نوع مقاله: مقاله پژوهشی

نویسندگان

1 کارشناس آزمایشگاه - دانشگاه آزاد اسلامی واحد علوم وتحقیقات- مجتمع آزمایشگاهی

2 عضو هیئت علمی پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری

3 کارشناس آزمایشگاه

چکیده

مطالعه حاضر جداسازی و شناسایی باکتری¬های ترموفیلیک (°C 60) و مزوفیلیک (°C 37) تجزیه کننده سلولز را از خاک نشان می¬دهد. باکتری¬های ترموفیل و مزوفیل با استفاده از روش رقت¬سازی متوالی پس از غنی¬سازی محیطهای رشد در حضور میکروکریستالین سلولز به عنوان تنها منبع کربن، جداسازی و خالص¬سازی شدند. غربالگری باکتری¬های خالص سازی شده برای شناسایی باکتری¬های تولید کننده آنزیم سلولاز با استفاده از تکنیک زایموگرام در پلیت انجام شد. از میان
سویه¬های سلولیتیک، 12 سویه ترموفیل و 12 سویه مزوفیل براساس میزان فعالیت آنزیم، درصد رشد و میزان پروتئین خارج سلولی با یکدیگر مقایسه و سویه¬های دارای بیشترین فعالیت آنزیم سلولاز از طریق توالی¬یابی ژن 16S rRNA شناسایی شدند. نتایج نشان داد این سویه¬ها به جنسهای Bacillus، Geobacillus و Chryseobacterium تعلق دارند. سویه¬ برتر ترموفیل و مزوفیل جهت شناسایی دما و pH بهینه مورد بررسی قرار گرفتند که سویه ترموفیل در دمای °C50 و pH 5/6 و سویه مزوفیل در دمای °C 37 و pH 5/8 بهترین عملکرد را نشان دادند. بر اساس نتایج بدست آمده، این باکتری ها از پتانسیل لازم جهت تبدیل ضایعات سلولیتیک شهری و کشاورزی به مواد دارای ارزش افزوده برخوردار می-باشند

کلیدواژه‌ها

عنوان مقاله [English]

Isolation and identification of native cellulose-degrading bacteria from soil

نویسندگان [English]

  • reza assareh 1
  • Hossein Shahbani Zahiri 2
  • Sima Eshghi 3

1 Laboratory Expert - Complex Laboratory, Science & research Branch, Islamic Azad University

2 National Institute of Genetic Engineering & Biotechnology Faculty

3 Laboratory Expert

چکیده [English]

The present study shows isolation and identification of thermophilic (60°C) and mesophilic (37°C) bacteria degrading the cellulose from the soil. after the growth environments enrichment with microcrystalline of cellulose as the sole source of carbon, Thermophilic and Mesophilic bacteria were isolated and purified by serial dilution method.
Screening of purified bacteria was done to identify cellulase-producing bacteria by zymogram on plate method. Among the cellulolytic strains, 12 thermophilic and 12 mesophilic strains were selected and these bacteria were compared with each other based on cellulase activity, growth and extracellular protein amounts. Identifying the strains with highest enzyme activity based on gene sequences 16S rDNA suggested that these strains belong to genera Bacillus، Geobacillus و Chryseobacterium. the preferred thermophilic and mesophilic genera were assessed to identify the best temperature and pH inwhich the thermophilic and mesophilic genera showed the best function in temperature 50°C and pH 6.5 and temperature 37°C and pH 8.5 respectively. These bacteria have necessitated potential for biological conversion of urban and agricultural cellulolytic wastes to valuable materials.

کلیدواژه‌ها [English]

  • cellulose
  • cellulase
  • cellulytic bacteria
  • Bacillus
  • Geobacillus

جداسازی و شناسایی باکتریهای بومی تجزیه­کننده سلولز از خاک

رضا عصاره 1*، حسین شهبانی ظهیری2 و سیما عشقی1

1 تهران، دانشگاه آزاد اسلامی واحد علوم وتحقیقات، مجتمع آزمایشگاهی زکریای رازی

2 تهران، پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری، گروه ژنتیک مولکولی 

تاریخ دریافت: 10/4/91               تاریخ پذیرش: 3/11/91

چکیده

مطالعه حاضر جداسازی و شناسایی باکتریهای ترموفیلیک (60 درجه سانتی گراد) و مزوفیلیک (37 درجه سانتی گراد) تجزیه کننده سلولز را از خاک نشان می­دهد. باکتریهای ترموفیل و مزوفیل با استفاده از روش رقت­سازی متوالی پس از غنی­سازی محیطهای رشد در حضور میکروکریستالین سلولز به عنوان تنها منبع کربن، جداسازی و خالص­سازی شدند. غربالگری باکتریهای خالص سازی شده برای شناسایی باکتریهای تولید کننده آنزیم سلولاز با استفاده از تکنیک زایموگرام در پلیت انجام شد. از میان سویه­های سلولیتیک، 12 سویه ترموفیل و 12 سویه مزوفیل براساس میزان فعالیت آنزیم، درصد رشد و میزان پروتئین خارج سلولی با یکدیگر مقایسه و سویه­های دارای بیشترین فعالیت آنزیم سلولاز از طریق توالی­یابی ژن 16S rRNA شناسایی شدند. نتایج نشان داد این سویه­ها به جنسهای Bacillus، Geobacillus و Chryseobacterium تعلق دارند. سویه­ برتر ترموفیل و مزوفیل جهت شناسایی دما و pH بهینه مورد بررسی قرار گرفتند که سویه ترموفیل در دمای 50 درجه سانتی گراد و pH 5/6 و سویه مزوفیل در دمای 37 درجه سانتی گراد و pH 5/8 بهترین عملکرد را نشان دادند. بر اساس نتایج به دست آمده، این باکتریها از پتانسیل لازم جهت تبدیل ضایعات سلولیتیک شهری و کشاورزی به مواد دارای ارزش افزوده برخوردار می­باشند.   

واژه­های کلیدی: سلولز، سلولاز، باکتریهای سلولیتیک، Bacillus، Geobacillus.

* نویسنده مسئول، تلفن: 44868443، پست الکترونیکی: reza.assareh@srbiau.ac.ir

مقدمه

 

استفاده از ضایعات لیگنوسلولزی برای تولید سوختهای زیستی به دلیل فراوانی، دسترسی آسان، قیمت پایین و تجدیدپذیری طی چند دهه گذشته افزایش یافته است. سلولز از اجزاء اصلی زیست­توده­های لیگنوسلولزی است که به دلیل برخورداری از ظرفیت مناسب برای تولید سوخت سبز و پاک در سرتاسر جهان مورد توجه می­باشد (4، 7 و 12). موانع متعددی برای تولید سوخت زیستی از ضایعات سلولزی وجود دارد از جمله این موانع می­توان به ساختار پایدار سلولز همراه با هزینه بالا و عملکرد پایین آنزیمهای سلولازی اشاره کرد. ساختار پایدار سلولز می­تواند به وسیله پیش تیمارهای فیزیکی و شیمیایی برداشته شود، درحالی که عملکرد آنزیم را می توان از طریق ایجاد محیطهای مناسب رشد برای میکروارگانیسم­های طبیعی یا دستکاری شده افزایش داد (10، 15 و 21).

مکانیزم هیدرولیز آنزیمی سلولز شامل همکاری سه آنزیم اندوگلوکاناز، اگزوگلوکاناز، و بتاگلوکوزیداز می­باشد. میکروارگانیسم­هایی مثل باکتریها، قارچها و اکتینومایستها برای تجزیه ترکیبات سلولزی این آنزیمها را به صورت مجزا و نیز به صورت ساختار پیچیده متصل به هم تولید می­کنند(22 و 24).

هزینه تولید سلولاز بیش از 40 درصد از کل هزینه تبدیل ضایعات سلولزی به بیواتانول را دربر میگیرد (3، 7). مطالعات جهت جداسازی و شناسایی میکروبهای سلولیتیک قوی ادامه دارد و میکروبهای سلولیتیک زیادی مانند: Bifidobacterium breve، Thielavia terrestris، Clostridium Sp.، Bacillus Sp.،  Cellulomonas Sp. و ... گزارش شده است. Bisaria and Ghose تعدادی از قارچها و باکتریهایی که توانایی تجزیه سلولز نامحلول در شرایط آزمایشگاهی را از طریق تولید سلولازهای خارج سلولی دارند ارائه داده­اند. گونه­های قارچی عبارتند از : T. reesei،  T. viride، T. coningi، Penicillium funiculosum، Pulverulentum، Fusarium solani و Sclerotium rolfsii. گونه­های باکتریایی عبارتند ازCellulomonas clostridium، Bacillus، Thermonorospora، Flavobactrium و Thermoactinomycetes (6).

امروزه تولید و پرورش میکروارگانیسم­هایی که با سرعت بیشتر و هزینه کمتر موجب تولید این آنزیمها می­شوند مد نظر بسیاری از محققین می­باشد. بی­شک در آینده بسیار نزدیک شاهد تولید قند، اتانول و دیگر محصولات تخمیری از زباله­های مواد غذایی، کاغذهای باطله، پسماندهای کشاورزی نظیر کاه و دیگر منابع سلولزی خواهیم بود (8).

هدف از این مطالعه: 1- غنی­سازی نمونه خاک انتخاب شده از پارک جنگلی چیتگر 2- جداسازی باکتریهای تولید کننده آنزیم سلولاز از نمونه خاک غنی­سازی شده 3- مقایسه باکتریهای تولید­کننده آنزیم سلولاز و شناسایی ایزوله­های برتر می باشد.

مواد و روشها

غنی­سازی و جداسازی باکتریهای تجزیه کننده سلولز: نمونه خاک از پارک جنگلی چیتگر در شهر تهران در ایران انتخاب شد. غنی سازی نمونه خاک با استفاده از محیط کشت با ترکیب (گرم در لیتر) : 1 میلی­لیتر محلول 3/0 درصد کلرید آهن Ш، 05/0 گرم کلرید کلسیم، 01/0 گرم سولفات منیزیم، 01/0 گرم کلرید پتاسیم، 01/0 گرم کلرید کلسیم، 3/0 گرم کلرید آمونیوم، 05/0 گرم عصاره مخمر و 1 میلی­لیتر از محلول Nitsch’s trace element با ترکیب (گرم در لیتر): 2/2 گرم سولفات منگنز، 5/0 گرم سولفات روی، 5/0 گرم اسید بوریک، 016/0 گرم سولفات مس، 025/0 گرم مولیبدات سدیم و  046/0 گرم کلرید کبالت انجام شد (17). این محیط با 5/0 گرم در لیتر از میکروکریستالین سلولز به عنوان تنها منبع کربن تکمیل گردید. pH محیط قبل از اتوکلاو با استفاده از NaOH 10 مولار بر روی 7 تنظیم شد.

یک گرم از نمونه خاک در ارلن مایر 100 میلی­لیتری حاوی 50 میلی­لیتر محیط کشت استریل تلقیح شد. 12 ارلن به این صورت آماده و برای جداسازی باکتریهای ترموفیل 6 ارلن در دمای 60 درجه سانتی گراد و برای جداسازی باکتریهای مزوفیل 6 ارلن در دمای 37 درجه سانتی گراد بر روی شیکر با دور rpm 120 برای 6 روز انکوبه شدند. از مخلوط هر ارلن 1 میلی­لیتر به ارلن حاوی محیط تازه منتقل و در همان شرایط انکوباسیون انجام شد. این فرایند 5 بار تکرار شده و کشتهای نهایی برای جداسازی و خالص سازی مخلوط باکتریهای به دست آمده از غنی­سازی صورت گرفته با استفاده از کلرید سدیم 85/0 درصد به روش رقت­سازی متوالی استفاده شدند. در این روش رقتهای متوالی تهیه و از هر رقت 100 میکرولیتر بر روی پلیت آگار شامل محیط غنی­سازی جامد شده به وسیله آگار بدون ماده مغذی (15 گرم در لیتر) اسپری کرده و پلیتها در دماهای 60 و 37 درجه سانتی گراد انکوبه شدند. پلیتها پس از 24 ساعت بررسی شده و کلنیهای تک رشد کرده برای 3 مرتبه به صورت خطی کشت داده شدند تا از خلوص آنها اطمینان کامل حاصل گردد (17). 

شناسایی باکتری­های سلولیتیک: محیط کشت زایموگرام با ترکیب (گرم در لیتر) : 2 گرم سدیم نیترات، 1 گرم دی­پتاسیم هیدروژن فسفات، 5/0 گرم سولفات منیزیم، 5/0 گرم کلرید پتاسیم، 2 گرم کربوکسی متیل سلولز، 2/0 گرم پپتون مخصوص میکروبیولوژی و 17 گرم آگار تهیه شد. سویه­های خالص شده به صورت نقطه­ای بر روی این محیط کشت داده شدند، بعد از 24 ساعت انکوباسیون در دماهای37 و 60 درجه سانتی­گراد پلیتها با استفاده از روشهای Gram’s Iodine و کنگورد رنگ آمیزی شدند تا ایزوله­های سلولیتیک از طریق ایجاد هاله شفاف از دیگر ایزوله­ها شناسایی شوند (9).

تعیین میزان فعالیت آنزیم و درصد رشد: جهت تعیین درصد رشد و میزان فعالیت آنزیم باکتریهای مزوفیل در محیط تولید آنزیم شامل محیط کشت LB حاوی 5/0 گرم در لیتر کربوکسی متیل سلولز، و باکتریهای ترموفیل در محیط غنی­سازی کشت داده شدند. پس از 24 ساعت میزان فعالیت آنزیم به روش دی­نیتروسالیسیلیک اسید (DNS) بر اساس مقدار قند­های احیاء کننده آزاد شده از کربوکسی متیل سلولز تعیین شد (13). مخلوط آزمایش 1 میلی­لیتر شامل 500 میکرولیتر از کربوکسی متیل سلولز (CMC) 1 درصد در بافر سیترات-فسفات pH 5/6 و 500 میکرولیتر سوپرناتانت کشت به عنوان آنزیم آماده شد، این مخلوط 1 ساعت در oC50 انکوبه و واکنش با اضافه کردن محلول DNS (3 میلی­لیتر) متوقف گردید. نمونه­ها 15 دقیقه در  100 درجه سانتی گراد انکوبه شده و برای تثبیت رنگ برای 5 دقیقه بر روی یخ قرار داده شدند. پس از آنکه نمونه­ها خنک شدند جذب نوری هرنمونه در طول موج 550 نانومتر در مقابل نمونه کنترل که کاملاً شبیه نمونه آزمایش بدون گرماگذاری در 50 درجه سانتی گراد تهیه شده بود اندازه­گیری شد. فعالیت سلولاز با استفاده از منحنی استاندارد گلوگز تعیین گردید. یک واحد از فعالیت آنزیم معادل مقداری از آنزیم می­باشد که یک میکرومول از گلوگز در دقیقه آزاد ­کند.

برای تعیین سرعت رشد 5 میلی­لیتر از محیط برداشته و به وسیله سانتریفیوز (30 دقیقه در g 12000) سلولها از سوپرناتانت جدا شدند. سلولها در یک میلی­لیتر ­هیدروکسید سدیم یک نرمال به صورت محلول در آمده و برای 10 دقیقه در  100 درجه سانتی گراد انکوبه شدند. سلولهای تخریب شده به وسیله سانتریفیوز (30 دقیقه در g12000) رسوب داده شدند و مقدار پروتئین آزاد شده در اثر تخریب سلولها به روش لوری با استفاده از استاندارد Bovin serum albumin    در سوپرناتانت اندازه­گیری شد. مقدار پروتئین سلولی می­تواند شاخصی برای تعیین رشد باشد (11 و 20).

غلظت پروتئین محلول با استفاده از روش بردفورد (Bradford MM., 1976) اندازه­گیری شد (5). برای تهیه منحنی استاندارد از محلول Bovin serum albomin استفاده شد. جذب نوری نمونه­های آماده شده بعد از 20 دقیقه انکوباسیون در دمای اتاق در طول موج 595 نانومتر اندازه­گیری شد.

شناسایی مولکولی ایزوله­های برتر: ایزوله­هایی که بیشترین تولید آنزیم سلولاز را در مقایسه با سایر ایزوله­ها نشان دادند انتخاب و بر اساس توالی­یابی بخشی از ژن 16S rRNA شناسایی شدند. استخراج DNA باکتری با تغییراتی در روش Sambrook  و  Russell (2011) انجام شد (19). کل DNA به دست آمده جهت تکثیر بخشی از ژن 16S rRNA به همراه دو پرایمر عمومی 27 F و 1495 R استفاده شد (14).

27 F (5 GAGAGTTTGATCCTGGCTCAG3́)

1495 R (5́ CTACGGCTACCTTGTTACGA 3́ )

مخلوط واکنش زنجیره­ای پلیمراز در حجم 25 میکرولیتر شامل MgCl2 mM 5/1، از هر dNTPs 4/0 میلی مولار، از هر پرایمر pmol 25، DNA 100 نانوگرم، Taq DNA پلیمراز U 5/0 و 5/2میکرولیتر از 10x PCR buffer تهیه شد. واکنش PCR با استفاده از دستگاه ترموسایکلر طبق مراحل زیر انجام شد : واسرشت سازی اولیه در دمای 94 درجه سانتی گراد برای 5 دقیقه، 35 سیکل شامل واسرشت سازی در دمای 94 درجه سانتی گراد برای 1 دقیقه، اتصال در دمای 55 درجه سانتی گراد برای 1دقیقه، توسعه در دمای 72 درجه سانتی گراد برای 2 دقیقه و یک مرحله توسعه نهایی برای 10 دقیقه (14).

محصولات به دست آمده از واکنش زنجیره­ای پلیمراز جهت توالی­یابی، از طریق شرکت سیناژن به شرکت Sourcebioscience فرستاده شده و به روش Sanger توالی­یابی شدند. توالیهای به دست آمده با استفاده از نرم افزار Blast در بانک ژن با دیگر توالیهای موجود در این پایگاه اطلاعاتی مقایسه شدند. درختچه­های فیلوژنی به روش neighbor-joining  با استفاده از نرم افزار CLUSTAL در برنامه MEGA 5 ترسیم شدند (18 و 23). بر اساس حداقل خطا از درخت توپولوژی Boot strap برای هر نمونه 1000 تکرار بود.

اثر pH و دما بر فعالیت آنزیم  CMCase : اثر pH محیط کشت بر فعالیت کربوکسی متیل سلولاز (CMCase) تولید شده توسط سویه­ برتر ترموفیل و مزوفیل از طریق ساخت محیط کشت با pHهای متغییر بررسی شد. pH محیط از 4 تا 5/9 با افزایش 5/0 واحدی با استفاده از NaOH و HCl 10 مولار تنظیم و سویه برتر ترموفیل و مزوفیل در این محیطها کشت داده شدند. کشتهای تهیه شده در دمای 50 درجه سانتی گراد برای سویه ترموفیل و دمای  37 درجه سانتی گراد برای سویه مزوفیل انکوبه شدند. پس از 24 ساعت، فعالیت کربوکسی متیل سلولاز (CMCase) حاصل از محیطهای دارای pHهای مختلف اندازه­گیری و pH بهینه تعیین شد.

اثر دما بر تولید آنزیم از طریق انکوباسیون محیط­های کشت با pH بهینه در دماهای مختلف  بررسی شد. انکوباسیون سویه ترموفیل در دماهای (30، 40، 50، 60  درجه سانتی­گراد) و انکوباسیون سویه مزوفیل در دماهای (30، 35، 37، 40، 45، 50، درجه سانتی گراد) صورت گرفت. پس از 24 ساعت فعالیت کربوکسی متیل سلولاز (CMCase) حاصل از انکوباسیون در دماهای مختلف اندازه­گیری و دمای بهینه تعیین شد.

 

شکل 1- پلیت زایموگرام جهت غربالگری و شناسایی باکتریهای تولید کننده آنزیم سلولاز از طریق ایجاد هاله شفاف بر روی محیط حاوی CMC بعد از 24 ساعت انکوباسیون و رنگ آمیزی به وسیله (A) کنگورد و (B) Gram’s iodine

نتایج

جداسازی و شناسایی باکتریهای تجزیه کننده سلولز: تعدادی ایزوله باکتریایی از نمونه خاک جداسازی و خالص سازی شدند. ایزوله­های انتخاب شده طی 24 ساعت بر روی پلیت رشد کرده و کلنیهای صاف، گرد و خامه­ای ایجاد کردند. بعضی ایزوله­ها قادر به تولید رنگدانه در محیط کشت بودند. در بررسیهای میکروسکوپی، باکتریها میله­ای گرم مثبت و منفی دیده شدند. از میان باکتریهای خالص سازی شده 12 ایزوله­ ترموفیل و 12 ایزوله­ مزوفیل به خوبی بر روی محیط حداقل رشد کرده و توانایی ایجاد هاله شفاف بر روی پلیت زایموگرام را نشان دادند (شکل 1). این ایزوله­ها برای ادامه مطالعه انتخاب شدند.

جداسازی ایزوله­های برتر  : 12 ایزوله­ ترموفیل و 12 ایزوله­ مزوفیل بر اساس نتایج غربالگری انتخاب شدند. این ایزوله­ها بر اساس میزان پروتئین محلول، درصد رشد، و میزان فعالیت CMCase با یکدیگر مقایسه شده و ایزوله­هایی که بیشترین فعالیت آنزیم سلولاز را نشان دادند شناسایی و انتخاب شدند (نمودارهای 1 و 2).

 

 

نمودار 1- مقایسه باکتریهای مزوفیل تولید کننده آنزیم سلولاز بر اساس میزان فعالیت CMCase سوپرناتانت کشتهای 24 ساعته، میزان رشد و غلظت پروتئین سوپرناتانت. غلظت پروتئین سلولی نشان دهنده درصد رشد است.

 

نمودار 2- مقایسه باکتریهای ترموفیل تولید کننده آنزیم سلولاز بر اساس میزان فعالیت CMCase سوپرناتانت کشتهای 24 ساعته، میزان رشد و غلظت پروتئین سوپرناتانت. غلظت پروتئین سلولی نشان دهنده درصد رشد است.

 

شکل 2- A: الکتروفورز DNA استخراج شده از ایزوله های جداسازی شده از نمونه های خاک( 1-6)؛ B: الکتروفورز محصولات PCR. حاصل از ژن کد کننده 16S rRNA مربوط به ایزوله های جداسازی شده از نمونه های خاک. شماره 1 تا8: ایزوله های مختلف، M : مارکر DNA 1kb

 

 

شکل 3- درخت فیلوژنی رابطه بین توالی 16S rDNA ایزوله­های ترموفیل  به دست آمده در این مطالعه و توالیهای به دست آمده از بانک جهانی ژن را نشان می­دهد.درخت با استفاده از نرم­افزار MEGA 5 به روش neighbor-joining ترسیم شده است.

 

 

شکل 4- درخت فیلوژنی رابطه بین توالی 16S rRNA ایزوله­های مزوفیل به دست آمده در این مطالعه و توالیهای به دست آمده از بانک جهانی ژن را نشان می­دهد.درخت با استفاده از نرم­افزار MEGA 5 به روش neighbor-joining ترسیم شده است.

 

نمودار 4-  اثر pH محیط کشت روی تولید سلولاز را در ایزوله برتر مزوفیل نشان می­دهد. pH محیط کشت با استفاده از   NaOH (1 N)و HCl (1 N) تنظیم و بعد از 24 ساعت انکوباسیون در دمای oC37 فعالیت CMCase در سوپرناتانت اندازه­گیری شد. فعالیت آنزیم به صورت درصدی از حداکثر فعالیت آنزیم نشان داده شده است.


شناسایی مولکولی ایزوله­های برتر: شناسایی باکتریهایی که فعالیت آنزیم بیشتری نشان دادند از طریق توالی­یابی بخشی از ژن 16S rRNA انجام شد. نتایج استخراج DNA و PCR در شکل 2 نشان داده شده است. محصولات PCR توالی­یابی شده و توالیهای به دست آمده در بانک جهانی ژن ثبت شدند.Accession number  اختصاص داده شده به توالیهای ثبت شده عبارتند از: JQ083168، JQ083169، JQ083170، JQ083171، JQ083172 و  JQ083173. بر اساس نتایج حاصل از توالی­یابی محصولات PCR و اطلاعات به دست آمده از بانک جهانی ژن درختچه­های فیلوژنتیکی با استفاده از نرم­افزار MEGA 5 به روش neighbor-joining برای سویه­های ترموفیل و مزوفیل ترسیم شد (شکل 3 و 4). بر اساس نتایج به دست آمده از ترسیم درختچه­های فیلوژنتیکی باکتریهای شناسایی شده به جنسهای Bacillus، Geobacillus و Chryseobacterium تعلق داشتند.

 

 

نمودار 5-  اثر دما در تولید سلولاز توسط ایزوله برتر مزوفیل. محیط کشت حاوی CMC به عنوان تنها منبع کربن و با pH 5/8 تهیه شد. بعد از 24 ساعت انکوباسیون کشتها در دماهای مختلف فعالیت CMCase  در سوپرناتانت اندازه­گیری شد. فعالیت آنزیم به صورت درصدی از حداکثر فعالیت آنزیم نشان داده شده است.

 

 

نمودار 6 - اثر pH محیط کشت روی تولید سلولاز را در ایزوله برتر ترموفیل نشان می­دهد. pH محیط کشت با استفاده از   NaOH (1 N)و HCl (1 N) تنظیم و بعد از 24 ساعت انکوباسیون در دمای oC50 فعالیت CMCase در سوپرناتانت اندازه­گیری شد. فعالیت آنزیم به صورت درصدی از حداکثر فعالیت آنزیم نشان داده شده است.

 

نمودار 7 - اثر دما در تولید سلولاز توسط ایزوله برتر ترموفیل. محیط کشت حاوی CMC به عنوان تنها منبع کربن و با pH 5/6 تهیه شد. بعد از 24 ساعت انکوباسیون کشتها در دماهای مختلف فعالیت CMCase  در سوپرناتانت اندازه­گیری شد. فعالیت آنزیم به صورت درصدی از حداکثر فعالیت آنزیم نشان داده شده است.


اثر pH و دما در تولید سلولاز: ایزوله­های ترموفیل و مزوفیل بطور قابل توجه­ای رشد و تولید سلولاز را در رنج گسترده­ای از pH نشان دادند. بیشترین تولید آنزیم برای  سویه مزوفیل در pH 5/8 (نمودار 4) و برای سویه ترموفیل در pH 5/6 (نمودار 6) به دست آمد. شیب تند قسمت اول این نمودارها به دلیل عدم توانایی رشد ایزوله­ها در pH کمتر از 5/4 می­باشد. این مقدار از فعالیت آنزیم 100 درصد در نظر گرفته شده و مقدار آنزیم به دست آمده در دیگر pH ها با آن مقایسه شد. دمای بهینه برای تولید آنزیم برای سویه مزوفیل 37 درجه سانتی گراد (نمودار 5) و برای سویه ترموفیل 50 درجه سانتی گراد (نمودار 7) به دست آمد. فعالیت آنزیم در این دما 100 درصد در نظر گرفته شده و مقدار فعالیت آنزیم در سایر دماها نسبت به آن سنجیده شد.

بحث

پژوهش در زمینه هیدرولیز سلولز  و  آنزیمهای  درگیر،  به سرعت در حال پیشرفت است. در سالهای اخیر منافع قابل توجهی از مواد گیاهی به عنوان یک منبع تجدیدپذیر که قابلیت تبدیل به محصولات مفید مانند سوختهای مایع را دارند به دست آمده است. از جمله فواید فرآیندهای تبدیل زیستی از بین رفتن ضایعات سلولیتیک شهری و کشاورزی است که امروزه یکی از معضلات محیط زیست می­باشند. مهدی پور مقدم و همکاران در سال 1388 سویه­هایی به منظور مقایسه فعالیت آنزیمهای تجزیه کننده دیواره سلولی از ریشه های برنج و گندم جداسازی کردند (1). زمانی و همکاران در سال 1387 تأثیر عوامل محیطی مختلف شامل منابع کربنی، القاکننده ها، pH و زمان کشت را جهت مطالعه میزان فعالیت آنزیم اندوگلوکاناز در سویه R4 قارچ  Aspergillus niger را بررسی کردند (2). در این مطالعه چندین ایزوله باکتریایی با قابلیت تولید آنزیمهای سلولیتیک خالص سازی گردید که پتانسیل کاربرد در تجزیه مواد گیاهی را دارا می­باشند جهت جداسازی باکتریهای تولیدکننده آنزیم سلولاز از روش غربالگری در پلیت استفاده شد. Kasana و همکاران در سال 2008 نشان دادند رنگ آمیزی با Gram’s iodine آسان­تر و سریع­تر بوده و جهت غربالگری مناسب­تر از روشهای رنگ آمیزی با محلولهای کنگورد و HAB می باشد (9). استفاده از روشهای کنگورد و Gram’s iodine جهت شناسایی سویه­های سلولیتیک و بررسی­ هاله­های ایجاد شده در پلیت نشان داد رنگ آمیزی با Gram’s iodine سریع­تر و مناسب­تر بوده و نتایجی مشابه با Kasana و همکاران به دست آمد. ایزوله­هایی که بیشترین فعالیت آنزیم سلولاز را نشان دادند از طریق آنالیز ژن 16S rRNA شناسایی شدند. توالیهای به دست آمده از این ایزوله­ها در بانک جهانی ژن ثبت شده و بر اساس اطلاعات به دست آمده از این پایگاه اطلاعاتی و ترسیم درخچه­های فیلوژنی مشخص شد این سویه­ها به جنسهای Bacillus، Geobacillus و Chryseobacterium تعلق دارند. Rastogi و همکاران در سال 2010 نشان دادند سلولز و علوفه ذرت مناسبترین سوبسترا جهت افزایش فعالیت CMCase در جنسهای  Bacillus sp. وGeobacillus sp. می­باشند (16). در بررسیهای این تحقیق گزارشات معدودی از تولید آنزیم سلولاز توسط جنسهای Bacillus و Geobacillus به دست آمد که بیشتر گزارشات به دست آمده مربوط به سویه­های ترموفیل و بی هوازی بود. اگرچه تعدادی از باسیلوسهای هوازی تولیدکننده آنزیم اندوگلوکاناز معرفی شده­اند. در این تحقیق سویه هایی از جنس Bacillus و Geobacillus شناسایی گردید که قادر بودند در شرایط هوازی در مدت 24 ساعت بالاترین سطح میزان آنزیم خود را تولید کنند. در میان ایزوله­های مزوفیل ایزوله برتر آنزیم با فعالیت U/ml40 و در میان ایزوله­های ترموفیل ایزوله برتر آنزیم با فعالیت U/ml100 را تولید کردند. این باکتریها قادر بودند در رنج گسترده­ای از دما و pH رشد کرده و آنزیم با فعالیت قابل توجه تولید کنند. در بحث انرژیهای زیستی بخش عمده هزینه مربوط به گرانی آنزیم­های سلولیتیک می­باشد، جداسازی میکروارگانیسم­های تولیدکننده این آنزیم از خاکهای بومی می­تواند گامی مهم در کاهش هزینه­ها و اقتصادی شدن استفاده از ضایعات سلولیتیک ­باشد. 

1- مهدی پور مقدم، م، امتیازی، گ، صالحی، ز، 1388 ، مقایسه فعالیت آنزیمهای فیتاز و سلولاز درآزوسپیریلوم های اندوفیت برنج و گندم، مجله زیست شناسی ایران، جلد 25، شماره 3، صفحات 340 تا 350. 

2- رجب خانی،ز، زمانی، م، مطلبی، م، عنصری دیزج یکان، ح، 1387، بهینه سازی تولید آنزیم بتا 1 و 4 اندوگلوکاناز (سلولاز) قارچ (R4)  Aspergillus nigerو همسانه سازی ژن eglB، مجله زیست شناسی ایران، جلد 22، شماره 4، صفحات 682 تا 690.

3. Ahamed, A., Vermette, P., 2008. Culture based strategies to enhance cellulose enzyme production from Trichoderma reesei RUT-30 in bioreactor culture conditions. Biochem. Eng. J. 140, 399–407. 

4.  Bansal, N., Tewari, R., Gupta, J.K., Soni, S.K., Soni, R., 2011. A novel strain of Aspergillus niger producing a cocktail of industrial depolymerising enzymes for the production of second generation biofuels. BioRes. 6, 552–569.

5. Bradford, M., 1976. A Rapid and Sensitive Method for the Quantitation of Microgram Quantities of Protein Utilizing the Principle of Protein-Dye Binding Anal. Biochem. 72:248-254.

6. Bisaria, V. and  Ghose, T., 1978. Bioconvertion of cellulosic substances into energy,    chemicals and microbial protein.T.K.Ed.New Dehli 155-165.

7.  Deswal, D., Khasa, Y.P., Kuhad, R.C., 2011. Optimization of cellulase production by a brown rot fungus Fomitopsis sp. RCK2010 under solid state fermentation.Bioresour. Technol. 102, 6065–6072.

8. Howard, R. L., Abotsi, E., Jansen, E. L., Howard, S., 2003. Lignocellulose Biotechnology: Issues of  bioconversion and enzyme production. Afr. J. Biotechnol., 2, 602-619.

9. Kasana, R., Salvan, R., Dhar, H., Dutt, S., Gulati, A., 2008. A Rapid and Easy Method for the Detection of Microbial Cellulases on agar Plates Using gram’s iodine. Curr, Microbiol. 57:503-507.

10. Krishna, C., 2005. Solid-state fermentation systems – An Overview. Crit. Rev. Rev. Biotechnol. 25, 1–30.

11. Lowry, O.H., 1951. Protein measurement with Folin phenol reagent. J. Biol. Chem.193, 265–275.

12. Milala, M. A., Shugaba, A., Gidado, A., Ene, A. C., Wafer, J.A., 2005. Studies on the use of agricultural wastes for cellulase enzyme productions by Aspergillus niger. Res. J. Agric. Biol. Sci. 1, 325–328.

13. Miller, G. L., Blum, R., Glennon, W. E., Burton, A. L., 1960. Easurement of Carboxymethylcellulase  activity. Anal. Biochem. 1, 127-132.

14. Sharma, M., Schmid, M., Rothballer, M., Hause, G., Zuccaro, A., Imani, J., Kämpfer, F., Domann, E., Schäfer, P., Hartmann, A., Kogel, K. H., 2008. Detection and identification of bacteria intimately associated with fungi of the order Sebacinales. Cellular Microbiology 10(11), 2235–2246.

15. Pandey, A., 1994. Solid-State Fermentation. Wiley Eastern Limited, New Delhi, pp. 12–17.

16. Rastogi, G., Bhalla, A., Adhikari, A., Bischoff, K. M., Hughes, S. R., Christopher, L. P., Sani, R. K., 2010. Characterization of thermostable cellulases produced by Bacillus and Geobacillus strains. Bioresour. Technol. 101, 8798-8806.

17. Rastogi, G., Muppidi, G. L., Gurram, R. N., Adhikari, A., Bischoff, K. M., Hughes, S. R., Apel, W. A., Bang, S. S., Dixon, D. J., Sani, R. K., 2009. Isolation and characterization of cellulose-degrading bacteria from the deep subsurface of the Homestake gold mine, Lead, South Dakota, USA. J. Ind. Microbiol. Biotechnol. 36, 585–598.

18. Saitou, N., and Nei, M., 1987. The Neighbor-joining Method: A New Method for Reconstructing Phylogenic Trees. Mol. Biol. Evol. 4- 406-425.

19.  Sambrook, J., Russell, D., 2001. Molecular Cloning: A Laboratory Manual, 3rd edition Cold Spring Harbor Laboratory Press, Cold Spring Harbour, NY.

20. Sami A. J., Akhtar  M. W., Malik N. N., Naz B. A., 1988. Production of free and substrate-bound cellulases of cellulomonas flavigena. Division of  Biochemistry   Institute of chemistry. University of the Panjab.

21- Schloss P. D., Handelsmen, J., 2005. Introducing DOTUR, a computer program for defining operational taxonomic units and estimating species richness. Appl.environ. microbial.71,1501-1506.

22. Sherief, A. A., El-Tanash, A. B., Atia, N., 2010. Cellulase production by Aspergillus fumigates on mixed substrate of rice straw and wheat bran. Res. J. Microbiol. 5, 199–211.

23. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) Software Version 4.0. Mol. Biol. Evol. 24, 1596-1599.199–211.

24. Viikari, L., M.Tenkanen, J. Buchert, M. Ratto, M. Bailey, M. Siika-Apo, and M. Linko. 1993. Hemicellulases for industrial applications. In: Saddler, J. N. Bioconversion of Forest and Agricultural Plant Residues. CAB International, Wallingford, UK, 131–182.