای محققین باز کرده است. در این مطالعه بررسی داده های حاصل از این تکنیک بر روی نوک شاخه و نوک ریشه سویا اطلاعات جامعی از نوع و تعداد و میزان ژنهای بیان شده در این نواحی فراهم کرد. نتایج نشان داد که ژنهای درگیر در فرآینده های کاتالیتیک، نسخه برداری، سیگنالینگ، پاسخ سلولی در نوک شاخه و ریشه سویا فعال هستند. برای مثال نتایج حاصل از qRT-PCR تأیید کرد که ژن Glyma18g09560 که متعلق به خانواده گلیکوزیل ترانسفرازها می باشد در نوک شاخه سویا در مقایسه با ریشه به میزان بالاتری و ژن Glyma06g20400 (BANQUO3) متعلق به خانواده Baisc helix-loop-helix (BHLH) تنظیم کننده های رونویسی (28) به میزان کمتری بیان می‌شوند. علاوه بر این ژن Glyma17g14710، مسئول یک فاکتور رونویسی متعلق به خانواده YABBY، ژن Glyma14g05150 فاکتور رونویسی KNOX/ELK homeobox و ژن Glyma02g04710 فاکتور رونویسی متعلق به خانواده MADS-box بیان بالاتری در نوک شاخه در مقایسه با نوک ریشه داشتند. ژن Glyma19g39340 که یک فاکتور پاسخ دهنده به اکسین می باشد نیز در نوک شاخه بیان بالاتری را داشت.

گلیکوزیل تراسفرازها مسئول انتقال گلیکوزیل از یک دهنده فعال به یک مولکول گیرنده هستند و یک باند گلیکوزیک را ایجاد می کنند. گلیکوزیل ترانسفرازها در تمامی ارگانیسمهای زنده یافت می‌شوند. تعداد بسیاری از این گلیکوزیل ترانسفرازها داری موتیف خاصی هستند که این گروه به UDP گلیکوزیل ترانسفرازها معروف هستند.

 

 

شکل 2- میزان بیان ژن Glyma06g20400 (BANQUO 3) بر اساس آنالیز qRT-PCR

 

شکل 3- میزان بیان ژن Glyma18g09560 (UDP-Glycosyltransferase superfamily protein) بر اساس آنالیز qRT-PCR

 

UDP گلیکوزیل ترانسفرازها گیاهی در یک دامنه‌ای ‌از فعالیتها درگیر هستند و در بسیاری از آنها از UDP-glucose در واکنش انتقال استفاده می شود. این واکنش چندین نتیجه مهم دارد: 1- ترکیبات ممکن است در نتیجه اتصال گلوکز فعال یا غیر فعال شوند. برای مثال بسیاری از هورمونها در نتیجه گلیکوزیله شدن غیر فعال می شوند 2- گلیکوزیله شدن با افزایش خصوصیات هیدروفیلیک باعث تغییر حلالیت ترکیبات می شوند (24).

در نتیجه این وقایع گلیکوزیله شدن از طریق تنظیم سطح، فعالیت و محل متابولیتهای کلیدی سلول باعث یک پایداری نسبی سلولی می شود. افزایش بیان گلیکوزیل تراسفراز ها در نوک شاخه بیانگر این است که آنها به احتمال زیاد با تغییر خصوصیات اگلیکون ها در فرآیند های تمایزی بخش هوایی نقش دارند (24).

فاکتورهای رونویسی به توالی DNA متصل می شوند و بیان ژن را در گیاهان و حیوانات تنظیم می‌کنند (35). تقریباً تمامی فرایند‌های بیولوژیک یا به طور مستقیم به وسیله فاکتور های رونویسی تنظیم می‌شوند یا اینکه به وسیله آنها تحت تاثیر قرار می‌گیرند و اختصاصاً فرآیند‌های توسعه‌ای به شدت تحت کنترل وجود و عدم وجود فاکتورهای رونویسی است (35). با بررسی ژنهای متمایز بیان شده مشخص می شود که فاکتورهای رونویسی متعلق به خانواده YABBY و MADS box در نوک شاخه بیان بیشتری در مقایسه با نوک ریشه داشتند. فاکتورهای رونویسی متعلق به خانواده BHLH (برای مثال BANQUO3) و بعضی از فاکتورهای رونویسی متعلق به (No Apical Meristem) NAC بیان کمتری در نوک شاخه از خود نشان دادند، این به این معنی است که این ژنها بیان بالاتری در نوک ریشه دارند. علاوه بر این فاکتورهای رونویسی متعلق به خانواده WRKY نیز در ریشه بیان بالاتری را از خود بروز دادند. این موارد از کاهش و افزایش بیان فاکتورهای رونویسی در این مرحله توسعه‌ای گیاه تأییدی است بر نقش آنها در فرآیندهای توسعه‌ای گیاه سویا.

YABBY  یک گروه از خانواده فاکتور‌های رونویسی است که نقش مهمی در تعیین قطبیت (Polarity) اندام بازی می کند (8، 13، 23 و 36). این فاکتور رونویسی در استقرار قطبیت abaxial-adaxial در اندامهای جانبی نقش دارد (7، 15، 37). فاکتورهای رونویسی خانواده YABBY دارای یک ناحیه (Domain)zinc-finger در ناحیه انتهایی اسید‌آمینه‌ای و یک ناحیه YABBY در انتهای کربوکسیل خود هستند. Glyma17g1471 یک فاکتور رونویسی متعلق به خانواده YABBY است که در نوک شاخه سویا در مرحله جوانه‌زنی بیان بیشتری (حدود 1800 برابر) داشت. در مطالعات گوناگون نشان داده شده است که فاکتورهای رونویسی متعلق به خانواده YABBY در مراحل توسعه‌ای سویا نقش دارند (16، 21، 35). افزایش بیان این ژن متعلق به این خانواده بیانگر نقش مهم آن در این مرحله حساس رشدی گیاه است که در حال بیرون آمدن از بستر کشت و شکل گرفتن اندامهای هوایی است که می‌تواند با تعیین قطبیت در ارتباط باشد. علاوه بر این ژنهای Glyma17g12200 که نیز متعلق به این خانواده فاکتورهای رونویسی هستند جزء گروه ژنهای کاملا اختصاصی بیان شده در نوک شاخه هستند (جدول 2). Shamimuzzaman و همکاران نیز نشان دادند که بیان ژنهای Glyma13g22620 و Glyma17g12200 در مراحل ابتدایی رشد گیاه افزایش می‌یابد (35).

ژنهای MADS-box رمز کننده فاکتورهای رونویسی هستند و در گیاهان، حیوانات و قارچها وجود دارند. در گیاهان ژنهای MADS-box معادل ژنهای Homeobox جانوران هستند و شامل ژنهای تنظیم کننده توسعه‌ای می‌باشند (30). نتایج این تحقیق نشان داد که ژن Glyma16g13070 متعلق به خانواده MADS-box به طور کاملاً اختصاصی در نوک شاخه و ژنهای Glyma02g04710 و Glyma01g02880 از جمله ژنهایی از خانواده فاکتورهای رونویسی MADS-box هستند که بیان بیشتری در نوک شاخه سویا از خود نشان دادند. به احتمال زیاد این ژنها تعدادی از ژنهای MADS-box هستند که در مراحل ابتدایی توسعه‌ای گیاه نقش دارند و برای تأیید این نیاز به تحقیقات بیشتر و تکمیلی می‌باشد.

BANQUO3  فاکتور رونویسی متعلق به خانواده BHLH می باشد که در تنظیم پاسخهای به نور فعال می‌باشد و در میزان کلروفیل، رنگ کاسبرگ و گلبرگ نقش دارد (28). لذا کاهش بیان این ژن (جدول 4) در مراحل ابتدایی رشد (در مرحله جوانه زنی) دور از انتظار نیست چرا که در این مرحله گیاه هنوز در معرض نور قرار نگرفته است. علاوه بر این ژنهای BNQ در تنظیم زمان گلدهی نیز نقش دارند و این نیز تأیید کننده نتیجه به دست آمده در این تحقیق می باشد.

بعضی از ژنهای مشابه با ژنهای گروه NAC نیز بیان متمایزی در نوک شاخه و نوک ریشه از خود نشان دادند. پروتئینهای حاوی ناحیه NAC نیز گروهی از فاکتورهای رونویسی هستند که در دامنه‌ گسترده‌ای از فعالیتهای بیولوژیک شامل جنین‌زایی، توسعه گل، تشکیل چوب و شاخه‌زایی نقش دارند (4، 20، 27، 31 و 40). بررسی داده‌های RNA-seq نشان داد که ژنهای متعلق به این گروه مانند ژن Glyma04g01650 به طور اختصاصی در نوک شاخه و ژنهای Glyma09g36820 و Glyma12g00540 به طور اختصاصی در نوک ریشه و ژنهای Glyma12g35530، Glyma13g34950 و Glyma06g35660 بیان بالاتری در نوک شاخه در مقایسه با ریشه داشتند. ژنهای Glyma08g17140 و Glyma15g42050 بیان بیشتری را در نوک ریشه بروز دادند. این افزایش و کاهش بیان تعدادی از ژنهای متعلق به این خانواده در نوک شاخه و ریشه نشان از نقش فعال آنها در مرحله ابتدایی رشد و نمو ریشه و شاخه دارد.

ژنهای خانواده WRKY نیز مانند دیگر فاکتورهای رونویسی، تنظیم کننده بیان ژنهای دیگر در گیاهان هستند. آنها به عنوان فعال کننده یا متوقف کننده بسیاری از فرآیندهای بیولوژیک مانند جوانه‌زنی، توسعه‌ای و پاسخ به تنشهای زنده و غیر زنده نقش دارند (33). در میان ژنهای متمایز بیان شده نیز تعدادی ژن مرتبط با این دسته وجود دارد. در این مطالعه مشخص شد که ژن Glyma05g25270 به طور اختصاصی در ریشه بیان می‌شود و ژنهای Glyma08g43260، Glyma15g20990 و Glyma18g49140 بیان بیشتری در ریشه داشتند و نشان از نقش آنها در توسعه ریشه در مراحل ابتدایی دارند.

فاکتور پاسخ به اکسین 2 گروهی دیگر از فاکتورهای رونویسی هستند که به اجزای پاسخ دهنده به اکسین در پروموتور ژنهای تنظیم کننده اکسین متصل می‌شوند (26). مطالعات نشان داده است که موتاسیون در Auxin responsive factor 2 (ARF2) به ایجاد فنوتیپهایی مانند رشد افزایش یافته اندامهای هوایی و اندازه بذر به دلیل افزایش تقسیم سلولی، جلوگیری از باز شدن جوانه گلها، تأخیر در گلدهی، پیری برگ، ریزش اندام گل و رسیدگی غلاف شده است (26). علاوه بر این نشان داده شده است که ARF2 متوقف کننده سیگنالینگ اکسین است. Glyma19g39340 یک ژن کاندید برای ARF2 در سویا است که بیان آن در نوک شاخه در مقایسه با ریشه قابل ملاحظه بود. این می‌تواند دلیلی بر نقش آن در این مرحله توسعه‌ای گیاه باشد تا اندازه اندام هوایی گیاه را تنظیم کند. همچنین آلومینیوم از طریق تأثیر بر فعالیت اکسین اکسیداز و کاهش بیوسنتز فاکتور های رشد موجب کاهش رشد ریشه می شود (3).

به طور کلی وجود تعداد زیادی ژن از گروه فاکتورهای رونویسی در میان ژنهای متمایز شده با مطالعات دیگر نیز سازگار است (18 و 19). بیان متمایز فاکتورهای رونویسی مانند ژن Glyma17g14710 متعلق به خانواده YABBY، ژن Glyma14g05150 متعلق به خانواده KNOX/ELK و ژن Glyma02g04710 متعلق به خانواده MADS-box در نوک شاخه در مقایسه با نوک ریشه نشان از نقش مهم این ژنها در مراحل توسعه‌ای گیاه سویا دارد. چرا که این ژنها با فعال کردن یا خاموش کردن بیان دیگر ژنهای پایین دستی، بسیاری از فعالیتهای بیولوژیک را کنترل می‌کنند. علاوه بر این ژن Glyma04g01650 متعلق به خانواده NAC که در فرآیند شاخه زایی درگیر می باشد به طور اختصاصی در نوک شاخه سویا بیان داشت که می تواند دلیلی بر نقش آن در شاخه  زایی باشد. در نتیجه مجموعه ژنهای گزارش شده در این مطالعه می تواند ساختاری برای بررسی و مطالعه بیشتر مسیرهای تنظیم کننده مریستم و نهایتاً رشد و توسعه گیاه باشد.

تشکر و قدردانی

نویسنده این مقاله از دانشگاه تحصیلات تکمیلی صنعتی  و

فناوری پیشرفته به خاطر حمایت مالی به شماره 534/7 تقدیر و تشکر می نماید. همچنین از آقای پرفسور پیتر گرشف (دانشگاه کوئیزلند استرالیا) به خاطر در اختیار گذاشتن داده های اولیه تشکر و قدردانی صورت می گیرد.

1-      جعفری، س.، شریف نیا، ف.، پیوندی، م. و نیکنام، ف. ۱۳۹۴. بررسی تکوین مریستم زایشی، تشکیل گل، سنجش میزان کربوهیدرات و فعالیت آنزیمی گیاه عناب (Zizyphus jujuba Mill). مجله پژوهش های گیاهی (مجله زیست شناسی ایران).  دوره ۲۸، شماره ۱،  صفحه ۷۸-۷۲ .

2-      میرزایی، س. 1395. گزارش طرح پژوهشی بررسی ترانسکریپتوم نوک شاخه و ریشه گیاه سویا جهت شناسایی ژنهای با بیان بالا در این نواحی. دانشگاه تحصیلات تکمیلی صنعتی و فناوری پیشرفته.

3-      نجفی، ف. و محمدی، ف. 1394. تاثیر ایندول استیک اسید بر میزان رشد، پروتئین، فعالیت آنزیم های کاتالاز و پراکسیداز در گیاه سویا (Glycine max (L.) Merr) تحت تنش آلومینیوم کلراید. مجله پژوهش های گیاهی (مجله زیست شناسی ایران). دوره 28، شماره 1، صفحه 198-186.

 

4-       Aida M., Ishida T., Fukaki H., Fujisawa H., and Tasaka M. 1997. Genes involved in organ separation in Arabidopsis: an analysis of the cup-shaped cotyledon mutant. The Plant Cell Online. 9(6):841-857.

5-       Baumann K. 2013. Plant cell biology: The roots of quiescence. Nat Rev Mol Cell Biol. 14(12):754-754.

6-       Bilyeu K., Ratnaparkhe M. B., and Kole C. 2010. Genetics, Genomics, and Breeding of Soybean (CRC Press)

7-       Bowman J. 2000. The YABBY gene family and abaxial cell fate. Curr Opin Plant Biol. 3:17-22.

8-       Bowman J., Eshed Y., and Baum S. 2002. Establishment of polarity in angiosperm lateral organs. Trends Genet. 18:134-41.

9-       Chickarmane V. S., Gordon S. P., Tarr P. T., Heisler M. G., and Meyerowitz E. M. 2012. Cytokinin signaling as a positional cue for patterning the apical-basal axis of the growing Arabidopsis shoot meristem. Proceedings of the National Academy of Sciences of the United States of America. 109(10):4002-4007.

10-   Conesa A, Götz S., Garcia-Gomez J. M., Terol J., Talon M. and RoblesM. 2005. Blast2GO: a universal tool for annotation, visualization and analysis in functional genomics research. Bioinformatics. 21(18):3674-3676.

11-   Doyle J. J. 1994. Phylogeny of the legume family an approach to understanding the origins of nodulation. Annual Review of Ecology and Systematics. 25:325-349.

12-   Doyle J. J. and Luckow M. A. 2003. The rest of the iceberg. Legume diversity and evolution in a phylogenetic context. Plant Physiology. 131(3):900-910.

13-   Eshed Y., Baum S., Perea J., and Bowman J. 2001. Establishment of polarity in lateral organs ofplants. Curr Biol. 11:1251-1260.

14-   Gepts P.,Beavis W. D., Brummer E. C., Shoemaker R. C., Stalker H. T., Weeden N. F., and Young N. D. 2005. Legumes as a model plant family. Genomics for food and feed report of the cross-legume advances through genomics conference. Plant Physiology. 137(4):1228-1235.

15-   Goldshmidt A., Alvarez J., Bowman J., and Eshed Y. 2008. Signals derived from YABBY gene activities in organ primordia regulate growth and partitioning of Arabidopsis shoot apical meristems. Plant Cell. 20:1217-1230.

16-   Gonzalez D. and Vodkin L. 2007. Specific elements of the glyoxylate pathway play a significant role in the functional transition of the soybean cotyledon during seedling development. BMC Genomics. 8:468.

17-   Graham P. H. and Vance C. P. 2003. Legumes: Importance and constraints to greater use. Plant Physiology. 131(3):872-877

18-   Haerizadeh F., Singh M. B., and Bhalla P. L. 2011. Transcriptome profiling of soybean root tips. Functional Plant Biology. 38(6):451-461.

19-   Haerizadeh F., Wong C. E., Singh M. B., and Bhalla P. L. 2009. Genome-wide analysis of gene expression in soybean shoot apical meristem. Plant Mol Biol. 69(6):711-727.

20-   Hu R., Qi G., Kong Y., Kong D., Gao Q. and Zhou G. 2010. Comprehensive analysis of NAC domain transcription factor gene family in Populustrichocarpa. BMC Plant Biology. 10(145):1-23.

21-   Jones S., Gonzalez D., and Vodkin L. 2010. Flux of transcript patterns during soybean seed development. BMC Genomics. 11:136.

22-   Kal A. J., Van Zonneveld A. J., Benes V., Van den Berg M., Koerkamp M. G., Albermann K., Strack N., Ruijter J. M., Richter A., Dujon B., Ansorge W. and Tabak H. F. 1999. Dynamics of gene expression revealed by comparison of serial analysis of gene expression transcript profiles from yeast grown ontwo different carbon sources. Molecular Biology of the Cell. 10(6):1859-1872.

23-   Kumaran M., Bowman J., and Sundaresan V. 2002. YABBY polarity genes mediate the repression of KNOX homeobox genes in Arabidopsis. Plant Cell. 14:2761-2770.

24-   Li J., JiaD., and Chen X. 2001. HUA1, a Regulator of Stamen and Carpel Identities in Arabidopsis, Codes for a Nuclear RNA Binding Protein. The Plant Cell Online. 13(10):2269-2281.

25-   Libault M., Thibivilliers S., Bilgin D. D., Radwan O., Benitez M., Clough S. J., and Stacey G. 2008. Identification of four soybean reference genes for geneexpression normalization. Plant Genome. 1(1):44-54.

26-   Lim P. O.,Lee I. C., Kim J., Kim H. J., Ryu J. S., Woo H. R., and Nam H. G.,2010. Auxin response factor 2 (ARF2) plays a major role in regulating auxin-mediated leaf longevity. Journal of Experimental Botany. 61(5):1419-1430.

27-   Mao C.,Ding W., Wu Y., Yu J., He X., Shou H., and Wu P. 2007. Overexpression of a NAC-domain protein promotes shoot branching in rice. New Phytologist. 176(2):288-298.

28-   Mara C. D., Huang T., and Irish V. F. 2010. The Arabidopsis Floral Homeotic Proteins APETALA3 and PISTILLATA Negatively Regulate the BANQUO Genes Implicated in Light Signaling. The Plant Cell. 22(3):690-702.

29-   Mortazavi A., Williams B., McCue K., Schaeffer L., and Wold B. 2008. Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nat Methods. 5:621-628.

30-   Nam J., dePamphilis C. W., Ma H., and Nei M. 2003. Antiquity and Evolution of the MADS-Box Gene Family Controlling Flower Development in Plants. Molecular Biology and Evolution. 20(9):1435-1447.

31-   Ohtani M.,Nishikubo N., Xu B., Yamaguchi M., Mitsuda N., Goué N., Shi F., Ohme-Takagi M., and Demura T.2011. A NAC domain protein family contributing to the regulation of woodformation in poplar. The Plant Journal. 67(3):499-512.

32-   Perales M. and Reddy G. V. 2012. Stem cell maintenance in shoot apical meristems. Current Opinion in Plant Biology. 15(1):10-16.

33-   Rushton P. J., Somssich I. E., Ringler P., and Shen Q. J. 2010. WRKY transcription factors. Trends in Plant Science. 15(5):247-258.

34-   Scott P. T., Pregelj L., Chen N., Hadler J. S., Djordjevic M. A. and Gresshoff P. M.2008. Pongamiapinnata: an untapped resource for the biofuels industry of the future. BioEnergy Research. 1(1):2-11.

35-   Shamimuzzaman M. and Vodkin L. 2013. Genome-wide identification of binding sites for NAC and YABBY transcription factors and co-regulated genes during soybean seedling development by ChIP-Seq and RNA-Seq. BMC Genomics. 14(1):477.

36-   Sieber P., Petrascheck M., Barberis A., and Schneitz K. 2004. Organ polarity in Arabidopsis. NOZZLE physically interacts with members of the YABBY family. Plant Physiol. 135:2171-2185.

37-   Siegfried K. R., Eshed Y., Baum S. F., Otsuga D., Drews G. N., and Bowman J. L.,1999. Members of the YABBY gene family specify abaxial cell fate in Arabidopsis. Dev. 126:4117-4128.

38-   Smykal P., Jovanovic Z., Stanisavljevic N., Zlatkovic B., Cupina B., Dordevic V., Mikic A. and Medovic A. 2014. A comparative study of ancient DNA isolated from charred pea (Pisum sativum L.) seeds from an Early Iron Age settlement in southeast Serbia: inference for pea domestication. Genetic Resources and Crop Evolution. 61(8):1533-1544.

39-   Tsuda K. and Hake S. 2016. Chapter 14-Homeobox Transcription Factors and the Regulation of Meristem Development and Maintenance. Plant Transcription Factors, ed Gonzalez DH (Academic Press, Boston), pp 215-228.

40-   Xie Q., Frugis G., Colgan D., and Chua N. H. 2000. Arabidopsis NAC1 transduces auxin signal downstream of TIR1 to promote lateral root development. Genes & Development. 14(23):3024-3036.