نوع مقاله: مقاله پژوهشی

نویسندگان

1 دانشجوی کارشناسی ارشد دانشکده علوم کشاورزی و منابع طبیعی، گروه تولیدات گیاهی ،دانشگاه گنبد کاووس

2 استادیار دانشکده علوم کشاورزی و منابع طبیعی، گروه تولیدات گیاهی ،دانشگاه گنبد کاووس

3 دانشیار دانشکده علوم کشاورزی و منابع طبیعی، گروه تولیدات گیاهی ،دانشگاه گنبد کاووس

4 دانشیار گروه گیاهپزشکی ، دانشگاه علوم کشاورزی و منابع طبیعی ساری

چکیده

بیماری سفیدک سطحی از جمله بیماری‏های مهم گندم است در سال های اخیر کاربرد القا کننده ها به میزان زیادی استقبال شده لذا در این مطالعه به منظور بررسی نقش کیتوزان، رقم فلات به عنوان یک رقم حساس انتخاب و در مرحله دو برگی بوسیله کیتوزان اسپری برگی شد، سپس گیاهان تیمار شده به همراه گیاهان شاهد، توسط قارچ Bgt مایه‎زنی شدند.در نهایت الگوی تظاهر ژنهای ‌MLO، BI-1 و NPR1 با استفاده از تکنیک qRT-PCR مورد ارزیابی قرار گرفت. نتایج نشان داد که در هر دو گروه از گیاهان تیمار شده با کیتوزان و شاهد روند تظاهر ژن های مورد بررسی پس از اعمال آلودگی به صورت افزایشی بوده، به طوری که گیاهان تیمار شده القای زودهنگام و بالای ژن NPR1 را در ساعات اولیه بعد از آلودگی با Bgt نسبت به گیاهان شاهد نشان دادند و 24 ساعت پس از آلودگی به حداکثر بیان خود رسیدند. اما میزان افزایش در ژن های BI-1 و MLO در گیاهان تیمار شده کمتر از گیاهان شاهد بود، به طوریکه این گیاهان بر خلاف گیاهان شاهد در 24 ساعت پس از آلودگی کمترین میزان بیان را نشان دادند که این نشان دهنده این است که این ژنها با کاهش سطح بیان خود در جهت افزایش سطح گونه های اکسیژن فعال سبب القا مرگ سلولی در گیاه شده تا از این طریق سبب ممانعت از رشد و توسعه قارچ در مراحل اولیه آلودگی گردند. می توان کاربرد کیتوزان را در القای مقاومت سیستمیک در گندم علیه بیماری سفیدک سطحی موثر دانست.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Assay of NPR1, MLO and BI-1 genes expression in susceptible wheat to powdery mildew after treatment with chitosan

نویسندگان [English]

  • marjan khatami 1
  • leila Ahangar 2
  • Fakhtak Taliei Tabari 2
  • Hossein Sabouri 3
  • Valiollah Babaeizad 4

1 MSc. student Plant Production Dept., Faculty of Agriculture & Natural Resources, Gonbad Kavous University, Gonbad Kavous, I.R. of Iran

2 Assistant professor Plant Production Dept., Faculty of Agriculture & Natural Resources, Gonbad Kavous University, Gonbad Kavous, I.R. of Iran

3 Associated of professor Plant Production Dept., Faculty of Agriculture & Natural Resources, Gonbad Kavous University, Gonbad Kavous, I.R. of Iran

4 Associated Professor of Plant Protection Department., Sari Agricultural Sciences and Natural Resources University, Sari, I.R. of Iran

چکیده [English]

Powdery mildew is one of the most important diseases of wheat that make yield damage annually. In recent years, the use of induction elicitors has been widely welcomed. Therefore, in this research in order to examine the ability of chitosan , Flat were selected as susceptible cultivar, and the leaves were sprayed with chitosan. Then treated plant together control plants were inoculated with Bgt pathogen.Finally, The expression rate of MLO, B-I1 and NPR1 genes was examined in using Real Time PCR technique Results showed that in both chitosan treated plants and the controls, rate of gene expression were increased after infection for all genes, So that, in the first hours after inoculation, treated plants showed NPR1 expression more rapidly than control. Maximum expression level of this gene was observed at 24 hours after infection. But, in treated plants, the expression rate of BI-1 and MLO were less than the control and they showed minimum expression at 24 hours after infection. These results indicated these genes by decreasing their expression rate in order to increase the level of active oxygen species causes induction of cell death in the plant to inhibition of fungal growth and development in the early stages after infection. The gene expression rate in plants treated with 250 mg/L was more indicative than those treated with chitosan 500 mg/L. Overall; results showed that chitosan could induce systemic resistance in susceptible wheat against powdery mildew in low concentration.

کلیدواژه‌ها [English]

  • Wheat
  • Chitosan
  • Powdery mildew
  • Resistance

بررسی میزان بیان ژن‏های NPR1، MLO و BI-1 در گندم حساس به سفیدک سطحی تحت تیمار با القا کننده کیتوزان

مرجان خاتمی1، لیلا آهنگر1*، فاختک طلیعی طبری1 و حسین صبوری1 و ولی‌اله بابایی زاد2

1 گنبد کاووس، دانشگاه گنبد کاووس، دانشکده علوم کشاورزی و منابع طبیعی، گروه تولیدات گیاهی

2 ساری، دانشگاه علوم کشاورزی و منابع طبیعی، گروه گیاهپزشکی

تاریخ دریافت: 29/1/97                تاریخ پذیرش: 27/4/97

چکیده

بیماری سفیدک سطحی با عامل Blumeria graminis f. sp. tritici (Bgt) از جمله بیماری‏های مهم گندم به شمار می‏رود که در سراسر جهان از جمله ایران سالانه میزان زیادی خسارت به این محصول وارد می‎کند. در سال های اخیر کاربرد القا کننده های دفاعی به میزان زیادی استقبال شده لذا در این مطالعه به منظور بررسی نقش کیتوزان به عنوان یک محرک زیستی مکانیسم دفاعی، رقم فلات به عنوان یک رقم حساس به سفیدک سطحی انتخاب و در مرحله دو برگی بوسیله کیتوزان اسپری برگی شد، سپس گیاهان تیمار شده به همراه گیاهان شاهد، توسط قارچ Bgt مایه‎زنی شدند. تمامی مراحل آزمایش در سال زراعی 1395 در آزمایشگاه ژنتیک دانشگاه گنبد کاووس انجام گرفت. در نهایت الگوی تظاهر ژنهای ‌MLO، BI-1 و NPR1 با استفاده از تکنیک qRT-PCR در چهار بازه زمانی در سه تکرار مورد ارزیابی قرار گرفت. نتایج نشان داد که در هر دو گروه از گیاهان تیمار شده با کیتوزان و شاهد روند تظاهر ژن های مورد بررسیپس از اعمال آلودگی به صورت افزایشی بوده، به طوری که گیاهان تیمار شده القای زودهنگام و بالای ژن NPR1 را در ساعات اولیه بعد از آلودگی با Bgt نسبت به گیاهان شاهد نشان دادند و  24 ساعت پس از آلودگی به حداکثر بیان خود رسیدند. اما میزان افزایش در ژن های BI-1 وMLO در گیاهان تیمار شده کمتر از گیاهان شاهد بود، به طوریکه این گیاهان بر خلاف گیاهان شاهد در 24 ساعت پس از آلودگی کمترین میزان بیان را نشان دادند که این نشان دهنده این است که این ژنها با کاهش سطح بیان خود در جهت افزایش سطح گونه های اکسیژن فعال سبب القا مرگ سلولی در گیاه شده تا از این طریق سبب ممانعت از رشد و توسعه قارچ در مراحل اولیه آلودگی گردند. علاوه بر این در این مطالعه مشخص شد که گیاهان تیمار شده با غلظت 250 میلی‏گرم در لیتر کیتوزان، سطوح بیانی بهتری را نشان دادند، لذا می توان کاربرد کیتوزان را به خصوص در میزان کمتردر القای مقاومت سیستمیک در گندم علیه بیماری سفیدک سطحی موثر دانست.

واژه های کلیدی: گندم، کیتوزان، سفیدک سطحی، مقاومت

* نویسنده مسئول، تلفن:01733335117  ، پست الکترونیکی: L.ahangar63@gmail.com

مقدمه

 

بیماری سفیدک سطحی که به وسیله قارچ انگل اجباری به نام (Bgt). tritici  Blumeria graminis f. sp ایجاد می‎گردد یکی از بیماری‏های مهم گندم است که موجب کاهش چشمگیر عملکرد کیفی و کمی در مزارع گندم می‌شود (14). اﻣﺮوزه اﺳﺘﻔﺎده از روش­های شیمیایی ﺑﻪ دﻟﯿﻞ ﺿﻌﻒ در ﮐﺎراﯾﯽ، آﻟﻮدﮔﯽ ﻣﺤﯿﻂ زﯾﺴﺖ و اﯾﺠﺎد ﻣﻘﺎوﻣﺖ در ﺑﯿﻤﺎرﮔﺮ ﭼﻨﺪان ﻣﻮرد ﺗﻮﺟﻪ ﻗﺮار ﻧﻤﯽﮔﯿﺮد. بنابراین محققان به دنبال استفاده از مواد بیولوژیک به عنوان یکی از استراتژی­های مقاومتی در گیاهان هستند تا با کاربرد این ترکیبات بتوانند مکانیزم­های دفاعی گیاه را قبل از مواجهه با عامل بیمارگر فعال کنند(43). در سال­های اخیر کاربرد ترکیبات شیمیایی تحت عنوان فعال کننده به میزان زیادی مورد توجه قرار گرفته و در این بین کیتوزان به یک تمرکز اصلی پژوهش در کشاورزی تبدیل شده است. کیتوزان یک فعال کننده زیستی تجزیه‎پذیر و مشتق شده از پوست سخت پوستان است که امروزه به عنوان ماده افزایش دهنده قدرت دفاعی گیاهان علیه آلودگی­های قارچی به کار می‍رود (35). کیتوزان بوسیله پدیده مقاومت سیستمیک اکتسابی (SAR) که یکی از انواع مقاومت­های القایی است، منجر به تحریک فعالیت ژن­های پاسخ دهنده به بیمارگر و القای مقاومت نسبت به عوامل بیماری‎زا خواهد شد (43). شواهد حاکی از آن است که اسپری برگی کیتوزان با غلظت­های 0، 100، 200 و 500 میلی گرم در لیتر در گندم سبب کاهش رشد قارچ Fusarium graminearum شده است (3). پاسخ مقاومت القایی علیه Botrytis cinerea در برگ های خیار تیمار شده با غلظت 2/0 گرم در لیتر کیتوزان نیز گزارش شده است (8). ناندیش کومار و همکاران (32) نیز با تیمار بذرها آفتاب گردان با محلول 5% کیتوزان توانستند بیماری کپک زدگی را توسط قارچ Plasmopara hastedii ایجاد می­گردد را به میزان 46-52 درصد به ترتیب در شرایط گلخانه و مزرعه کنترل نمایند. گزارش­ها همچنین نشان داد که ارزن تیمار شده با نانوذرات کیتوزان بیان بالایی از ژن­های PAL، PR1، PR5، پراکسیداز و فنیل اکسیداز پس از تیمار با اومایسیت بیوتروف Sclerospora graminicola نشان دادند (37).

گیاهان دارای یک سیستم امنیتی بسیار قوی بوده و در مواجهه با هر نوع تنشی، گروهی از پروتئین‎ها تحت عنوان پروتئین‏های مرتبط با بیمارگر (PR) را تولید می نمایند. ﭘﺮوﺗﺌﯿﻦﻫﺎی PR گروه متنوعی از ﭘﺮوﺗﺌﯿﻦﻫﺎی ﮔﯿﺎﻫﯽ ﻫﺴﺘﻨﺪ که ﻣﻮﺟﺐ ﺗﺨﺮﯾﺐ دﯾﻮارهﻫﺎی ﺳﻠﻮل ﻗﺎرﭼﯽ، اﯾﺠﺎد اﺧﺘﻼل در ﻏﺸﺎﻫﺎی ﺳﻠﻮﻟﯽ آن، ﺗﻘﻮﯾﺖ ﺳﯿﺴﺘﻢ ﭘﺎﺳﺦ دﻓﺎﻋﯽ ﻣﯿﺰﺑﺎن، دﺧﺎﻟﺖ در ﺑﯿﻤﺎری‎زاﯾﯽ و ﺳﻨﺘﺰ ﭘﺮوﺗﺌﯿﻦﻫﺎی ﺿﺪ ﻗﺎرﭼﯽ ﻣﯽﺷﻮﻧﺪ (42). نسخه بیان نشده ژن­های مرتبط با بیماری‎زایی Non-expresser of PathogensisRelated genes 1(NPR1)، به عنوان واسطه کلیدی در مقاومت القایی شناخته شده است (39). مطالعات نشان داد که وجود NPR1 برای آشکار سازی SAR جهت القای مکانیسم دفاعی علیه طیف وسیعی از بیمارگرها مورد نیاز می­باشد (14 و 9). پروتئین NPR1 تحت شرایط نرمال به صورت الیگومریک غیرفعال در سیتوزول سلول وجود دارد، اما به محض آلودگی گیاه به بیمارگر وضعیت اکسایشی سلول تغییر یافته و پروتئین NPR1 بوسیله شکستن پیوندهای دی‎سولفید خود به فرم مونومری تبدیل شده (31) که می‎تواند بوسیله کنش با نوع خاصی از فاکتورهای تنظیم کننده رونویسی (TGA)، بیان ژن‎های دفاعی PR را القاء کند (31 و 22). NPR1 همچنین بوسیله تنظیم سیگنال­های پایین دست سالسیلیک اسید (SA) بر مسیر SAR تاثیر می­گذارد (14 و 13). به طوری که موتانت­هایnpr1آرابیدوپسیس، فاقد توانایی القای ژن­های PR و افزایش SAR حتی پس از تیمار با SA می­باشند. درحالیکه انتقال ژن NPR1 به این نوع گیاهان موتانت، نه تنها سبب رفع شدن تاثیر جهش می­شود بلکه پاسخ به عوامل تحریک کننده SAR را با بیان بالای ژن PR، به حالت اول بر ­گردانده و سبب مقاومت به آلودگی Pseudomonas syringae می­شود (11).    

مرگ سلولی برنامه­ریزی شده (PCD = Programmed Cell Death) یکی از مکانیسم­های دفاعی گیاهان و حیوانات علیه عوامل بیماری­زا است. پدیده PCD در حیوانات است بوسیله اعضای خانواده پروتئین BAX (BCL2-Associated X protein) تنظیم می­گردد (20). اگرچه تاکنون هیچ همولوگی از پروتئین BAX در ژنوم گیاهی شناسایی نگردید، اما محققین ژن دیگری که به عنوان مهارکننده BAX (BI-1)(BAX- inhibitor) است را در گیاهان شناسایی نمودند (16 و 6) که بیان بالای آن در گیاهان منجر به حساسیت به بیمارگر بیوتروف و افزایش مقاومت به بیمارگر نکروتروف می­شود (21 و 6). علاوه بر این، یکی دیگر از ژن‏هایی که نقش مهمی در حمایت از مرگ سلولی در پاسخ به تنش‎های زیستی و غیر زیستی ایفا می‏نماید، ژن  MLO(Mildew Resistance Locus O) است (34 و 26). پروتئین MLO یک پروتئین غیرعادی تراغشایی است که آلل وحشی آن، تنظیم کننده منفی مرگ سلولی در گیاه بوده (26) به طوریکه بیان بالای ژن MLO در گیاه جو سبب حساسیت بسیار بالای این گیاهان به سفیدک سطحی (Bgh) و افزایش میزان نفوذ قارچ در دیواره سلولی و تشکیل هاستوریوم گردید (24). شواهد همچنین نشان داده است که میزان بیان ژن MLO در طی پیری برگ به طور موثری کاهش می‎یابد (34). همچنین رینستادلر و همکاران (36) با استفاده از آلل موتانت mlo در جو نشان دادند که پروتئین MLO برای القای حساسیت به سفیدک بسیار مهم می‎باشد. به طوری که مطالعات نشان داده است که بیان ژن­های BI-1 و MLO در موتانت mlo5 جو از طریق تخریب مکان تجمع پراکسید هیدروژن (H2O2) و سرکوب نمودن پاسخ­های دفاعی سبب تسهیل در نفوذ قارچ Bgh و حساسیت در گیاه گردید (15).

کیتوزان یک الیسیتور زیستی است که در تحقیق حاضر به منظور کاهش اثرات مخرب قارچ­کش­ها بر سلامت موجودات زنده و محیط زیست،  از تاثیر القا کنندگی آن در گندم نسبت به بیماری سفیدک سطحی استفاده گردید. از سویی با توجه به اینکه تاکنون مطالعات خاصی در مورد تاثیر کیتوزان بر میزان بیان ژن‏های MLO، BI-1 و NPR1 در بیماری سفیدک سطحی گندم صورت نگرفته است. لذا در این مطالعه به بررسی تاثیر این القاکننده بر تغییرات نسبی این گروه از ژن ها در گندم آلوده به Bgt، پرداخته شد.

مواد و روشها

در این تحقیق رقم فلات به عنوان رقم حساس به بیماری سفیدک سطحی انتخاب شد (3). بذرهای این رقم از ایستگاه تحقیقات کشاورزی گنبد تهیه گردید. جدایه قارچ Blumeria graminis F. sp. tritici (Bgt)  نیز از بخش تحقیقات پاتولوژی غلات موسسه اصلاح و تهیه نهال و بذر تهیه و به دلیل بیوتروف بودن، عامل بیماری در اتاقک رشد روی رقم حساس بولانی در دمای 22 درجه سلسیوس و رطوبت نسبی 70% در طول مدت این بررسی تکثیر و نگهداری شد (30).

ارزیابی کاربرد کیتوزان در القای مقاومت به بیماری سفیدک سطحی: به منظور بررسی کاربرد کیتوزان در القای مقاومت در گندم در برابر بیماری سفیدک پودری، برگ گیاهان حساس، 24 ساعت پس از تیمار با غلظت های مختلف کیتوزان به همراه گیاهان کنترل در محیط آب آگار حاوی 20 میلی‏گرم در لیتر بنزیمیدازول در تشتک‎های پتری قرار داده شدند. یک هفته پس از مایه‎زنی، تعداد کلنی رشد یافته در 5/2 سانتیمتر مربع هر برگ شمارش گردید. آزمایش با پنج تکرار برای هر تیمار انجام شد (7 و 2). سپس نتایج حاصله با آزمون حداقل تفاوت معنی دار (LSD) تجزیه و تحلیل گردید.

تیمار نمودن گیاهان و آلوده سازی با قارچ سفیدک پودری جهت بررسی الگوی بیان ژن: برای بررسی تأثیر القاکننده کیتوزان در مقابل عامل بیماری، بذرها گندم رقم فلات به مدت یک دقیقه با محلول یک درصد هیپوکلریت سدیم ضدعفونی شده و پس از سه مرتبه شستشو با آب مقطر روی کاغذ فیلتر مرطوب در تشتک پتری قرارداده شدند. پس از جوانه‎زنی، بذرها به گلدان حاوی خاک مزرعه و ماسه (1:1) ضدعفونی شده منتقل شده و در اتاقک رشد با تناوب 16 ساعت روشنایی با دمای 22 درجه سلسیوس و هشت ساعت تاریکی با دمای 20 درجه سلسیوس با رطوبت نسبی70 درصد نگهداری شدند. پس از گذشت دو هفته، گیاهچه‎ها به‎وسیله محلول کیتوزان (Sigma Alderich/ MMW) با غلظت 250 و 500 میلی‎گرم در لیتر اسپری برگی شدند(3). برای حل نمودن کیتوزان ابتدا آن را با اسید استیک یک درصد حل نموده و سپس به حجم مورد نظر رسانیده شد. گیاهان شاهد نیز با محلول آب و اسید استیک، تیمار شده و در اتاقک کشت نگهداری شدند. پس از گذشت 24 ساعت از تیمار گیاهان با کیتوزان، برگ‏های گیاهان تیمار شده به ‏همراه گیاهان شاهد، به وسیله اسپورهای قارچ عامل بیماری در غلظت 50 کنیدیوم در میلی‎متر مربع مایه‏زنی شدند. نمونه‎برداری از گیاهان شاهد و آلوده در زمان‎‏های 0، 12، 24 و 48 ساعت پس از آلودگی، انجام شد و نمونه‎های برگی در فریزر C°80- جهت استخراج  RNA کل نگهداری شدند.

استخراج RNA از نمونه­ها، ساخت cDNA و اندازه‌گیری الگوی بیان ژن‌های مورد مطالعه: برای استخراج RNA از نمونه­های برگی، از کیت RNX-plus شرکت سیناژن (Cat, No: RN7713C) استفاده گردید. سپس کیفیت RNA استخراج شده در ژل آگارز 5/1 درصد ارزیابی شد. آنگاه نمونه‌های RNA­، جهت زدودن DNA بوسیله آنزیم DNase 1 سیناکلون (cat. No: MO5401) تیمار شده و cDNA مربوط به هر نمونه با استفاده از کیت RevertAid™ First Strand cDNA Synthesis  سیناکلون (cat. No: RT5201) ساخته شد. تمامی این مراحل طبق دستورالعمل هر کیت انجام گرفت. بررسی بیان ژن (qRT-PCR) با استفاده از دستگاه C1000™ Thermal Cycler (AB) و کیت Sina SYBR Blue HS- qPCR Mix (2X)(Cat. No: MM2171) انجام شد. واکنش زنجیره­ای پلیمراز شامل مرحله واسرشت سازی اولیه 7 دقیقه در 95 درجه سلسیوس سپس 40 چرخه (شامل 15 ثانیه در 95 درجه سلسیوس، 30 ثانیه در 60 درجه سلسیوس و 60 ثانیه در 72 درجه سلسیوس) بود. پس از اتمام واکنش PCR، برای رسم منحنی ذوب واکنش در دمای 95-60 درجه سلسیوس با اختلاف 5/0 درجه در هر چرخه انجام گرفت. به منظور استاندارد نمودن داده­ها، نمونه­ها بوسیله ژن خانه‌دار Actin  نرمال گردیدند. لیست آغازگرهای مورد استفاده در جدول 1 آمده است. این آغازگرها پس از هم ردیف نمودن توالی‎های بدست آمده از بانک ژنی NCBI (http://www.ncbi.nlm.nih.gov/) بوسیله نرم‎افزارهای BioEdit 7.0.9.0 و OligoExplorer V1.4 طراحی شدند. 

نرخ بیان ژن نیز به روش ∆∆CT = (CT target gene – CT actin)sample – (CTtarget gene – CT actin)calibrator

 اندازه‎گیری شد(28). این آزمایش در سه تکرار جداگانه انجام گردید و پس از محاسبه بیان ژن‎های مورد مطالعه برای هر نمونه، انحراف معیار آن‎ها محاسبه و نتایج با استفاده از آزمون حداقل تفاوت معنی­دار (LSD) ارزیابی شدند.

 

جدول 1- لیست آغازگرهای مورد استفاده در این تحقیق

منبع آغازگر

اندازه محصول

آغازگر برگشت

آغازگر رفت

نام آغازگر

DN551593

150 bp

AGTGTCTGGATCGGTGGTTC

AGCCCAATCATAGGAAAAGTGC

TaActin

KM017011

149 bp

GTA GTC CAC CTT GGT GAC C

TAC CAG TTC GCA AAT GAT CCT G

TaMLO

FJ705442,  GU564292

149 bp

AGA CTG GCA CCG AGA ACA TC

CCA CCT CAA GCT CGT TTA CC

TaBI-1

KMo17012

157 bp

GAA CAG TAT AAC CTC TTG GGT TTC

GCT TGT CAG GAT GCT GCT C

TaNPR1

             

 


نتایج

ارزیابی   فنوتیپی   اجزای   مقاومت   در  نتیجه  کاربرد

کیتوزان: بر اساس نتایج به دست آمده تعداد کلنی رشد یافته در برگ گیاهان تیمار شده با سطوح 250 و 500 میلی‎گرم در لیتر به ترتیب 43 و 4/29 درصد نسبت به گیاهان شاهد، کاهش معنی‎داری را نشان دادند (شکل1). این نتایج بیانگر آن است که مقاومت القاء شده توسط کیتوزان نقش مهمی در مقاومت گندم علیه سفیدک پودری و کاهش پیشرفت بیماری ایفا می­کند (شکل2). نتایج حاصله با نتایج فائورو و همکاران (17) و کورس وهمکاران (25) مبنی بر کاهش بیماری سفیدک سطحی جو مطابقت داشت. آمبوراب و همکارن (5) نیز بیان کردند که کیتوزان بدلیل ماهیت پلی کاتیونی خود باعث تخریب ساختمان سلولی و تراوش الکترولیت­ها و پروتئین­ها شده و بدین ترتیب می­تواند از رشد بیمارگر ممانعت نماید. از سویی نتایج حاکی از تاثیر معنی دار کیتوزان 250 نسبت به کیتوزان 500 میلی گرم در لیتر در کاهش شدت بیماری بود.

 

شکل 1- ارزیابی توانایی کیتوزان در القای مقاومت در گندم به قارچ Bgtبر اساس تعداد کلنی­های رشد یافته در cm25/2 در برگ گیاهان تیمار شده با کیتوزان 250 و 500 میلی گرم در لیتر و تیمار نشده (شاهد). مقایسه میانگین به روش LSD در سطح 1% انجام گرفت.


شکل 2-  تعداد کلنی­های رشد یافته در برگ گیاهان تیمار شده با کیتوزان 250 (B) ، کیتوزان 500 (C) میلی گرم در لیتر و گیاهان شاهد (A).

 

اندازه‌گیری الگوی بیان ژن‌های مورد مطالعه در گندم تحت تیمار با کیتوزان:

ژن NPR1:آنالیز qPCR نشان داد که میزان بیان ژن NPR1در گیاهان تیمار شده با کیتوزان قبل اعمال بیماری روند افزایشی داشته، به طوری‎که گیاهان تیمار شده در 24 ساعت پس از تیمار با کیتوزان 250 و 500 میلی گرم در لیتر به ترتیب با میزان بیان 2/4و 1/3 افزایش معنی‎داری را در سطح 5 درصد نسبت به گیاهان کنترل نشان دادند (شکل 3). همچنین آنالیز بیان ژن پس از اعمال آلودگی نیز حاکی از روند افزایشی میزان رونوشت ژن NPR1در گیاهان پیش تیمار شده و کنترل بود ولی روند افزایشی بیان ژن در گیاهان پیش تیمار شده به طور معنی‎داری بیشتر از گیاهان شاهد بوده است. گیاهان تیمار شده با کیتوزان 250 و 500 میلی‎گرم، 12 ساعت پس از آلودگی به ترتیب با افزایش میزان بیان 3/2 و 68/1 برابری نسبت به گیاه کنترل، تفاوت معنی­داری نشان دادند. سپس این گیاهان در 24 ساعت پس از آلودگی به ترتیب با میزان بیان 7/9 و 5/6 برابری نسبت به زمان صفر به بیشترین میزان بیان ژن NPR1 رسیدند. از سویی گیاهان کنترل نیز روند افزایشی ولی آرامی از بیان را نشان دادند و سپس در 24 ساعت پس از آلودگی با 4 برابر افزایش بیان نسبت به زمان صفر به حداکثر بیان خود رسیدند. اگرچه هر دو گروه از گیاهان در یک بازه به بیشینه بیان رسیدند ولی مقایسه میزان بیان در زمان اوج بیان نشان داد که در گیاهان تیمار شده با کیتوزان 250 و 500 میلی گرم میزان بیان به ترتیب 4/2 و 63/1برابر بیشتر از گیاهان کنترل می­باشد که این افزایش بیان معنی­دار بود. سپس در ساعات بعدی (48 ساعت) پس از آلودگی میزان بیان روند کاهشی را نشان داد، در حالی‎که میزان کاهش در گیاهان کنترل به طور معنی­داری کمتر از گیاهان پیش تیمار شده بود. از سویی نتایج نشان داد که سطح بیان ژن NPR1 در گیاهان تیمار شده با کیتوزان 250 به طور معنی‏داری بیشتر از تیمار 500 میلی گرم کیتوزان بود.

 

 

شکل 3 -سطح بیان ژن­های NPR1 ، MLO  و BI-1 در گیاهان تیمار شده با کیتوزان و گیاهان کنترل پس از آلودگی با Bgt . مقایسه میانگین بین تیمارها در هر بازه زمانی با استفاده از آزمون حداقل تفاوت معنی دار در سطح 5 درصد انجام گرفت. میل بارها نشان دهنده مقادیر خطای استاندارد میانگین می­باشد.


NPR1 یکی از تنظیم کننده­های کلیدی مقاومت القایی در گیاه می­باشد که بوسیله تاثیر در نواحی پایین دست مسیر سیگنال­دهی SA، سبب فعال سازی بیان ژن‎های PR، القای مرگ سلولی و در نهایت مقاومت به طیف وسیعی از بیمارگرها می­شود (39 و 10). نتایج حاصل از این مطالعه نشان داد که میزان بیان ژن NPR1در گیاهان پیش تیمار شده و کنترل به طور قابل توجهی افزایش یافت. به طوری‎که این گیاهان در 12 و 24 ساعت پس از آلودگی، همزمان با نفوذ میخ رخنه و رشد هاستوریوم (16) به بیشترین میزان بیان خود رسیدند. همچنین گزارش شد که کیتوزان سبب القای مکانیسم SAR در گیاه شده که این مکانیسم به فعال شدن NPR1 با موقعیت درون هسته­ای نیاز دارد (14 و 13)، لذا با توجه به نتایج حاصله چنین استنباط می‎گردد که اسپری کردن کیتوزان بر روی برگ رقم فلات نقش موثری در القای مقاومت از طریق افزایش آمادگی در گیاه حساس دارد. به این دلیل گیاهان پیش تیمار شده به محض آلودگی، بیان بالا و سریعی از ژن NPR1 را نشان داده تا با القای SAR از نفوذ و گسترش بیماری در گیاه جلوگیری ­نمایند که با نتایج فیتزا و همکاران (18) و  لاندی و همکاران (27) مطابقت داشت. همچنین با توجه به اینکه ژن NPR1در ساعات اولیه پس از آلودگی به طور معنی­داری در فلات تیمار شده افزایش یافته، می­توان چنین تصور نمود که ژن NPR1 می­تواند به عنوان شاخصی برای القای مقاومت به بیمارگر در نظر گرفته شود. نقش NPR1 در مقاومت گندم به فوزاریوم (29)، آرابیدوپسیس به سفیدک سطحی (38) تایید شده است. ماکاندار و همکاران (29) نیز طی مطالعاتی بوسیله انتقال ژن AtNPR1 به گندم حساس سبب افزایش بیان ژن NPR1، فعال نمودن SAR و افزایش مقاومت به Fusarium graminearumگردیدند.  

ژن MLO : نتایج آنالیز بیان ژن MLOنشان داد که پس از محلول پاشی کیتوزان، سطح تظاهر این ژن به طور قابل توجهی کاهش یافت، بطوری‎که گیاهان تیمار شده با کیتوزان 250 و 500 میلی گرم در لیتر به ترتیب با میزان بیان 74/0 و 83/0 نسبت به زمان کنترل کاهش معنی‎داری را نشان دادند (شکل 3). همچنین بررسی تغییرات الگوی بیان ژن MLO پس از آلودگی با بیمارگر نشان داد بیان این ژن در 12 ساعت پس از آلودگی در گیاهان تیمار شده و شاهد نسبت به زمان صفر القا گردید ولی گیاهان پیش تیمار شده به خصوص در تیمارکیتوزان 250 میلی‎گرم در لیتر با کاهش 42/1 برابری نسبت به گیاهان کنترل، تفاوت معنی­داری را نشان دادند. از سویی ارزیابی میزان بیان این ژن در 24 ساعت پس از آلودگی حاکی از متفاوت بودن روند تغییرات در گیاهان تیمار شده و کنترل بود. به طوریکه گیاهان تیمار شده با کیتوزان 250 و 500 میلی گرم در لیتر به ترتیب با میزان بیان 95/0 و 3/1 برابری نسبت به زمان کنترل به حداقل بیان بعد از آلودگی رسیدند، در حالیکه گیاهان کنترل با میزان بیان 8/1 برابری نسبت به زمان صفر سیر صعودی از بیان ژن را نسبت به گیاهان پیش تیمار شده نشان دادند. مقایسه سطح تظاهر این ژن در بازه 24 ساعت پس از آلودگی حاکی از آن است که میزان بیان در گیاهان تیمار شده با کیتوزان 250 و 500 میلی گرم در لیتر به ترتیب 9/1 و 3/1 برابر کمتر از گیاهان کنترل می‏باشد. از سویی نتایج الگوی بیان حاکی از کاهش معنی‎دار سطح بیان این ژن در تمامی بازه‎های زمانی در گیاهان تیمار شده با کیتوزان 250 نسبت به تیمار 500 میلی گرم در لیتر بود.

ﭘﺮﻭﺗﺌﻴﻦ  MLO، ﮔﻴﺮﻧﺪﻩ‏ﻫﺎی ﻏﺸﺎء ﭘﻼﺳﻤﺎﯾﯽ می‏باشند که فرم وحشی ژن آن تنظیم کننده منفی مرگ سلولی در گیاه می باشد (26). آنالیز بیان ژن MLOدر رقم حساس پس از تیمار با سطوح کیتوزان نشان داد که سطح تظاهر این ژن پس از محلول پاشی به طور قابل توجهی کاهش یافت که این نتیجه بیانگر تاثیر منفی این القا کننده شیمیایی در القای بیان این ژن می­باشد. در حالی‌که پس از اعمال آلودگی با قارچ Bgt سطح بیان ژن در گیاهان تیمار شده و کنترل به طور قابل توجهی افزایش یافت که این نتیجه می­تواند به دلیل درک اولیه گیاه از حمله قارچ سفیدک سطحی باشد، در حالی‎که میزان بیان در گیاهان پیش تیمار شده به طور معنی­داری کمتر از گیاهان کنترل بود. از این کاهش بیان چنین تصور می‎شود که گیاهان القا شده همراه با کاهش سطح ژن MLO، تولید H2O2را که مرتبط با فرآیندهای دفاعی و مرگ سلولی در گیاه است (12) در همان ساعات اولیه پس از آلودگی جهت مقابله با لوله تندشی اولیه و اپرسوریوم قارچ آغاز می‎کنند (40). سپس گیاهان تیمار شده برخلاف گیاهان کنترل، در 24 ساعت پس از آلودگی، اقدام به کاهش سطح بیان ژن MLOنموده، به طوریکه در این بازه زمانی بیشترین تفاوت معنی‏دار بین دو گروه (تیمار شده و کنترل) از گیاهان مشاهده گردید. همانطور که ذکر شد ژن MLO واکنش دفاعی را سرکوب نموده و سبب القای حساسیت به بیمارگرهای بیوتروف می­گردد، لذا فقدان و یا کاهش بیان این ژن، سبب القای مرگ سلولی، تشکیل پاپیلا، پیری زودرس و بیان ژن­های PR در پاسخ به بیمارگر می‎گردد (34). بنابراین، کاهش قابل ملاحظه‎ی بیان ژن MLOدر 24 ساعت پس از آلودگی همزمان با نفوذ میخ رخنه و توسعه هاستوریوم قارچ را می­توان بدین صورت توجیه نمود. مطالعات نشان داد که H2O2 تولید شده می­تواند از سویی در تشکیل پاپیلا و از سویی در مرگ سلولی نقش داشته باشد، لذا تلقیح کیتوزان بر روی گیاه با القای کاهش سطح بیانی ژن MLO در جهت افزایش میزان H2O2 سبب القای مسیر SAR و پاسخ­های مقاومتی  و مرگ سلولی در محل حمله قارچ شده و بدین ترتیب از گیاه در برابر توسعه قارچ بیوتروف حمایت می­نماید. نتایج حاصله با نتایج آهنگر و همکاران (1) مبنی بر کاهش بیان ژن MLO در گندم تیمار شده با سالسیلیک اسید تحت بیماری Bgt مطابقت داشت. ژو و همکاران (45) گزارش نمودند که ژن MLO در خیار سبب حساسیت به بیماری سفیدک سطحی شده است. در حالیکه پسینا و همکاران (33) نیز با سرکوب نمودن ژن MLO در انگور توانستند حساسیت به Erysiphe necator را کاهش دهند. اولین گزارش از تاثیر کیتوزان در سرکوب بیان ژن MLOدر گندم آلوده به Bgt می­باشد.

ژن BI-1 : پروتئین BI-1 یکی از تنظیم کننده­های منفی مرگ سلولی است که دارای نقش همه جانبه در پاسخ به استرس می‎باشد (26 و 19).  به طوریکه شواهد بیانگر این بود که بیان بالای این ژن از مرگ سلولی ایجاد شده توسط H2O2 و SA نیز جلوگیری می­نماید (23). پروتئین BI-1 همچنین در کنار کنترل مرگ سلولی، قادر خواهد بود مقاومت غیراختصاصی جو در موتانت mlo را از بین برده و سبب نفوذپذیری این گیاهان به ایزوله­های مختلف قارچ سفیدک سطحی گردند (15). تجزیه و تحلیل بیان ژن BI-1نشان داد که گیاهان پیش تیمار شده با کیتوزان 250 و 500 میلی گرم در لیتر به ترتیب با میزان بیان 8/0و 9/0 برابری نسبت به زمان صفر کاهش معنی­داری را نسبت به گیاه کنترل نشان دادند (شکل 3). در حالیکه نتایج آنالیز بیان ژن BI-1، پس از اعمال آلودگیحاکی از افزایش بیان این ژن همراه با روندی متفاوت در گیاهان پیش تیمار شده و کنترل بود. بیان این ژن در هر دو گروه از گیاهان در 12 ساعت پس از آلودگی القاء گردید ولی تفاوت معنی­داری بین کیتوزان 500 با گیاهان کنترل مشاهده نشد. در حالیکه گیاهان تیمار شده با کیتوزان 250 میلی گرم در لیتر، با کاهش 3/1 برابری نسبت به گیاه کنترل تفاوت معنی­دار را نشان دادند . این گیاهان (تیمار کیتوزان 250) نهایتأ در 24 ساعت پس از آلودگی با میزان بیان 07/1 برابری نسبت به زمان صفر به بیشترین بیان خود رسیدند. در حالیکه گیاهان کنترل روند افزایشی سریع­تری از میزان بیان ژن BI-1را پس از آلودگی نشان داده و در نهایت در 24 ساعت پس از آلودگی با میزان بیان 47/1 برابری نسبت به زمان صفر به بیشینه بیان خود رسیدند. بررسی الگوی بیان ژن نشان داد که اگرچه اوج بیان ژن BI-1در گیاهان پیش تیمار شده و کنترل در یک بازه زمانی (24 ساعت) رخ داده ولی میزان بیان در گیاهان کنترل 37/1 برابر بیشتر از گیاهان پیش تیمار با کیتوزان 250 بود که این میزان افزایش در سطح 5 درصد معنی‎دار می‎باشد. در حالی‎که مجددا تفاوت معنی داری بین گیاهان کنترل و تیمار شده با 500 میلی گرم کیتوزان ددر این بازه زمانی مشاهده نشد. سپس هر دو گروه از گیاهان در 48 ساعت پس از آلودگی روند کاهشی بیان را در پیش گرفتند به طوری‎که گیاهان تیمار شده با کیتوزان سطوح کمتری از بیان را نشان دادند. 

به طور کلی بررسی روند تغییرات بیان ژن BI-1در نمونه­های برگی رقم فلات پس از محلول پاشی با کیتوزان حاکی از القا میزان بیان این ژن در ساعات پس از آلودگی بود، در حالیکه گیاهان تیمار شده کاهش معنی‎داری را نسبت به گیاهان شاهد نشان دادند. مطالعات قبلی نشان داد که ژن BI-1 ممکن است همانند MLO به عنوان یک تنظیم کننده منفی مرگ سلولی پاسخ­پذیر به شرایط اکسایشی درگیر در فرآیند پیری برگ عمل نماید (34).  لذا تصور می­گردد همانند ژن MLO، فقدان و یا کاهش ژن BI-1نیز می­تواند به دلیل ارتباط با مرگ سلولی و القای پاسخ­های مقاومتی سبب مقاومت بالای گیاه به ایزوله‎های قارچ سفیدک سطحی گردد. از سویی نتایج مطالعات ایشمن و همکاران (14) نیز نشان داد که بیان بالای ژن HvBI-1 در جو سبب کاهش انفجار H2O2 در دیواره سلولی ژنوتیپ مقاوم mlo و حمایت از توسعه هاستوریوم قارچ در گیاه می­گردد. در حالیکه هوکلهوفن و همکاران (20) نشان دادند که کاهش بیان ژن BI-1سبب مرگ سلولی و افزایش نواحی نکروزه در محل­های آلوده شده می­گردد. بنابراین کاهش سطح بیان این ژن در گیاهان تیمار شده نسبت به گیاهان کنترل در بازه­های زمانی مصادف با نفوذ میخ رخنه و توسعه هاستوریوم قارچ در گیاه یعنی 24 ساعت پس از آلودگی می‎ تواند بیانگر تاثیر مثبت پیش تیمار کردن کیتوزان بر روی برگ گندم حساس به Bgt، باشد. به طوری‎که کیتوزان از طریق القای آمادگی می­تواند در افزایش پتانسیل مقاومتی در رقم حساس بسیار موثر باشد، لذا این گیاهان پس از اعمال آلودگی با قارچ Bgt بوسیله کاهش سطح بیان ژن BI-1 ، سبب افزایش تجمع  H2O2و متعاقبأ القای مرگ سلولی در سلول­های مورد حمله شده تا از نفوذ و توسعه بیشتر قارچ در سلول میزبان ممانعت نمایند. به طوری که مطالعات نشان داد که بیان بالای ژن BI-1درگندم سبب متوقف شدن مرگ سلولی گردید (44). بر اساس بررسی منابع موجود این اولین گزارش از تاثیر کیتوزان در سرکوب بیان ژن BI-1در گندم آلوده به بیماری Bgt می­باشد که با نتایج آهنگر و همکاران (1) مبنی بر کاهش بیان ژن BI-1 در گندم تیمار شده با سالسیلیک اسید و قارچ Piriformospora indica تحت آلودگی با Bgt مطابقت دارد.

در کل بر اساس مطالعات انجام شده پیشنهاد می­گردد که پروتئین BI-1 می­تواند به عنوان یک واسطه کلیدی عمل نموده که می­تواند واکنش­های مرگ سلولی را در طی کنش با انواع مختلفی از بیمارگر­ها تنظیم کند. از سویی مطالعه و بررسی این ژن در کنار ژن MLO می­تواند به عنوان مارکر مناسبی برای ارزیابی میزان حساسیت ژنوتیپ­های گندم به قارچ سفیدک سطحی مورد استفاده قرار گیرد. علاوه بر این در شکل 4، منحنی ذوب مربوط به ژن­های مورد بررسی نشان داده شده است. همانطور که مشاهده می‏شود هیچ نوع یک اضافی که حاکی از تکثیر غیر اختصاصی ژن مورد نظر و وجود آغازگر دایمر باشد دیده نمی‏شود.

بحث و نتیجه گیری

کاربرد خارجی کیتوزان بوسیله القای مکانیسم مقاومتی SAR سبب القا بیان ژن‏های دفاعی در بافت‎های تیمار شده با این فعال کننده می‎گردد. نتایج حاصل از این مطالعه نشان داد که سطح بیان ژن دفاعیNPR1 پس از 24 ساعت تیمار با کیتوزان افزایش معنی­داری را نشان داده، در حالی‎که دو ژن کنترل کننده منفی مرگ سلولی MLO و BI-1، کاهش معنی‎داری را نسبت به گیاه کنترل نشان دادند. همچنین پس از اعمال آلودگی نیز گیاهان پیش تیمار شده با بیان زود

هنگام خود تفاوت معنی‎داری را نسبت به گیاهان کنترل نشان دادند که این نتایج بیانگر موثر بودن نقش کیتوزان در القای ژن­های مسیر مقاومت می­باشد. به طور کلی نتایج این بررسی نشان داد که کاربرد خارجی کیتوزان بوسیله افزایش سطح SA در گیاه، القای SAR، بیان PR پروتئین‎ها، MLO و BI-1، و دیگر محصولات ژن‎های دفاعی سبب افزایش مقاومت در گیاه به بیماری می‎گردد.

از سویی میزان بیان ژن های دفاعی در گیاهان تیمار شده با کیتوزان 250 در سطوح بالا و مناسب تری نسبت به گیاهان تیمار شده با کیتوزان 500 میلی گرم در لیتر بود.  به نظر می سد یکی از دلایل مشاهده این نتایج اثرات سمی کیتوزان در غلظت بالا باشد، لذا توصیه می گردد سطوح بالای کیتوزان مصرف نگردد. بنابراین بر اساس این مطالعه در مقاومت به سفیدک کاربرد سطح 250 میلی گرم در لیتر کیتوزان توصیه می گردد.

از نتایج بدست آمده چنین استنباط می‎گردد یک همبستگی بین زمان و فعالیت ژن‎هایNPR1، MLO و BI-1 و مقاومت یا تحمل به بیماری سفیدک سطحی وجود دارد. با توجه به تغییرات مشاهده شده در الگوی بیان ژن‎های مورد مطالعه و نقش آنها در مقاومت، تصور می‎شود این ژن‎ها در ارتباط با پاسخ‎های دفاعی گندم نسبت به بیمارگر نقش بسیار مهمی را ایفا می‎نمایند. بنابراین این ژن‎ها می‎توانند به عنوان ژن‎های کاندید، برای مطالعات بیشتر در جهت تولید ارقام مقاومی که دارای سطح بیان بیشتری از این ژن‎ها باشند، محسوب شوند. به طور کلی نتایج حاصل از الگوی بیان ژن، بهبود خصوصیات مرفولوژیکی و شمارش کلنی‎های رشد یافته بیانگر موثر بودن نقش کیتوزان در القای مقاومت گندم حساس به قارچ Bgt بود. از سویی با در نظر گرفتن مزایای زیست محیطی کیتوزان و نیز هزینه‎های فراوان کودهای شیمیایی از نظر اقتصادی و هزینه­های جبران ناپذیر زیست محیطی، کیتوزان را می‎توان در جهت کاهش خسارت بیماری و کم نمودن آثار سوء استفاده از مواد شیمیایی مورد استفاده قرار داد. 


شکل4 – منحنی ذوب ریل تایم برای ژن­های Actin (A) ، NPR1 (B)، MLO (C) و BI-1 (D) در گیاهان تیمار شده با کیتوزان و گیاهان کنترل قیل و پس از آلودگی با Bgt. آنالیز مرحله ذوب نشان دهنده وجود تنها یک پیک با دمای ذوب مشخص می‏باشد که در واقع تاییدی بر تک محصوله بودن آغازگر‏های مورد استفاده می‏باشد.

1.     آهنگر، ل. 1393. بررسی سلولی و مولکولی چند رقم گندم در تعامل با قارچ سفیدک سطحی و بررسی امکان القای ژن‌های مقاومت پس از تیمار با اسید سالسیلیک و قارچ اندومایکوریز Piriformospora indica. رساله دکتری. دانشگاه علوم کشاورزی و منابع طبیعی ساری.

  1. آهنگر، ل.،  رنجبر، غ.ع.، بابایی زاد، و.، نجفی زرینی، ح و بیابانی، ع. 1393. بررسی بیان فنیل آلانین آمونیالیاز و ژن­های مرتبط با بیماریزایی در گندم همزیست شده با قارچ اندومیکوریز Piriformospora indica پس از آلودگی با سفیدک پودری. بیماری گیاهی. 4(50): 384-369
  2. قاضی محسنی، ق. و صباغ، س.ک. 1394. اثر کیتوزان در بیان ژن و فعالیت آنزیم های موثر در القای مقاومت به بلایت فوزاریومی خوشه گندم. دانش گیاهپزشکی ایران. 46(2): 371-363
    1. Aist, J.R., and Bushnell, W.R. 1991. Invasion of plant hosts by powdery mildew fungi and cellular mechanism of resistance. In:  Cole GT,  Hoch HC (Eds)  The Fungal Spore and Disease Initiation in Plants and Animals. Plenum Press, New York 321-345.
    2. Amborabe, B. E., Bonmort, J., Fleurat-Lessard, P. and Roblin. G. 2008. Early events induced by chitosan in plant cells.  Journal Experimental Botany. 59: 2317-2324.
    3. Babaeizad, V. 2009. Generation and molecular analyses of transgenic barley (Hordeum vulgare L.) in response to relevant pathogens. Msc Thesis. Agriculture Justus Liebig university Gieben. pp: 103
    4. Babaeizad, V.,  Imani, J.G., Kogel, K. H., Eichmann, R. and Hückwlhoven, R. 2009. Over-expression of the cell death regulator BAX inhibitor-1 in  barley confers reduced or enhanced susceptibility to distinct fungal pathogens. Theortical Applied Genetic. 118: 455-463.
    5. Ben-Shlom N and Fallik, E.. 2003. Further suppression of Botrytis cinerea disease in cucumber seedlings by chitosan–copper complex as compared with chitosan alone. Phytoparasit. 31: 99–102.
    6. Chaturvedi, R. and Shah, J. 2007. Salicylic acid in plant disease resistance. Pp: 335-370 in: Salicylic Acid—A Plant Hormone. Hayat S. and Ahmad, A. eds. Springer, Dordrecht, The Netherlands. 
    7. Chern, M. C., Fitzgerald, H. A.. Canals, P. E., Navarre, D. A. and Ronald, P. C. 2005. Overexpression of a rice NPR1 homolog leads to constitutive activation of defense response and hypersensitivity to light . Molecular Plant Microbiology Interaction. 18: 511–520
    8. Clarke, S. M., Mur, L. A. Wood, J. E. and Scott, I. M. 2004. Salicylic acid dependent signaling promotes basal thermo tolerance but is not essential for acquired thermo tolerance in Arabidopsis thaliana. Plant Journal. 38:432-447
    9. Doke, N., Miura, Y. Sanchez, L.M. Park, H.J. Noritake, T. Yoshioka. H..and Kawakita, K.. 1996. The oxidative burst protects plants against pathogen attack: mechanism and role as an emergency signal for plant bio-defense: areview. Gene. 179:45–51. 
    10. Dong, X. 2004. NPR1, all things considered. Current Opinion in Plant Biology, 7: 547-552.
    11. Durrant, W. E., and Dong, X.. 2004. Systemic Acquired Resistance. Annual Review of Phytopathology. 42:185-209.
    12. Eichmann, R., Bischof, M., Weis, C., Shaw, J., Lacomme, C., Schweizer, P., Duchkov, D., Hensel, G., Kumlehn, J. and Huchelhoven, R. 2010.  BAX INHIBITOR-1 is required for full susceptibility of barley to powdery mildew.. Molecular Plant Microbe Interaction. 23: 1217-1227.
    13. Eichmann, R., Holger, S., Kogel, K. H. and Hückelhoven, R. 2004. The barley apoptosis suppressor homologue Bax inhibitor-1 compromises nonhost penetration resistance of barley to the inappropriate pathogen Blumeria graminis f. sp. tritici. Molecular Plant–Microbe Interactions. 17:484–490.
    14. Hückelhoven, R. 2004. BAX inhibitor-1, an ancient cell death suppressor in animals and plants with prokaryotic relatives. Apoptosis 9: 299–307.
    15. Hückelhoven, R., Dechert, C. and Kogel. K. H. 2003. Overexpression of barley BAX inhibitor 1 induces breakdown of  mlo-mediated penetration resistance to Blumeria graminis. Proceedings of the National Academy of Sciences. 100: 5555–5560.
    16. Imani. J., Baltruschat, H., Stein, E., Jia, G., Vogelsberg, J., Kogel, K. H. and Hückelhoven. R. 2006. Expression of barley BAX inhibitor-1 in carrots confers resistance to Botrytis cinerea. Molecular Plant Pathology. 7: 279-284.
    17. Johnson ,C., Boden. E. and Arias. J. 2003. Salicylic acid and NPR1 induce the recruitment of trans-activating TGA factors to adefense gene promoter in Arabidopsis. Plant Cell. 15:1846–58
    18. Kawai-Yamada, M., Ohmori, Y. and Uchimiya, H. 2004. Dissection of Arabidopsis Bax inhibitor-1 suppressing Bax-, hydrogen peroxide-, and salicylic acid-induced cell death. The Plant Cell. 16:21–32.
    19. Kim, M. C., Panstruga, R., Elliott, C., Müller, J., Devoto, A., Yoon, H. W., Park, H., Cho, M. J. and Schulze-Lefert, P. 2002. Calmodulin interacts with MLO to regulate defence against mildew in barley. Nature. 416:447-450.

 

17.  Faoro F., Maffi, D., Cantu, D. and Iriti, M. 2008. Chemical-induced resistance against powdery mildew in barley: the effects of chitosan and benzothiadiazole. Bio Control. 53: 387–401.

18.    Fitza, K. N. E., Payn, K. G., Steenkamp, E. T., Myburg, A. A. and Naidoo, S. 2013. Chitosan application improves resistance to Fusarium circinatum in Pinus patula . Elsevier. 85: 70-78.

25. -Koers, S., Guzel-Deger, A., Marten, I. and Roelfsema. M. R. 2011. Barley mildew and its elicitor chitosan promote closed stomata by stimulating guard-cell S-type anion channels. Plant. J. 68:670-80.

  1. Lam, E., Kato, N. and Lawton, M. 2001. Programmed cell death, mitochondria and the plant hypersensitive response. Nature. 411: 848–853.

27.    Landi, L., De Miccolis Angelini, R.M., Pollastro, S., Feliziani, E., Faretra, F. and Romanazzi, G. 2017. Global Transcriptome Analysis and Identification of Differentially Expressed Genes in Strawberry after Preharvest Application of Benzothiadiazole and Chitosan. Front Plant Science. 8: 235- 247.

28. Livak, K.J. and Schmittgen, T. D. 2001. Analysis of relative gene expression data using real Time Quantitative PCR and the 2-ΔΔCTmethod. Methods.  25: 402-408.

29. Makandar, R., Essig, J. S., Schapaugh, M. A., Trick H. N. and Shah. J. 2006. Genetically engineered resistance to Fusarium head blight in wheat by expression of Arabidopsis NPR1. Molecular Plant- Microb Interaction. 19: 123-139.

  1. Molitor, A.,  Zajic, D., Voll, L. M., Pons- Hückelhuven, J., Samans, B., Kogel, K. H. and Waller, F. 2011. Barley Leaf Transcriptome and Metabolite Analysis Reveals New Aspects of Compatibility and Piriformospora indica–Mediated Systemic Induced Resistance to Powdery Mildew . Molecular Plant-Microbe Interaction.  24: 1427–1439. 
  2. Mou, Z., Fan, W. and Dong, X. 2003. Inducers of plant systemic acquired resistance regulate NPR1 function through redox changes. Cell. 113: 935–944.
  3. Nandeeshkumar, P., Sudisha, J., Ramachandra, K. K., Prakash, H. S., Niranjana. S. R. and  Shekar, S. H. 2008. Chitosan induced resistance to Downy mildew in sunflower caused by Plasmopara halstedii. Journal Physiology Molecular Plant Pathology. 72: 188-94.
  4. Piffanelli, P., Zhou, F., Casais, C., Orme, J., Jarosch, B., Schaffrath, U., Collins, N.C., Panstruga, R. and Schulze-Lefert. P. 2002. The barley MLO modulator of defense and cell death is responsive to biotic and abiotic stress stimuli. Plant Physiology. 129: 1076–1085. 
  5. Propagdee, B., Kotchdat, A., Kumsopa, A. And  Visarathanonth,  N. 2006. The role of chitosan in protection of soybean from suolden death syndrome caused by Fusarium solani f. sp. Glycines. Bioresource Technology.  98: 1353-1358.
  6. Reinstädler, A., Müller, J., Czembor, J. H. Piffanelli, P. and Panstruga, R. 2010. Novel induced mlo mutant alleles in combination with site-directed mutagenesis reveal functionally important domains in the heptahelical barely MLO protein. BMC Plant Biology. 10: 31-44.
  7. Stein, E., Molitor, A. Kogel. K. H. and Waller, F. 2008. Systemic resistance in Arabidopsis conferred by the mycorrhizal fungus Piriformospora indica requires jasmonic acid signaling and the cytoplasmic function of NPR1. Plant Cell Physiology. 49:1747-51.
  8. 39.  Tada, Y., Spoel, S. H., Pajerowska-MuhktarMou, K. Z., Song, J. et al. 2008. Plant immunity requires conformational changes of NPR1 via S-nitrosylation and thioredoxins. Science. 321:952–56
  9. Thordal-Christensen, H., Zhang, Z., Wei, Y. and Collinge, D. B. 1997. Subcellular localization of H2O2 in plants: H2O2 accumulation in papillae and hypersensitive response during the barley powdery mildew interaction. Plant Journal. 11:1187–1194 
  10. Van Hulten, M., Pelser, M., Van Loon, L. C., Pieterse, C. M. J. and Ton, J. 2006. Costs and benefits of priming for defense in Arabidopsis. Proceeding of the National Academy of Science USA. 103: 5602-5607.

33.    Pessina, S., Luisa, L., Perazzoli, M., Campa, M., Costa, L. D., Urso, S., Vale, G., Salamini, F., Velasco, R. and Malnoy, M. 2016. Knockdown of MLO genes reduces susceptibility to powdery mildew in grapevine. Hortic Research. 3: 160-166

37.    Siddaiah, Ch. N., Harish Prasanth, K.V., Raj Satyanarayana, N., Mudili, V., Gupta,  V. K., Kalagatur, N. K., Satyavati, T., Feng Dai, X., Chen, J. Y., Mocan, A., Singh, B.P. and Srivastav, R. K. 2018. Chitosan nanoparticles having higher degree of acetylation induce resistance against pearl millet downy mildew through nitric oxide generation. Scientific Report. 8: 1-14

42. Van Loon, L.C., Rep M. and Pieterse, C. M. J. 2006. Significance of Inducible Defense-related proteins in infected plants. Phytopathology. 44: 135-162.

  1. 43.  Vlot, A.C., Dempsey, D. A. and  Klessig, D. F. 2009. Salicylic acid, a multifaceted  hormone to combat disease. Annual Review of Phytopathology. 47: 177-206.

44.    Wang, X., Tang, C., Huang, X., Li, F., Chen, X., Zhang, G., Sun, Y., Han. D. and Kang, Z. 2012.Wheat BAX inhibitor-1 contributes to wheat resistance to Puccinia striiformis. Journal Experial Botany. 63: 4571-4584

45.    Zhou, S. J., Jing, Z. and Shi. J. L. 2013. Genome-wide identification, characterization, and expression analysis of the MLO gene family in Cucumis sativus. Genet Molecular Research. 12: 6565-6578.