نوع مقاله: مقاله پژوهشی

چکیده

باکتری اشریشیا کلی انتروتوکسی‍‍ژنیک (ETEC) شایع ترین عامل اسهال باکتریایی کودکان زیر پنج سال و همچنین رایج ترین عامل اسهال مسافر در بالغین در دنیا است، که سالانه تعداد زیادی از کودکان را به کام مرگ کشانده و تعداد کثیر دیگری را تحت تأثیر قرار می دهد. از این رو هدف WHO تولید واکسن علیه این عامل می باشد. فیمبریه CFA/I یکی از عوامل ویرولانس مهم و شایع این باکتری است که نقش اساسی در فرآیند بیماریزایی این باکتری دارد. از این رو پروتئین انتهایی این فیمبریه (CFaE) می تواند به عنوان کاندید واکسن مطرح باشد. هدف از این مطالعه، بررسی امکان بیان پروتئین نوترکیب CFaE از توالی طبیعی ژن مربوطه بعد از همسانه سازی آن در ناقل بیانی، بوده است. بعد از طراحی پرایمر برای ژن cfaE ، با استفاده از واکنش PCR تکثیر شد. در مرحله بعد، ژن مذکور در ناقل pTZ57R/T همسانه سازی اولیه و سپس با استفاده از آنزیمهای محدودالاثر در ناقل بیانی pET28a(+) زیر همسانه سازی شد. بررسی بیان با استفاده از ماده IPTG با تغییر پارامترهای مختلف صورت گرفته در دو میزبان E.coli سویه های BL21(DE3)pLysS و Rosetta مورد ارزیابی قرار گرفت. فرآیند همسانه سازی و زیر همسانه سازی با موفقیت انجام گرفت. نمونه های تست در مقایسه با کنترل در مواجهه با IPTG پروتئین نوترکیب قابل تشخیصی را روی ژل SDS-PAGE نشان نداد. این نتیجه با تغییر پارامترهای مختلف (زمان القاء، دما و غلظتهای متفاوت IPTG) تکرار شد. به نظر می رسد توالی طبیعی ژن cfaE دارای میزان A+T بالا و همچنین کدونهای نادر زیادی است که باعث می شود قابلیت تولید بالای پروتئین در E.coli با این الگوی کدونی وجود نداشته باشد. از این رو پیشنهاد می گردد توالی این ژن بعد از بهینه سازی کدونها ، سنتز شده و سپس بررسی بیان آن مجدداً ارزیابی شود.

کلیدواژه‌ها

عنوان مقاله [English]

Amplification, Cloning and Expression Assay of the minor subunit Colonization Factor Antigen I (CFaE) from Enterotoxigenic Escherichia coli (ETEC)

چکیده [English]

Enterotoxigenic Escherichia coli (ETEC) is the most common cause of bacterial diarrhea in children under 5 years and it is also a cause of Travelers diarrhea worldwide. To prevent ETEC-caused diarrhea and decrease its prevalence, the WHO has promoted the vaccine production against this pathovar. CFA/I fimbriae is an important and frequent virulence factor of this bacteria, playing a critical role in pathogenesis. Therefore, tip protein of this fimbriae (CFaE) could describe as a vaccine candidate. This study was aimed at investigating the expression of the gene rCFaE from native sequence after cloning into expression vector. rCFaE was amplified by PCR using a newly designed set of primers. PCR product was then cloned into early cloning vector pTZ57R/T and then sub cloned into the expression vector pET28a(+). Protein expression in 2 strains of E.coli BL21 (DE3) pLysS and Rosetta was determined by using IPTG under different conditions. cloning and sub cloning process were performed successfully. Test samples in the comparatives with control samples did not show detectable protein on the SDS-PAGE. The same results were obtained after changing different parameters like time and temperature of induction and variety of IPTG concentration. It was not possible to obtain high level expression of the target recombinant protein production in E.coli with pattern codon usages, probably due to the high A+T content and also abundance rare codons in the native sequence of cfaE gene. Therefore we suggest synthesizing this gene after codon optimization and checking for expression that again.

کلیدواژه‌ها [English]

  • Enterotoxigenic Escherichia coli (ETEC)
  • minor subunit Colonization Factor Antigen I (CFaE)
  • cloning
  • recombinant protein expression

تکثیر، همسانه سازی و بررسی امکان بیان ژن زیرواحد فرعی آنتی ژن عامل کلونیزاسیون I (CFaE) از باکتری اشریشیاکولی انتروتوکسیژنیک (ETEC)

میثم منصوری1و2، سید جعفر موسوی1،*، شهرام نظریان1، زهرا احصایی1، فرشته جعفری3 و راضیه خالصی1

1 تهران، دانشگاه جامع امام حسین (ع)، دانشکده و پژوهشکده علوم پایه، گروه زیست شناسی

2 تهران، پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری

3 تهران، دانشگاه علوم پزشکی شهید بهشتی، مرکز تحقیقات گوارش و کبد، دایره بیماریهای ناشی از غذا و اسهال

تاریخ دریافت: 28/9/89               تاریخ پذیرش: 12/10/90

چکیده

باکتری اشریشیا کلی انتروتوکسی‍‍ژنیک (ETEC) شایع ترین عامل اسهال باکتریایی کودکان زیر پنج سال و همچنین رایج ترین عامل اسهال مسافر در بالغین در دنیا است، که سالانه تعداد زیادی از کودکان را به کام مرگ کشانده و تعداد کثیر دیگری را تحت تأثیر قرار می دهد. از این رو هدف WHO تولید واکسن علیه این عامل می باشد. فیمبریه CFA/I یکی از عوامل ویرولانس مهم و شایع این باکتری است که نقش اساسی در فرآیند بیماریزایی این باکتری دارد. از این رو پروتئین انتهایی این فیمبریه (CFaE) می تواند به عنوان کاندید واکسن مطرح باشد. هدف از این مطالعه، بررسی امکان بیان پروتئین نوترکیب CFaE از توالی طبیعی ژن مربوطه بعد از همسانه سازی آن در ناقل بیانی، بوده است. بعد از طراحی پرایمر برای ژن cfaE ، با استفاده از واکنش PCR تکثیر شد. در مرحله بعد، ژن مذکور در ناقل pTZ57R/T همسانه سازی اولیه و سپس با استفاده از آنزیمهای محدودالاثر در ناقل بیانی pET28a(+) زیر همسانه سازی شد. بررسی بیان با استفاده از ماده IPTG با تغییر پارامترهای مختلف صورت گرفته در دو میزبان E.coli سویه های BL21(DE3)pLysS و Rosetta مورد ارزیابی قرار گرفت. فرآیند همسانه سازی و زیر همسانه سازی با موفقیت انجام گرفت. نمونه های تست در مقایسه با کنترل در مواجهه با IPTG پروتئین نوترکیب قابل تشخیصی را روی ژل SDS-PAGE نشان نداد. این نتیجه با تغییر پارامترهای مختلف (زمان القاء، دما و غلظتهای متفاوت IPTG) تکرار شد. به نظر می رسد توالی طبیعی ژن cfaE دارای میزان A+T بالا و همچنین کدونهای نادر زیادی است که باعث می شود قابلیت تولید بالای پروتئین در E.coli با این الگوی کدونی وجود نداشته باشد. از این رو پیشنهاد می گردد توالی این ژن بعد از بهینه سازی کدونها ، سنتز شده و سپس بررسی بیان آن مجدداً ارزیابی شود.

واژه های کلیدی: اشریشیا کلی انتروتوکسی‍‍ژنیک، زیرواحد فرعی آنتی ژن عامل کلونیزاسیون I (CFaE)، همسانه سازی، بیان پروتئین نوترکیب.

* نویسنده مسئول، تلفن: 09123571469، پست الکترونیکی: jmosavi@ihu.ac.ir 

مقدمه

 

با وجود پیشرفتهای عمده بهداشتی در قرن حاضر، هنوز هم عفونتهای اسهالی از نگرانیهای بزرگ مجامع بهداشتی در سراسر جهان محسوب می شوند. به طوری که بیماریهای حاصل از ابتلاء به این عفونتها، سالانه سبب مرگ و میر تقریباً 3 میلیون نفر در سراسر جهان می شود (13). در این بین باکتری اشریشیا کلی انتروتوکسی‍‍ژنیک (ETEC) شایع ترین عامل اسهال باکتریایی در سراسر دنیا می باشد (14 و 15) .تخمین زده می شود که عفونتهای ETEC مسئول حداقل 650 میلیون مورد اسهال در جهان می باشد که سالانه جان نزدیک به 000/800 کودک زیر 5 سال را می گیرد (1). همچنین ETEC به عنوان شایع ترین عامل اسهال مسافران نیز مطرح است و سالانه تعداد زیادی از جهانگردانی را که به نواحی اندمیک بیماری (که اغلب کشورهای در حال توسعه و فقیر بوده)، مسافرت می کنند را تحت تأثیر قرار می دهد (11).

باکتری ETEC از طریق آب و غذای آلوده وارد بدن انسان شده و در سطح سلولهای اپی تلیال روده کوچک کلونیزه می شود. در گام بعدی، باکتری انتروتوکسین های مقاوم به حرارت (ST) و/یا حساس به حرارت (LT) را ترشح می نماید که این سموم با ورود به داخل سلول باعث خروج آب و الکترولیت ها از سلولهای اپی تلیالی روده شده که نهایتاً موجب ایجاد اسهال می گردد (4 و 6). از این رو اتصال باکتری به سطح سلولهای اپی تلیالی یک مرحله کلیدی در شروع عفونت محسوب می شود. این اتصال به وسیله فاکتورهای کلونیزاسیون (CF) که زائده های پروتئینی در سطح باکتری هستند، وساطت می شود. حداقل 25 نوع متفاوت از فیمبریه CF (که به لحاظ آنتی ژنی از هم متفاوتند) در سویه های ETEC شناسایی شده است (4). در این بین، فیمبریه CFA/I اولین فاکتور کلونیزاسیون ETEC خاص انسان است که گزارش شده (5) و همچنین این فیمبریه شایع ترین نوع فیمبریه در میان فیمبریه های شناخته شده برای ETEC در کل جهان است  (7). هزاران زیر واحد اصلی(CFaB) تولید یک ساقه را برای فیمبریه CFA/I نموده که یک یا تعداد اندکی زیر واحد فرعی به نام CFaE در نوک این فیمبریه جای می گیرد (9). در حقیقت ساختار CFA/I یک مارپیچ است که بدنه آن از CFaB ساخته شده و یک پروتیئن انتهایی به نام CFaE در نوک این ساختمان قرار گرفته است (8).

از آنجایی که هدف اصلی سازمانهای بهداشتی در دنیا (نظیر WHO) تولید واکسن مؤثر علیه این عامل است (12)، به نظر می رسد مطالعه بر روی CFaE به عنوان یک کاندید بالقوه بتواند نقش مهمی را در طراحی واکسن علیه کلونیزاسیون ETEC داشته باشد. در این مطالعه، سعی شده است با همسانه سازی ژن cfaE در ناقل بیانی، مطالعات مقدماتی جهت تهیه پروتئین نوترکیب به منظور مطالعات ایمنی زایی آتی، فراهم گردد.

مواد و روشها

مواد: سوش باکتری اشرشیا کلی انتروتوکسیژنیک مورد مطالعه در این تحقیق 10407H سروتیپ O78:H11 با شماره استاندارد ATCC 35401 بود. ناقل همسانه سازی اولیه pTZ57R/T از شرکت فرمنتاز و ناقل بیانی pET28a(+) از شرکت نواژن خریداری شد. کلیه آنزیمهای محدودالاثر، T4 DNA لیگاز و مخلوط آنزیم PCR با خاصیت غلط گیری بالا (High fidelity PCR enzyme mix) از شرکت فرمنتاز و مواد مورد نیاز برای واکنشهای زنجیره ای پلیمراز (PCR)، X-gal، IPTG از شرکت سیناژن تهیه شد. محیطهای کشت لازم برای اهداف مولکولی به کار رفته در این تحقیق از شرکت مرک (Merck) خریداری شد.

طراحی پرایمر:‌ به منظور همسانه سازی ژن cfaE ؛ بعد از استخراج توالی این ژن از بانک اطلاعاتی NCBI با شماره M55661 یک جفت پرایمر طراحی شد. بعد از آنالیز این ژن با نرم افزار Web cutter 2.0 مقرر شد پرایمر های پیشرو و پیرو به ترتیب حاوی جایگاه شناسایی برای آنزیمهای محدودالاثر EcoRI و XhoI باشند (جایگاه شناسایی این آنزیمها در توالی پرایمرها به صورت زیرخط دار نشان داده شده است). پرایمر های طراحی شده بعد از طراحی به لحاظ بررسی قرابت و اختصاصیت با نرم افزار BLAST مورد ارزیابی قرار گرفتند و به منظور سنتز به شرکت تکاپو زیست سفارش داده شد . این توالیها بدین قرار بود:

پرایمر پیشرو:

5'ATGAATTCATGGCAGATAAAAATCCCGGAAG 3'

پرایمر پیرو :

5'TTATCTCGAGTCACTAGAGTGTTTGACTACTTG 3'

واکنش زنجیره ای پلیمراز (PCR): ژن cfaE ابتدا با آنزیم Taq پلی­مراز (سیناژن) طی 30 سیکل تکثیر گردید. این واکنش در غلظت 3 میلی مولار   MgCl2 و 20 پیکومول از هر پرایمر،0/2 میلی مولار dNTPو 50 نانوگرم از ژنوم استخراج شده ETEC (با روش NaCl/CTAB) در دمای اتصال 57 درجه سانتی گراد بهینه سازی گردید. چرخه های PCR شامل یک مرحله واسرشتی ابتدایی در دمای 94 درجه سانتی گراد به مدت 5 دقیقه، 30 چرخه شامل مراحل واسرشتی در دمای 94 درجه سانتی گراد به مدت40  ثانیه، اتصال پرایمر به رشته الگو در دمای 57 درجه سانتی گراد به مدت 35 ثانیه و تکثیر قطعه مورد نظر در دمای 72 درجه سانتی گراد به مدت70 ثانیه و در پایان یک مرحله تکثیر نهایی دردمای 72 درجه سانتی گراد به مدت 10 دقیقه بود.

از آنجایی که آنزیم Taqپلی­مراز فاقد خاصیت غلط گیری است، از این رو به منظور همسانه سازی با صحت بالا ژن cfaE در مرحله نهایی از آنزیم مخلوطی از DNA پلیمراز با خاصیت غلط گیری بالا (فرمنتاز) استفاده شد. شرایط واکنش بهینه برای این آنزیم عبارت بود از : غلظت 4 میلی مولار MgSO4 و 20 پیکومول از هر پرایمر، 0/2 میلی مولارdNTP و 50 نانوگرم از ژنوم استخراج شده ETEC. سیکلهای PCR شامل یک مرحله واسرشته شدن ابتدایی در دمای 94 درجه سانتی گراد به مدت 5 دقیقه،30 چرخه شامل مرحله واسرشتی ابتدایی در دمای 94 درجه سانتی گراد به مدت 50 ثانیه، اتصال پرایمر به رشته الگو در دمای 58 درجه سانتی گراد به مدت 50 ثانیه و تکثیر قطعه مورد نظر در دمای 72 درجه سانتی گراد به مدت90 ثانیه و در پایان یک مرحله تکثیر نهایی در دمای 72 درجه سانتی گراد به مدت 30 دقیقه بود. محصولPCR  بر روی ژل آگارز 1درصد الکتروفورز گردید. در نهایت محصول PCR جهت تأیید به عنوان سوبسترا مورد هضم آنزیمی  HindIII قرار گرفت.

همسانه سازی ژن cfaE در ناقل  pTZ57R/T: از آنجایی که آنزیم مخلوطی از DNA پلیمراز با خاصیت غلط گیری بالا، مخلوطی از آنزیم  Taqپلی­مراز و یک آنزیم با خاصیت غلط گیری می باشد، از این رو با افزایش زمان تکثیر نهایی می توان اطمینان حاصل کرد که دنباله dA در دو انتهای /3 قرار داده خواهد شد. سپس محصول PCR با استفاده از کیت تخلیص DNA از ژل(Bioneer) خالص سازی گردید. واکنش الحاق با کمک آنزیم T4 لیگاز برای محصول PCR دارای دنباله  Aخالص شده و وکتور pTZ57R/T که در دو انتهای/3 دارای دنباله dT می باشد، به مدت 8 ساعت در دمای 17 درجه سانتی گراد انجام شد. بعد از انجام همسانه سازی، سازه نوترکیب حاصل با روش شوک حرارتی به سلولهای مستعد  E.coliسویه DH5α انتقال داده شد و باکتریها بر روی پلیت لوریا- برتانی آگار ( LBآگار) حاوی  Xgal-IPTGو آمپی سیلین (غلظتμg/ml  80) کشت داده شدند. بعد از گذشت مدت زمان12 ساعت کلنیهای سفید وآبی رنگ مشاهده شدند.

به منظور غربالگری سویه های حاوی ناقل نوترکیب، 5 کلونی سفید انتخاب و پس از کشت 12 ساعته در محیط LB مایع انتخابی (حاویμg/ml  80 آنتی بیوتیک آمپی سیلین) با استفاده از روش PCR مستقیم با پرایمرهای اختصاصی صورت گرفت. برای این کار 200 ماکرولیتر از محیط حاوی باکتریها برداشته و در دمای 95 درجه سانتی گراد به مدت 5 دقیقه حرارت داده شد و پس از یک اسپین کوتاه، دو میکرولیتر از مایع رویی به عنوان الگو در واکنش PCR استفاده شد. از کلونیهای مثبت، پلاسمیدهای نوترکیب با استفاده از روش لیز قلیایی تخلیص و واکنش هضم آنزیمی با آنزیمهای محدودالاثر EcoRI و XhoI و نیز آنزیمهای XhoI و HindIII ، انجام گرفت. در پایان به منظور ارزیابی نمونه ها همگی آنها در کنار نشانگر مولکولی روی ژل آگارز 1 درصد الکتروفورز شدند.

زیرهمسانه سازی ژنcfaE در ناقل بیانی pET28a(+) : برای زیر همسانه سازی، ابتدا واکنش هضم آنزیمی ناقل نوترکیب pTZ57R/T-cfaE و همچنین پلاسمید بیانی pET28a، با استفاده از آنزیمهای محدودالاثر  XhoEcoRI به مدت 7 ساعت در دمای 37 درجه انجام گرفت. محصول PCR و ناقل pET28a  برش خورده بر روی ژل آگارز با دمای ذوب پایین الکتروفورز و با کمک کیت تخلیص محصول PCR از ژل (بایونیر) تخلیص شدند. واکنش الحاق در دمای 17 درجه به مدت 8 ساعت انجام و با روش شوک حرارتی به میزبان E.coli سویه BL21(DE3)pLysS  انتقال داده شد. سویه میزبان نوترکیب به مدت یک شبانه کاری بر روی LB آگار حاوی آنتی بیوتیک کانامایسین (غلظتμg/ml  80) کشت داده شد. به منظور غربالگری سویه های حاوی ناقل نوترکیب، از کلونیهای موجود بروی محیط کشت انتخابی، 5 کلونی انتخاب شدند. برای این نمونه ها ،واکنش PCR-کلونی ، هضم آنزیمی پس از تخلیص ناقلهای نوترکیب (با استفاده از EcoRI و XhoI و نیز آنزیمهای XhoI و HindIII) ، بررسی حرکت الکتروفورتیک ناقلهای pET28a خطی شده واجد ژن همسانه سازی شده و ناقل pET28a فاقد قطعه هدف، بروی ژل آگارز صورت پذیرفت. در نهایت به منظور بررسی توالی ژن همسانه سازی شده و اطمینان از عدم بروز هرگونه خطا، جهش و یا نوآرایی ناخواسته ، ناقل تخلیص شده توسط شرکت فزا بیوتک با استفاده از پرایمرهای جهانی این ناقل (براساس پروموتور T7) تعیین توالی صورت گرفت.

بررسی بیان سازه ژنیpET28a-cfaE: سویه­های نوترکیب واجد پلاسمید  pET28a-cfaEابتدا در محیط­ کشت LB مایع حاوی کانامایسین(غلظتμg/ml  80) کشت گردید واجازه داده شد جذب نوری آنها درطول موج 600 نانومتر به5/0 برسد. سپس ماده IPTG (ایزوپروپیل β-D- تیوگالاکتوپیرانوزید) به عنوان القاء کننده با غلظت 1 میلی مولار به محیط کشت اضافه و اجازه داده شد سلولها مدت 5 ساعت دیگر در دمای 37 درجه سانتی گراد با دور rpm150 گرماگذاری شدند. به منظور مشاهده بیان 3 پارامتر اصلی شامل غلظتIPTG (غلظتهای مختلف: 1،75/0 ،5/0 ،25/0 میلی مولار)، زمان (زمانهای مختلف بعد از القاء: 2، 3، 5، 12، 18، 24 ساعت) و دمای بیان (25، 30 و37 درجه سانتی‌‌گراد) تغییر داده شد. بعد از هر بار بیان، سلولها به وسیله سانتریفیوژ در دور rpm6000 و مدت زمان 10 دقیقه جمع آوری شده و به 3 صورت؛ خام، محلول و بررسی رسوب حاوی اجسام تجمعی (انکلوژن بادی) مورد ارزیابی قرار گرفتند. در تمام ارزیابیها، نمونه ها قبل و بعد از القای IPTG همراه با مارکر پروتئینی (Fermentas: SM0671) بر روی ژل 12 درصد SDS-PAGE الکتروفورز شدند. به منظور تأیید وجود احتمالی پروتئین نوترکیب از واکنش ایمونوبلاتینگ با استفاده از آنتی بادی علیه هیستیدین (مرک) استفاده شد.

برای بررسی بیان در سویه E.coli RossettaTM ، ناقل نوترکیب pET28a-cfaB تخلیص و به این سویه انتقال داده شد. بررسی بیان در این سویه، تماماً مشابه سویه E.coli BL21DE3pLysS انجام پذیرفت.

نتایج

واکنش PCR: پس از تکثیر ژن cfaE با استفاده از پرایمرهای طراحی شده، محصول PCR بر روی ژل آگارز 1 درصد الکتروفورز گردید. همان طور که در شکل 1 مشاهده می شود، مطابق انتظار یک قطعه 1023 جفت بازی در روی ژل مشاهده می گردد.

تأیید محصول PCR: برای تأیید محصول PCR، با استفاده از آنزیم HindIII یک واکنش PCR-RFLP طراحی شد. این آنزیم توالی ژن cfaE را در موقعیت نوکلوتید 380 برش داده و درنتیجه دو قطعه به طول 643 و 380 جفت بازی تولید می نماید. شکل 2، الکتروفورز پس از هضم محصول PCR با آنزیم HindIII را نشان می دهد.

 

 

شکل1- نتایج محصول PCR ژن cfaE روی ژل آگارز1 درصد. ستون 1: ژن cfaE ، ستون 2: نردبان DNA، ستون 3: کنترل منفی.

 

 

 

شکل2- تأیید محصول PCR ژن cfaE با استفاده از هضم آنزیمی (HindIII). ستون1: محصول PCR، ستون2: نردبان DNA، ستون3: هضم آنزیمی محصول PCR با آنزیم HindIII.

 

شکل 3- آنالیز ناقل pTZ57R/T حامل قطعه هدف. ستون1: نردبان DNA، ستون2: ناقل هضم شده با آنزیمهای EcoRI و XhoI، ستون 3: ناقل هضم شده با آنزیمهای XhoI و HindIII.

 

شکل 4- آنالیز ناقل بیانی pET28a(+) حامل قطعه هدف. ستون1: ناقل pET28a(+) حاوی قطعه هدف که به وسیله آنزیم EcoRI خطی شده است، ستون2: ناقل pET28a(+) فاقد قطعه هدف که به وسیله آنزیم EcoRI خطی شده است، ستون 3: نردبان DNA، ستون4: ناقل هضم شده با آنزیمهای EcoRI و XhoI، ستون5: ناقل هضم شده با آنزیمهای XhoI و HindIII.

 

شکل5- الکتروفورز SDS-PAGE. ستونهای 1-4و6: نمونه های القاء شده با IPTG، ستون 5: نشانگر پروتئینی، ستون7: نمونه کنترل( نمونه القاء نشده).

همسانه سازی در ناقل pTZ57R/T: واکنش PCR مستقیم از کلونیها و هضم آنزیمی آن با استفاده از آنزیمهای مناسب نشان داد که ژن مورد نظر در ناقل دلخواه همسانه سازی شده است. نتایج حاصل از این کار روی ژل آگارز 1 درصد مورد ارزیابی قرار گرفت. شکل 3 مؤید این مطلب است.

زیر همسانه سازی در ناقل pET28a(+): نتایج واکنش PCR مستقیم از کلونیها و هضم آنزیمی و حرکت الکتروفورتیک ناقلها بعد از خطی شدن با آنزیم HindIII تأییدی ابتدایی بر صحت فرآیند زیر همسانه سازی بود. در نهایت تعیین توالی ژن همسانه سازی شده نیز نشان داد این توالی فاقد کدون خاتمه نابه جا، جهش و نوآرایی ناخواسته می باشد (شکل 4).

بررسی بیان: بررسی بیان نمونه ها پس از القاء در سویه های به کار گرفته شده در مقایسه با نمونه کنترل نشان داد که پروتئین نوترکیبی که به صورت واضح در محدوده 41 کیلو دالتون بیان شده باشد، تولید نشده است. این اثر حتی بعد از تغییر پارامترهای مختلف نظیر غلظتهای مختلفIPTG، دما و زمان نیز مشاهده شد(شکل 5). در واکنش وسترن بلاتینگ نیز حضور باندی در محدوده مورد نظر که مؤید تولید پروتئین نوترکیب باشد، دیده نشد.

بحث

ETEC شایع ترین عامل اسهال باکتریایی در تمام دنیاست و هر ساله تعداد زیادی از انسانها را تحت تأثیر قرار داده و کودکان زیادی را به کام مرگ می کشاند (13 و 14). به همین دلیل، طراحی واکسن علیه این عامل در دستور کار سازمانهای بهداشتی از جمله WHO قرار دارد (12). پروتئین CFaE در نوک فیمبریه CFA/I (که شایعترین فاکتور کلونیزاسیون در سویه های ETEC مختص انسان است) قرار دارد (8 و9). مطالعات اخیر  نشان می دهد CFaE نقش عمده ای در اتصال باکتری به سطح سلولهای اپی تلیالی روده بازی می کند: آنانتا و همکاران (2) با همسانه سازی دامنه های N- ترمینال و C- ترمینال ژن cfaE در وکتور pMAL-P2، بیان این پروتئینها را بررسی نموده و نشان دادند آنتی بادی تولید شده علیه این دامنه ها می تواند از اتصال باکتری به سلولهای CaCo2 (سلولهای سرطانی روده انسان) در شرایط in vitro جلوگیری نماید. دو تفاوت عمده ای که این تحقیق با کار این دانشمندان امریکایی داشت این بود که وکتور pMAL-P2 دارای دنباله MBP با ورن حدوداً 42 کیلو دالتون است که خود ایمونوژن بوده و می تواند جواب ایجاد شده در مطالعات انجام گرفته را به طور کاذب تحت تأثیر قرار دهد. ولی در این تحقیق از ناقل بیانی pET28a استفاده شد که تنها 4 کیلو دالتون به ابتدای ژن اضافه می نماید و عموماً ایمونوژن نیست. ساکلاریس و همکاران (10) نشان دادند که وجود توالی مشخص و حفاظت شده CFaE برای ایجاد قابلیت اتصال به رسپتور لازم و ضروری است و سویه های موتانت ETEC که در آنها ژن cfaE در ناحیه N-ترمینال دچار جهش شده است ، قابلیت اتصال به گیرنده های مناسب را ندارد. باری و همکاران (3)، نشان دادند که وجود اسید آمینه آرژنین در موقعیت 181 پروتئین CFaE یک آمینواسید ضروری برای اتصال باکتری به اپی تلیوم است و جایگزینی آن با اسید آمینه مشابه به لحاظ بار و ساختار نظیر لیزین، باعث عدم اتصال باکتری به رسپتور هدف می شود. این مطالعات نشان می دهد، CFaE می تواند به عنوان یک کاندید بالقوه در طراحی واکسن مطرح باشد.

با مطالعات انجام گرفته در این تحقیق به نظر می رسد به علت بالا بودن میزان A+T ژن ( حدوداً 63 درصد) و وجود کدونهای نادر زیاد (97 کدون نادر از مجموع 341 اسید آمینه کل پروتئین) امکان بیان در سویه های E.coli BL21(DE3)pLysS و حتی سویه E.coli Rosetta که تأمین کننده برخی از این اسید های آمینه نادر است، وجود نداشته است. از این رو پیشنهاد می گردد، توالی این ژن بعد از بهینه سازی کدونها و تغییر مطابق با الگوی کدونهای فراوان در E.coli، سنتز گردد و سپس بیان پروتئین نوترکیب در این سویه های میزبان مورد ارزیابی قرار گیرد.

نتیجه گیری

ژن cfaE پس از تکثیر به وسیله واکنش PCR در ناقل pTZ57R/T همسانه سازی و سپس در ناقل بیانی pET28a زیر همسانه سازی گردید. بررسی بیان این ژن در میزبان E.coli سویه های BL21(DE3)pLysS و Rosetta نشان داد که پروتئین نوترکیب در این سویه ها تولید نشده است.

تشکر و قدردانی

نویسندگان، کمال تشکر و سپاس از آقایان دکتر محمدرضا زالی و دکتر جعفر سلیمیان به خاطر همکاری و راهنماییهای ارزشمندشان در طول این مطالعه دارند.

 

 

1 APA. 1994, Foodborne outbreaks of enterotoxigenic Escherichia coli--Rhode Island and New Hampshire, 1993. MMWR Morb Mortal Wkly Rep, 43 (5), 81, 87-89.

2 Anantha, R. P.; McVeigh, A. L.; Lee, L. H.; Agnew, M. K.; Cassels, F. J.; Scott, D. A.; Whittam, T. S.; Savarino, S. J. 2004, Evolutionary and functional relationships of colonization factor antigen i and other class 5 adhesive fimbriae of enterotoxigenic Escherichia coli. Infect Immun, 72 (12), 7190-7201.

3 Baker, K. K.; Levine, M. M.; Morison, J.; Phillips, A.; Barry, E. M. 2009, CfaE tip mutations in enterotoxigenic Escherichia coli CFA/I fimbriae define critical human intestinal binding sites. Cell Microbiol, 11 (5), 742-754.

4 Fleckenstein, J. M.; Hardwidge, P. R.; Munson, G. P.; Rasko, D. A.; Sommerfelt, H.; Steinsland, H. 2010, Molecular mechanisms of enterotoxigenic Escherichia coli infection. Microbes Infect, 12 (2), 89-98.

5 Gaastra, W.; Svennerholm, A. M. 1996, Colonization factors of human enterotoxigenic Escherichia coli (ETEC). Trends Microbiol, 4 (11), 444-452.

6 Guth, B. E. 2000, Enterotoxigenic Escherichia coli--an overview. Mem Inst Oswaldo Cruz, 95 Suppl 1, 95-97.

7 Li, Y. F.; Poole, S.; Nishio, K.; Jang, K.; Rasulova, F.; McVeigh, A.; Savarino, S. J.; Xia, D.; Bullitt, E. 2009, Structure of CFA/I fimbriae from enterotoxigenic Escherichia coli. Proc Natl Acad Sci U S A, 106 (26), 10793-10798.

8 Li, Y. F.; Poole, S.; Rasulova, F.; McVeigh, A. L.; Savarino, S. J.; Xia, D. 2007, A receptor-binding site as revealed by the crystal structure of CfaE, the colonization factor antigen I fimbrial adhesin of enterotoxigenic Escherichia coli. J Biol Chem, 282 (33), 23970-23980.

9 Mu, X. Q.; Savarino, S. J.; Bullitt, E. 2008, The three-dimensional structure of CFA/I adhesion pili: traveler's diarrhea bacteria hang on by a spring. J Mol Biol, 376 (3), 614-620.

10 Sakellaris, H.; Munson, G. P.; Scott, J. R. 1999, A conserved residue in the tip proteins of CS1 and CFA/I pili of enterotoxigenic Escherichia coli that is essential for adherence. Proc Natl Acad Sci U S A, 96 (22), 12828-12832.

11 Stauffer, W. M.; Konop, R. J.; Kamat, D. 2002, Traveling with infants and young children. Part III: travelers' diarrhea. J Travel Med, 9 (3), 141-150.

12 Svennerholm, A. M.; Tobias, J. 2008, Vaccines against enterotoxigenic Escherichia coli. Expert Rev Vaccines, 7 (6), 795-804.

13 Walker, R. I. 2005, Considerations for development of whole cell bacterial vaccines to prevent diarrheal diseases in children in developing countries. Vaccine, 23 (26), 3369-3385.

14 Walker, R. I.; Steele, D.; Aguado, T. 2007, Analysis of strategies to successfully vaccinate infants in developing countries against enterotoxigenic E. coli (ETEC) disease. Vaccine, 25 (14), 2545-2566.

15 Wenneras, C.; Erling, V. 2004, Prevalence of enterotoxigenic Escherichia coli-associated diarrhoea and carrier state in the developing world. J Health Popul Nutr, 22 (4), 370-382.