نوع مقاله: مقاله پژوهشی

نویسندگان

1 فارغ التحصیل

2 عصو هیات علمی دانشگاه زنجان، دانشکده کشاورزی، گروه علوم دامی

3 دانشگاه زنجان، دانشکده کشاورزی، گروه علوم دامی

4 سازمان جهاد کشاورزی زنجان، معاونت بهبود تولیدات دام

چکیده

چربی اعماء و احشا و دنبه درصد قابل توجهی از وزن لاشه در گوسفند را به خود اختصاص می دهد. در تحقیق حاضر ارتباط پلی‌مورفیسم ژن تیروگلوبولین (TG) با خصوصیات لاشه در گوسفند افشاری مورد بررسی قرار گرفت. بدین منظور از تعداد 98 راس بره نر 11 ماهه نمونه خون گرفته و از آن DNA استخراج گردید. آغازگرهای لازم با استفاده از توالی ژن TG گاو طراحی شدند. محصولات حاصل از PCR با روش SSCP مورد بررسی قرار گرفت. با بررسی باندها بر روی ژل اکریل آمید، تمامی نمونه‌ها در 6 گروه ژنوتیپی D- ,AC ,AB ,BB ,AA وEE قرار گرفتند. نتایج نشان داد که بین ضخامت چربی بین دنده 13-12 و ژنوتیپ‌ها تفاوت معنی‌دار )05/0>(p وجود دارد و ژنوتیپ BB کمترین (38/1cm) و ژنوتیپ D- بیشترین (87/1cm) میزان انباشت چربی در این ناحیه را دارند بالعکس درصد ضایعات به طور معنی‌داری در ژنوتیپ BB (20/4) از سایر گروه‌ها بیشتر و در ژنوتیپ D- (04/3) کمتر بود. ژنوتیپ BB کمترین مقدار عمق عضله راسته (09/2)، درصد راسته (60/15)، درصد سردست (87/15) و درصد لاشه (70/42) را داشت. و همچنین ژنوتیپBB به طور معنی‌داری کمترین میزان درصد قلوه‌‌گاه (08/15) و وزن قبل از کشتار (40/52) را نشان داد. ژنوتیپ D- بیشترین میزان درصد قلوه‌گاه (94/16) وژنوتیپ AB (36/59) بیشترین میزان وزن قبل از کشتار را داشتند و اختلاف بین گروه‌ها معنی‌دار بود. با توجه به این یافته می توان ژن TG را به عنوان یک ژن کاندید برای استفاده در برنامه های اصلاح نژاد این نژاد از گوسفند در نظر گرفت

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Association of polymorphism in 5’ UTR of thyroglobulin gene with carcass traits in Afshari×Booroola Merino cross lambs

نویسندگان [English]

  • malihe nezamabadi 1
  • taher harakinejad 2
  • mohammad hossein shahir 3
  • moradpasha eskandarinasab 3
  • leila danesh moghadam 1
  • rahman rostamkhani 4

چکیده [English]

Tail and other adipose fat comprise a considerable fraction of carcass composition. This study aimed to assess association between polymorphism in thyroglobulin gene (TG) and carcass traits in Afshari sheep. To do this, a study was conducted using 97 male lambs of Afshari breed. Lambs were at age of 11 month before slaughtering. Primers were designed based on sequences available for cow. To identify different genotypes SSCP procedure were implicated on PCR products. Six different genotypes namely AA, AB, BB, AC, D- and EE were found according to the bands on non-denaturing polyacrylamide gel. There were significant differences between back fat thickness (BFT) among genotypes and BB and D- had the most and least BFT respectively. Among all genotypes, BB had lowest carcass percentage (42.7) and Longissimus dorsi muscle diameter (2.09) and live weight in animals of this genotype was also the lowest. In contrast genotype AB had the highest live weight. These results are indicating that TG can be considered as a candidate gene when improvement of the carcass quality is a goal in breeding planes

کلیدواژه‌ها [English]

  • "Afshari sheep"
  • "Carcass traits"
  • "Thyroglobulin"
  • "Polymorphism"

ارتباط پلی­مورفیسم5'UTR  ژن تیروگلوبولین با خصوصیات لاشه در بره­های آمیخته افشاری× برولا مرینو

ملیحه نظام­آبادی 1، طاهر هرکی­نژاد1و2*، محمد­حسین شهیر1، روناک خرمتایی1 ، مرادپاشا اسکندری نسب1، لیلا دانش مقدم1 و رحمان رستمخانی3

1 زنجان، دانشگاه زنجان، دانشکده کشاورزی، گروه علوم دامی

2 زنجان، دانشگاه زنجان، پژوهشکده فناوریهای نوین زیستی

3 زنجان، سازمان جهاد کشاورزی، معاونت بهبود تولیدات دام

تاریخ دریافت:7/9/93                   تاریخ پذیرش: 28/5/94 

چکیده

چربی اعماء و احشاء و دنبه درصد قابل توجهی از وزن لاشه در گوسفند را به خود اختصاص می­دهد. در تحقیق حاضر ارتباط پلی­مورفیسم ژن تیروگلوبولین (TG) با خصوصیات لاشه در گوسفند افشاری× برولا مرینو مورد بررسی قرار گرفت. بدین منظور از تعداد 98 راس بره نر 11 ماهه نمونه خون توسط ونوجکت حاوی EDTA از ورید وداج (گردن) گرفته و از آن DNA استخراج گردید. آغازگرهای لازم به دلیل عدم وجود توالی مربوطه در گوسفند در زمان طراحی پرایمر با استفاده از توالی ژن TG گاو طراحی شدند. محصولات حاصل از PCR با طول قطعه 545 جفت باز با روش SSCP مورد بررسی قرار گرفت. با بررسی باندها بر روی ژل اکریل­آمید، تمامی نمونه­ها در 6 گروه ژنوتیپی D- ,AC ,AB ,BB ,AA وEE قرار گرفتند. نتایج نشان داد که  بین ضخامت چربی بین دنده 13-12 و ژنوتیپها تفاوت معنی­دار )05/0>(p وجود دارد و ژنوتیپ BB کمترین (38/1cm) و ژنوتیپ D- بیشترین (87/1cm) میزان انباشت چربی در این ناحیه را دارند بالعکس درصد ضایعات به طور معنی­داری در ژنوتیپ BB (20/4) از سایر گروهها بیشتر و در ژنوتیپ D- (04/3) کمتر بود. ژنوتیپ BB کمترین مقدار عمق عضله راسته (09/2)، درصد راسته (60/15)، درصد سردست (87/15) و درصد لاشه (70/42) را داشت. و همچنین ژنوتیپBB به طور معنی­داری کمترین میزان درصد قلوه­گاه (08/15) و وزن قبل از کشتار (40/52) را نشان داد. ژنوتیپ D- بیشترین میزان درصد قلوه­گاه (94/16) و ژنوتیپ AB (36/59) بیشترین میزان وزن قبل از کشتار را داشتند و اختلاف بین گروهها معنی­دار بود. با توجه به این یافته می­توان ژن TG را به عنوان یک ژن کاندید برای استفاده در برنامه های اصلاح نژاد این نژاد از گوسفند در نظر گرفت.   

واژه های کلیدی: گوسفند افشاری، خصوصیات لاشه،  تیروگلوبولین، پلی­مورفیسم

* نویسنده مسئول، تلفن: 09127432664، پست الکترونیکی: Taher.Harkinezhad@znu.ac.ir

مقدمه 

 

واحدهای ترشحی غده تیروئید فولیکولها هستند که یک ماده غیر شفاف به نام کلوئید را در بر می­گیرند که حاوی تیروگلوبولین (TG) و مقدار کمی تیروآلبومین ید­دار است. تیروگلوبولین پیش­ساز تمام هورمونهای تیروئیدی است. این پروتئین (TG) هورمونی بزرگ است که شایع ترین فرم آن دارای 660 کیلو دالتون وزن مولکولی است. این مولکول بزرگ در بین 5000 اسید آمینه خود تنها حاوی حدود 115 اسید آمینه تیروزین دارد. این اسید آمینه­ها ید­دار و به هم می پیوندند تا هورمونهای فعال تیروئیدی ساخته شوند. همانند سایر پروتئینها TGدر شبکه اندوپلاســمیک خشــن سلولهای فولیــکولی سنتز می شود و قــند دار شدن آن در دســــتگاه گلژی انجام می­گیرد. سپس TG در ویزیکولهای اگزوسیتوزی بسته بندی می­شوند و به داخل فولیکول منتقل می­شود. 8 تا 10 درصد وزن TG کربوهیدرات و2/0 تا 1 درصد وزن آن ید است. هورمونهای تیروئیدی به صورت قسمتی از مولکول تیروگلوبولین در حفره درونی فولیکول ذخیره می­شوند. این تیروگلوبولین به صورت کلوئید است سپس این قطره به لیزوزوم متصل می­شود تا فاگوزوم (اندوزوم) را تشکیل دهد. پروتئازهای داخل فاگوزوم TG را به اسید­آمینه­های تشکیل دهنده و T4 ، T3 ، rT3 ، DIT و MIT هیدرولیز می­کند.

پروتئین TG به عنوان ماتریکسی برای سنتز هورمونهای تیروئیدی، تیروکسین (T4) و تری­یدوتیرونین (T3) می­باشد. بیوسنتز هورمون تیروئید در برگیرنده متابولیسم تیروگلوبولین و ید است و تمامی مراحل توسط TSH تشدید می­یابند. این هورمون نسخه­برداری ژن تیروگلبولین را افزایش می­دهد. هورمونهای تیروئیدی نقش بسیار مهمی در تنظیم متابولیسم داشته و می­توانند روی رشد آدیپوسیت­ها، تمایز و هموستازی انباشت چربی مؤثر باشند (3و7). این هورمونها با افزایش لیپولیز در بافت چربی روی متابولیسم چربی اثر دارند، گاهی ممکن است افزایش فعالیت بعضی از آنزیمها مثل مالیک آنزیم، سیترات لیاز، گلوکز 6- فسفات دهیدروژناز لیپوژنز را هم تحریک کنند.   

این ژن دارای 48 اگزون بوده که دارای طول توالی حدود 270 کیلو جفت باز می­باشد و به طور وسیعی مورد مطالعه قرار گرفته است. بارندز (1999) توانست در ژن TG در گاو یک پلی­مورفیسمی را در ناحیه غیرترجمه شونده (5'UTR) که تنظیم رونویسی و ترجمه ژن توسط آن انجام می­گیرد شناسایی کند که با میزان ماربیلینگ مرتبط بود (5). ارتباط معنی­داری بین اسکور ماربیلینگ (چربی داخل عضلانی) با نشانگر DNA، CSSM66، پیدا شده است. این نشانگر روی کروموزوم 14 گاو نزدیک سانترومر قرار گرفته است. مشخص شده که ژن تیروگلوبولین نیز نزدیک این نشانگر قرار دارد. از آنجایی که ناحیه 5'UTR ژن در رونویسی بسیار اهمیت دارد از این رو اثر زیادی روی میزان تیروگلوبولین موجود دارد. با بررسی پلی­مورفیسم DNA در این قسمت ژن تیروگلوبولین سه ژنوتیپ مختلف در گاو شناسایی شده است و مشخص گردیده است که یکی از آللها به میزان زیادی با اسکور ماربیلینگ مرتبط است (5و19). انتظار می­رود ضخامت چربی زیر­پوستی و درصد چربی بافتی چون شیر تحت تأثیر TG قرار گیرد چرا که یدوتیرونین­ها تمایز آدیپوسیتی را تحت تأثیر قرار می­دهند (3). دیوبی و همکاران گزارش کرده اند که چندشکلی در ناحیه پروموتر ژن تیروگلوبولین با درصد چربی شیر در گاومیش مرتبط است (10). اثر چند شکلی ناحیه پروموتر این ژن در گاو گوشتی چینی نیز مورد بررسی قرار گرفته است، در این دام چند شکلی در ناحیه مذکور بر رشد اثر گذاشته است اما ارتباطی با ترکیبات لاشه نداشته است(22). در حالی که آنتون و همکاران(2008) گزارش کرده اند که چندشکلی در این ژن با چربی داخل عضله پشت در نژادهای گاو در بلغارستان ارتباط داشته است (4). ارتباط این ژن با اسکور چربی مرمری در گاو گوشتی توسط هو و همکاران(2011) نیز گزارش شده است (13). 

کروموزوم 9 گوسفند همولوگ کروموزوم 14 گاو می­باشد و ژن تیروگلوبولین در گاو که مشخص شده با مقدار چربی لاشه در ارتباط است همان طور که جلوتر اشاره شد روی این کروموزوم قرار دارد. چنین ارتباطی در گوسفند مورد بررسی قرار نگرفته است. چربی لاشه، چربی زیر­پوست و نیز دنبه قسمت قابل توجهی از وزن لاشه گوسفندان را تشکیل می­دهند و این چربیها اغلب در کشتارگاهها جدا می­شوند و مطلوب خریداران گوشت نیست. هدف از این پژوهش بررسی ارتباط چندشکلی در ژن تیروگلوبولین با چربی و سایر صفات لاشه در گوسفند افشاری×برولامرینو بود.

مواد و روشها 

جهت اجرای تحقیق تعداد 98 رأس بره نر 11 ماهه آمیخته افشاریx برولامرینو نسل F3 که در گله اصلاح نژادی گوسفند افشاری مزرعه آموزشی- پژوهشی دانشگاه زنجان در شرایط یکسانی پرورش داده شدند، انتخاب شدند. به دلیل امکانات مزرعه و شرایط آب و هوایی منطقه زایش بره­های ذکر شده از دهم فروردین ماه  شروع و تا نیمه اول تیر ماه ادامه داشت. البته 40 درصد زایشها در یک ماه اول انجام شد. بره ها معمولاً تا سن چهار ماهگی به طور دائم و یا چند ساعت در روز به همراه مادرانشان بودند. بنابر­این سن 220 روزگی در این مطالعه به عنوان سن از شیر­گیری در نظر گرفته شد. تمامی گوسفندان از تغذیه یکسان برخوردار بودند. بره­ها در 1 تا 2 هفته اول پس از زایش در کنار مادران قرار داشته و از شیر میشها به طور تمام وقت تغذیه می­کردند. سپس از مادر جدا شده و تنها در سه نوبت صبح، ظهر و شب برای استفاده از شیر میشها در کنار آنها قرار می­گرفتند در این مدت سه نوبت نیز تغذیه دستی انجام می شد. جیره بره­ها شامل مخلوطی از یونجه خرد شده، آرد جو و مکملهای ویتامینی و درمانی بود که تا حد اشتها در اختیار دامها قرار داده می­شد به گونه­ای که حدود 20 درصد خوراک داده شده باقی می­ماند و در آخر هر روز جمع آوری می­گردید. بره­ها در سالنی مسقف و با نور و تهویه مناسب در دمای 5 تا 25 در جه سانتی گراد نگهداری می­شدند. یک هفته قبل از کشتار، بره­ها پشم­چینی شدند. بره­ها پس از تحمل 18 ساعت گرسنگی توزین شدند و جهت اندازه­گیری ضخامت چربی، ضخامت و سطح مقطع عضله راسته در ناحیه بین دنده  13-12 با استفاده از سونوگرافی، ناحیه مورد نظر توسط تیغ تراشیده شد. سونوگرافی با استفاده از دستگاه التراسوند Sonovet 600 (ساخت کشور آمریکا) و پراب 5 مگاهرتز انجام گرفت. برای اندازه گیری ضخامت چربی پشت (UBF) و ضخامت عضله راسته(ULMD) از تمامی بره­ها در ناحیه ذکر شده فیلم تهیه شد. نرم افزار Scion Image  برای بررسی فیلمهای تهیه شده جهت اندازه­گیریUBF ، ULMD  مورد استفاده قرار گرفت. همچنین ابعاد مربوط به طول بدن، دور سینه و فاصله دوپا به وسیله متر پارچه­ای و ارتفاع جدوگاه با استفاده از کولیس فلزی بزرگ اندازه­گیری شد.

خونگیری جهت استخراج DNA انجام شد. جهت تهیه نمونه­های خون از ونوجکت خلاء­دار 5 سی­سی حاوی ماده ضد انعقاد EDTA استفاده شد. خونگیری از سیاه­رگ وداج صورت گرفت و نمونه­ها در ظرف محتوی یخ به آزمایشگاه منتقل شدند. نمونه­های خون قبل از استخراج DNA در دمای منهای 20 درجه سانتی گراد نگهداری شدند و استخراج DNA از تمام نمونه­های خون انجام پذیرفت.

بره­ها پس از تحمل 24 ساعت گرسنگی توزین و سپس کشتار شدند. در کشتارگاه پس از بر داشتن پوست دام، ضخامت چربی CBF و عضله CLMD بین دنده  22و 21 در همان ناحیه سونوگرافی­شده، توسط خط­کش فلزی با دقت 2 میلی متر روی لاشه اندازه­گیری شد. لاشه­ها پس از کشتار توزین و به یک شرکت بسته­بندی گوشت منتقل و به مدت 24 ساعت در سردخانه نگهداری شدند. سپس لاشه­ها از سردخانه خارج و با دقت از طول به دو نیمه چپ و راست تقسیم گردیدند و نیم لاشه راست جهت تعیین اندازه­های لاشه استفاده گردید. نیم لاشه مذکور به قطعات گردن، ران، سردست، قلوه گاه، راسته، دنبه تقسیم و ضایعات )چربی روی لاشه و اعماء و احشاء( آن اندازه­گیری شد. داده­های به دست آمده از بررسیهای قبل و بعد از کشتار دامها توسط نرم افزار SQL server  و SPSS تجزیه و تحلیل شد.

DNA خون با روش فنول-کلروفرم تعدیل شده استخراج گردید. از پرایمر های GGGGATGACTACGAGTATGACTG F: و GTGAAAATCTTGTGGAGGCTGTA R: برای تکثر قطعه مورد نظر توسط PCR استفاده شد. هر مخلوط واکنش (25lµ) شامل 16 پیکومول از هر پرایمر، 50 نانوگرم DNA ژنومیک، 8/0 IU تک­پلیمراز، 1/0lµ تک بافرPCR، 200  Mµ از هر dNTP(سیناژن)، 2mM  MgCl2 و 50 KCl mM بود. برنامه زمانی به ترتیب، مرحله واسرشتگی اولیه به مدت 5 دقیقه با دمای 96 درجه، 30 چرخه شامل سه مرحله: 96 درجه به مدت یک دقیقه، دمای اتصال 56 درجه به مدت 1 دقیقه و 72 درجه به مدت 5/1 دقیقه و یک چرخه گسترش نهایی 72 درجه به مدت 5 دقیقه برای انجام PCR در نظر گرفته شد. جهت واسرشته کردن محصولات PCR پس از مخلوط شدن با بافر لودینگ به نسبت 25 به 10 به مدت 5 دقیقه در حرارت 96 درجه قرار گرفته و بلافاصله روی یخ انتقال داده شدند و به مدت 10 دقیقه در دمای منهای 20 درجه سانتی گراد قرار گرفتند. سپس با استفاده از ژل غیر واسرشته­ساز اکریلامید 12 درصد با ولتاژ 170 به مدت 19 ساعت الکتروفورز انجام شد. رنگ­آمیزی ژلها با استفاده از رنگ­آمیزی معمول نیترات نقره انجام گرفت و ژنوتیپ حیوانات مشخص گردید(9). از هر ژنوتیپ سه نمونه تعیین توالی گردیدند. تجزیه آماری داده­ها با استفاده از نرم­افزار SPSS و مقایسه میانگینها با استفاده از آزمون چند دامنه­ای دانکن انجام شد. در این پژوهش از وزن تولد، تیپ تولد و سن مادر بره­ها به عنوان متغیر کمکی (کواریت) در تجزیه و تحلیل داده­ها استفاده شد. مدل آماری:  (مدل 1)

Yij = µ+Gi+ Tj + eij

Yij =  مقدار صفت برای هر دام µ = میانگین جامعه Gi = اثر ثابت ژنوتیپ Tj = اثر ثابت تیپ تولد، eij= مقادیر باقیمانده می باشد

نتایج و بحث

تکثیرناحیه 5'UTR ژن تیروگلوبولین گوسفند با استفاده از آغازگرهای طراحی شده  با موفقیت انجام گرفت. الکتروفورز محصولات PCR واسرشته بر روی ژل اکریلامید، شش الگوی باندی و ژنوتیپ مختلف را نشان داد (شکل 1). 98 نمونه تکثیر یافته از طریق SSCP تعین ژنوتیپ شده، مورد آنالیز قرار گرفتند و مشخص شد که ژنوتیپ AA بیشترین (37=n) و ژنوتیپ EE کمترین (4=n) فراوانی را در جمعیت مورد مطالعه داشتند( جدول 1).

 

 

 

 



 

 


















 
 

 
 
 




 


 



 
 
 
 
 



 
 
 

 


 

 






















 
 


 
 
 
 
 






 




 



 
 

 

 

 


شکل1- نتایج حاصل از انجام SSCP محصولات PCR  روی ژل اکریلامید 12%.

 

جدول1- فراوانی ژنوتیپی ژن تیروگلوبولین

ژنوتیپ

فراوانی

درصد

AA

37

76/37

AB 

25

51/25

BB 

7

14/7

AC 

11

22/11

D- 

14

29/14

EE 

4

08/4

کل

98

100

در جدول 2 میانگین و درصد صفات چربی لاشه در گروههای ژنوتیپی ژن TG نشان داده شده است. ضخامت چربی در فواصل دنده 13-12 در بین ژنوتیپها تفاوت معنی­دار )05/0>(p داشت و ژنوتیپ BB کمترین و ژنوتیپ D- بیشترین میزان انباشت چربی در این ناحیه را داشتند. بالعکس درصد ضایعات به طور معنی­داری در ژنوتیپ BB از سایر گروهها بیشتر و در ژنوتیپ D- کمتر بود. بین وزن ضایعات و دنبه و درصد دنبه در گروههای ژنوتیپی تفاوتی مشاهده نشد .در بره های دارای ژنوتیپ D- بیشترین میزان چربی پشت اما کمترین درصد ضایعات مشاهده شد و نسبت به سایر گروهها به همراه ژنوتیپ AC کمترین درصد دنبه  را داشتند. احتمال دارد که این ژنوتیپ موجب افزایش انباشت چربی در پشت و کاهش میزان چربی در دنبه گردد و بر عکس ژنوتیپ BB موجب کاهش انباشت چربی زیر جلدی شود و از آنجایی که سنتز چربی ادامه دارد ذخیره چربی در سایر قسمتها مانند دنبه افزایش پیدا کند.

در جدول 3 میانگین و درصد صفات لاشه در گروههای ژنوتیپی ژن تیروگلوبولین نشان داده شده است. ارتباطی بین گروههای ژنوتیپی با عمق عضله راسته، درصد راسته، درصد سردست، درصد لاشه و وزن لاشه وجود نداشت. اما ژنوتیپ BB کمترین مقدار عمق عضله راسته، درصد راسته، درصد سردست و درصد لاشه را داشت.

 

 

 

جدول 2- ارتباط ژنوتیپهای مختلف ژن تیروگلوبولین و صفات چربی لاشه بره­های افشاری×برولامرینو.

ژنوتیپ

تعداد هر ژنوتیپ 

AA 

(37=n)

AB 

(25=n)

BB

(7=n)

AC 

(11=n)

D-

(14=n)

EE

(4=n)

SEM

ضخامت چربی دنده 12-13(cm)

ab64/1

ab70/1

a38/1

ab76/1

b87/1

ab59/1

173/0

درصد ضایعات

ab64/3

ab44/3

b20/4

ab77/3

a04/3

ab71/3

409/0

وزن ضایعات(kg)

89/0

93/0

94/0

94/0

79/0

79/0

118/0

درصد دنبه

35/5

77/5

61/5

91/4

97/4

21/5

895/0

وزن دنبه(kg)

34/1

56/1

27/1

26/1

29/1

15/1

215/0

اسکور

00/3

14/3

95/2

00/3

17/3

93/2

249/0

    حروف مختلفa،b در هر ردیف نشان­ دهنده اختلاف معنی­دار)05/0 (P< است.

 

قبلاً نیز ارتباط معنی­داری بین TG و ضخامت چربی پشت و سطح مقطع عضله راسته در گاوهای Bos indicus گزارش شده است به این صورت که حیوانات هتروزیگوت چربی کمتر و سطح مقطع راسته کوچکتری نسبت به ژنوتیپ هموزیگوت داشتند(18) ممکن است کروموزم 14 محلی برای دو ژن مختلف باشد که بر روی این دو صفت اثر می­گذارند و نشانگر TG هم روی این دو ژن اثر می­گذارد و یا ممکن است یک ژن در این ناحیه وجود داشته باشد که بر روی دو صفت اثر دارد و نشانگر TG هم روی آن ژن اثرگذار باشد (7). به هرحال این ژن با سنتز پیش سازهای هورمونهای تیروئیدی می تواند نقش مهمی در متابولیسم داشته باشد و قسمت پروموتر آن می تواند تنطیم کننده اصلی در این میان باشد در کل نقش پروموتر همیشه اساسی است(1 و 2) البته نتایج تحقیقاتی که در مورد تأثیر ژن TG بر چربی داخل عضلانی (چربی مرمری) و نیز چربی پشت در گاو انجام شده است در برخی موارد ضد و نقیض است(8، 16 و 18) .  ژنوتیپBB  به طور معنی­داری کمترین میزان درصد قلوه­گاه  را نشان داد. در حالی که کمترین وزن قبل از کشتار مربوط به ژنوتیپ EE بود)05/0 (P<. ژنوتیپ D- بیشترین میزان درصد قلوه­گاه و این ژنوتیپ  به همراه ژنوتیپ AB بیشترین میزان وزن قبل از کشتار را داشتند و اختلاف بین گروهها معنی­دار بود. ژنوتیپ EE  به طور معنی­داری بیشترین و ژنوتیپ D- کمترین درصد وزن گردن را داشت. مشخص شده است که  SNP در موقعیت T422C ژن TG تولید چربی را بهبود داده و به عنوان یک نشانگر ژنی برای ذخیره چربی مرمری در گاوهای گوشتی مورد استفاده قرار می­گیرد (5، 6 و 14) و بین درصد قطعات لاشه و وزن لاشه با پلی­مورفیسم در این ژن ارتباط معنی­دار گزارش کرده­اند(11). نتایج این پژوهش نیز نشان می­دهد چند شکلی در این ژن بر روی برخی صفات لاشه به خصوص ضخامت چربی پشت اثرگذار است که با بسیاری از مطالعات قبلی مطابقت دارد.

 

 

جدول 3- ارتباط ژنوتیپهای مختلف ژن تیروگلوبولین با  لاشه بره­های نر افشاری×برولامرینو.

ژنوتیپ

تعداد هر ژنوتیپ

AA 

(37=n)

AB 

(25=n)

AC 

(11=n)

BB

(7=n)

D-

(14=n)

EE

(4=n)

SEM

عمق عضله دنده 12-13(cm)

23/2

43/2

31/2

09/2

38/2

21/2

159/0

درصد ران

ab89/30

ab33/30

b84/31

b85/32

b69/31

a25/28

140/0

درصدراسته

14/16

98/15

86/15

60/15

07/16

28/16

780/0

درصد سردست

87/16

13/17

22/16

87/15

36/17

22/17

660/0

درصد قلوه­گاه

ab46/16

ab60/16

ab66/16

a08/15

b94/16

ab41/16

634/0

درصد گردن

ab38/8

a83/8

a27/8

a17/8

a02/8

b27/10

664/0

درصد لاشه

51/43

00/44

03/44

70/42

40/43

37/44

20/1

وزن لاشه(kg)

35/24

17/26

82/24

44/22

82/25

47/21

74/1

وزن قبل از کشتار(kg)

ab95/55

b36/59

ab45/54

ab40/52

b25/59

a25/48

46/3

         حروف مختلفa،b در هر ردیف نشان­ دهنده اختلاف معنی­دار)05/0 (P< است.

 

 

 

در مطالعه گان و همکاران (2008) مشخص شد ارتباط معنی­داری بین SNPهای C133G، A156G، T220C و C506A در ژن TG با اسکور ماربلینگ وجود دارد (12). اما ون­اننام و همکاران (2007) و همچنین کاسس و همکاران (2005) ارتباط معنی­داری بین این مارکر و اسکور ماربلینگ پیدا نکردند. در این تحقیقات سایر صفات لاشه ارزیابی نشده بود ممکن است این ژن روی چربی مرمری اثری نداشته اما روی سایر صفات اثر­گذار باشند و مدیریت و محیط و نژاد اثر زیادی روی عملکرد این ژن دارند (8 و 19).

تالر و همکاران (2003) ارتباطی بین چربی بین عضلانی در عضله راسته گاو شاروله آلمان با پلی­مورفیسم در TG پیدا نکردند. ولی ارتباط معنی­داری بین TG و ضخامت چربی پشت و سطح مقطع عضله راسته در گاوهای Bos indicus پیدا شد به این صورت که حیوانات هتروزیگوت چربی کمتر و سطح مقطع راسته (LMA) کوچکتری نسبت به ژنوتیپ هموزیگوت داشتند (18). در تحقیق حاضر نیز مشخص شد پلی­مورفیسم در ژن TG و ایجاد ژنوتیپ BB موجب کاهش ضخامت چربی و کاهش عمق عضله راسته خواهد شد. در ژنوتیپ D- بالاترین میزان چربی پشت و به همراه ژنوتیپ AB بالاترین میزان عمق عضله راسته وجود دارد که با گزارش کاسس و همکاران (2005) و تالر و همکاران (2003) مطابقت دارد (8 و 18). از آنجایی که ژنوتیپ D- موجب افزایش ضخامت چربی پشت می­شود ممکن است موجب کاهش چربی مرمری گردد زیرا بوترفیلد در مطالعه­ای که بر روی میشها و بره­های اخته انجام داد گزارش کرد که نسبت بالاتر چربی زیر پوستی منجر به کمتر شدن چربی داخل ماهیچه­ای می­شود(6).

QTL برای سطح مقطع عضله راسته روی کروموزوم 14 شناسایی نشده است. ریلی و همکاران (2002) گزارش کردند همبستگی ژنتیکی و فنوتیپی بین ضخامت چربی و LMA در گاوهای برهمن به ترتیب 02/0 و 10/0 می­باشد (15). این نشان می­دهد احتمال آنکه ژنهای یکسانی هر دو را کنترل کنند، بسیار کم است.

رینکر و همکاران (2006) هیچ ارتباط معنی­داری بین مارکر TG و چربی ماربلینگ، چربی بین عضلانی و ضخامت چربی پشت پیدا نکردند اما بین درصد قطعات لاشه و وزن لاشه با پلی­مورفیسم در این ژن ارتباط معنی­دار گزارش کردند (17). به علت آنکه مارکر TG یک مارکر رایج برای بهبود ماربلینگ است. تعیین آنکه آیا اثری روی سایر صفات تولیدی هم دارد، حائز اهمیت است ولی در گزارش کاسس و همکاران (2007) مشخص شد هیچ ارتباطی بین مارکر T422C با درصد پروتئین، درصد چربی، درصد استخوان، وزن زنده، افزایش وزن روزانه، وزن لاشه، سطح مقطع عضله راسته و ضخامت چربی پشت وجود ندارد (8).

TG در گاو یک ژن نسبتاً بزرگ شامل 48 اگزون و بیش از 200 کیلو­باز ژنوم می­باشد. 50 قطعه ژنومیکی هر کدام تقریباً  یک کیلوباز در گاو شناسایی شده است(20). کاسس و همکاران (2007) بر اساس آللهای با کمترین میزان فراوانی در مطالعات قبلی پنج SNP جدید انتخاب نموند (8). آنالیز این پنج SNP نشان داد که هیچ ارتباط معنی­داری با اسکور ماربلینگ ندارد. اما مارکر 551 (BV718460) ژن TG با درصد چربی و درصد استخوان و مارکر 668 (BV718458) آن با افزایش وزن روزانه و درصد قطعات لاشه و درصد چربی ارتباط معنی­دار دارد (21). در تحقیق حاضر مشخص شد ژنوتیپهای D- و AB بیشترین وزن زنده و ژنوتیپ EE کمترین وزن زنده و وزن لاشه و بهترین درصد لاشه را دارد که با یافته­های کاسس و همکاران (2007) همسو است (8). پیش از این دو مطالعه روی گاوهای Wagyu، QTL را برای وزن زنده و وزن لاشه و نرخ رشد روی کروموزوم 14 شناسایی کرده­اند اما ارتباط آن با پلی­مورفیسم TG، یا QTL ماربلینگ مورد بررسی قرار نگرفته است(14 و 15). با توجه به یافته­های این پژوهش و پژوهشهای پیشین به نظر می­رسد که ژن TG می تواند یکی از کاندیداهای مناسب برای بهبود لاشه باشد. به هرحال برای اینکه این ژن بتواند در برنامه­های اصلاحی نژادی مورد استفاده قرار گیرد تحقیقات بیشتری نیاز است که انجام گیرد.

نتایج این پژوهش نشان می دهد که چند شکلی در ناحیه 5’UTR ژن تیروگلوبولین با ضخامت چربی پشت در گوسفند مرتبط می باشد. ژنوتیپی که بیشترین چربی پشت را داشت (D-) تقریباً از بیشترین عمق عضله راسته نیز برخوردار بود. در عین حال این دامها از وزن دنبه کمتری برخوردار بودند. اما دارای وزن بیشتری از سایر بره­ها بودند. با توجه به کاهش وزن دنبه انتظار می رود که چربی در بخشهای دیگر بدن دام ذخیره گردد. اما با توجه به اینکه چربی که در پشت ذخیره می شود هیچگاه به اندازه چربی دنبه نمی رسد این ژنوتیپ از دام می تواند برای اصلاح دام و کاهش دنبه مورد استفاده قرار گیرد. البته در مورد ارتباط آللهای مختلف این ژن با خصوصیات لاشه در گوسفند کارهای پژوهشی چندانی انجام نشده است. بنابراین برای اظهار نظر مطمئن­تر در این مورد همان طور که قبلاً نیز اشاره گردید نیاز به کارهای پژوهشی بیشتر در مورد سایر نژادهای گوسفند و نیز با تعداد نمونه های بیشتر می­باشد تا شواهد کافی برای صحت به کارگیری نتایج به دست آمده در برنامه های اصلاحی گردآوری شود.    

1-      رحیم طایفه، آ.، حیدری، ف.، قراگزلو، ف.، میرشکرایی،پ.،  فرخی، ن.، نیری فسایی، ب. و خضری،  ج. 1393. بررسی نقش هورمون GnRH در مراحل مختلف تکوین آزمایشگاهی رویان گاو. مجله پژوهشهای سلولی و مولکولی 27(2): 224-232

2-      کمالی سروستانی، آ.، مغنی باشی منصوریه، م.م.، محمدی نژاد، پ.، کهن، ل. و کمالی، ا. 1393. ارتباط پلی مورفیسم  G>T 137 در پروموتر ژن Muc6 با افزایش خطر ابتلا به بیماری زخم پپتیک. مجله پژوهشهای سلولی و مولکولی 27(2): 277-284.

 

3- Ailhaud, G., Grimaldi, P. and Negrel, R. 1992. Cellular and molecular aspects of adipose tissue development. Annual review of Nutrition. 12: 207-233.

4- Anton, I., Kovacs, K., Fesus, L., Varhegyi, J., Lehel, L., Hajda, Z., Polgar, J. P., Szabo, F., and Zsolnai, A. 2008. Effect of DGAT1 and TG gene polymorphisms on intramuscular fat and on milk production traits in different cattle breeds in Hungary. Acta Vet. Hung. 56, 181-186

5- Barends, W. 1999. Assessing lipid metabolism. Patent Publication WO9923248. Patent US 6383751. Available at: http:// ep. espacenet. Com.

6- Butter field, R. and Berg, M. 1976. Body composition and location of fat deposition. Journal of Animal Science. 7:151-155.

7- Casas, E., White, S. N., Riley, D. G., Smith, T. P. L., Brenneman, R. A., Olson. T. A., Johnson, D.D., Coleman, S. W., Bennet, G. L. and Chase, C. C. 2005. Assesssment of single nucleotid polymorphisms in genes residing on chromosomes 14 and 29 for association with carcass composition traits in Bos indicuscattle. Journal of Animal Science. 83: 13-19.

8- Casas, E., White, S. N., Shachelford, S. D., Wheeler, T. L., Koohmaraie, M., Bennett, G. L. and Smith, T. P. L. 2007. Assessing the association of single nucleotide polymorphism at the thyroglobuline gene with carcass traits in beef cattle. Journal of AnimalScience.85: 2807-2814.

9- Chuang Han, Y., Zhu Teng, C., Li Hu, Zh. And Chun Song, Y. 2008. An optimal method of DNA silver staining in polyacrylamide gels. Electrophoresis. 29, 1355–1358

10- Dubey, P. K., Goyal, S., Mishra, S. K., Yadav, A. K., Kathiravan, P., Arora, R., Malik, R., and Kataria, R. S. 2015. Association analysis of polymorphism in thyroglobulin gene promoter with milk production traits in riverine buffalo (Bubalus bubalis). Meta Gene 5, 157-161.

11- Fortes, M. R. S., Curi, R. A., Chardulo, l. A., Silveira, A. C., Assumpcao, O. D., Visintin, J. A. and Oliveira, H. N. 2009. Bovine gene polymorphism related to fat deposition and meat tenderness. Genetics and Molecular Biology. 32(1): 75-82.

12- Gan, Q. F., Zhang, L. P., Li, J.Y., Hou, G. Y., Li, H. D., Gao, X., Ren, H.Y. and Chen, J. B. 2008. Association analysis of thyroglobulin gene variants with carcass and meat quality traits in beef cattle. Journal of Applied Genetics‏. 4: 251-255.

13- Hou, G. Y., Yuan, Z. R., Zhou, H. L., Zhang, L. P., Li, J. Y., Gao, X., Wang, D. J., Gao, H. J., and Xu, S. Z. 2011. Association of thyroglobulin gene variants with carcass and meat quality traits in beef cattle. Mol. Biol. Rep. 38, 4705-4708

14- Mizoguchi, Y., Watanabe, T., Fujinaka, K., Iwamoto, E. and Sugimoto, Y. 2006. Mapping of quantitative trait loci for carcass traits in a Japanese Black (Wagyu) cattle population. Journal of Animal Breeding and Genetics. 37: 51-54.

15- Mizoshita, K., Watanabe, T., Hayashi, H., Kubota, C., Yamakuchi, H., Todoroki, J. and Sugimoto, Y. 2004. Quantitative trait loci analysis for growth and carcass traits in a half-sib family of purebred Japanese Black (Wagyu) cattle. Journal of Animal Science. 82: 3415-3420.

16- Moore, S. S., Li, C., Basarab, J., Snelling, W. M., Kneeland, J., Murdoch, B., Hansen, C. and Benkel, B. 2003. Fine mapping of quantitative trait loci and assessment of positional candidate genes for backfat on bovine chromosome 14 in a commercial line of Bos Taurus. Journal of Animal Science. 81: 1919-1925.

17- Rincker, C. B., Pyatt, N. A., Berger, L. L. and Faulkner,D. B. 2006. Relationship among GenesSTAR marbling marker, intramuscular fat deposition, and expected progeny differences in early weaned Simmental steers. Journal of Animal Science. 84: 686-693.

18-Thaller, G., Kuhn, C., Winte, A., Ewald, G., Bellman, O., Wegner, J., Zuhlke, H. and Fries, R. 2003. DGAT1, a new positional and functional candidate gene for intramuscular fat deposition in cattle. Journal of Animal Breeding and Genetics - Journal Information‏. 34: 354-357.

19- Van Eenennaam, A. L., Li, J., Thallman, R. M., Quaas, R. L., Dikeman, M. E., Gill, C. A., Franke, D. E. and Thomas, M. G. 2007. Validation of commercial DNA tests for quantitative beef quality traits. Journal of Animal Science. 85: 891-900.

20- White, S. N., Casas, E., Wheeler, T. L., Shackelford, S. D., Koohmaraie, M., Riley, D. G., Chase, C. C., Johnson, D. D., Keele, J. W. and Smith, T. P. L. 2005. A new single nucleotide polymorphism in CAPN1 extends the current tenderness marker test to include cattle of Bos indicus, Bos taurus, and crossbred descent. Journal of Animal Science. 83: 2001-2008.

21- Wood, I. A., Moser, G., Burrell, D. L., Mengersen, K. L. and Hetzel, S. 2006. A meta-analytic assessment of a Thyroglobulin marker for marbling in beef cattle. Genetics Selection Evolution‏. 38: 479-494.

22- Zhang, L., Ren, H., Yang, J., Gan, Q., Zhao, F., Gao, H., and Li, J. 2015. Effect of thyroglobulin gene polymorphisms on growth, carcass composition and meat quality traits in Chinese beef cattle. Mol. Biol. Rep. 42, 1403-1407