نوع مقاله: مقاله پژوهشی

نویسنده

دانشگاه شهید باهنر کرمان

چکیده

در این تحقیق برای اولین بار به شناسایی، استخراج و بررسی بیان ژن‌های محافظ سلولی (لایف‌گارد) در هیدر آب شیرین Hydra Vulgaris پرداخته شده است. بدین منظور،100 عدد از پولیپ‌های هیدر آب شیرین پرورش یافته برای استخراج DNA مورد استفاده قرار گرفتند و جهت تکثیر ژن‌های مورد نظر پرایمر‌های خاص طراحی و واکنش PCR صورت گرفت. پس از تکثیر ژن‌های محافظ سلولی، به منظور بررسی محل بیان این ژن‌ها، از تکنیک هیبریداسیون درجا با استفاده از دیگوکسیژنین استفاده شد. نتایج نشان داد که سه توالی از ژن‌های محافظ سلولی به نام‌های محافظ سلولی-‌4 و دو هومولوگ از محافظ سلولی-1 بی‌مهرگان در هیدر وجود دارد. هیبریداسیون درجا نشان داد که mRNA محافظ سلولی-‌4 در لایه اندودرم پولیپ در مراحل مختلف جوانه زدن مشاهده می‌شود. همچنین، این ژن در زمان تولید‌مثل غیر‌جنسی و مراحل مختلف تخمک‌زایی در تخمدان پولیپ ماده بیان می‌گردد. درخت فیلوژنی مشخص نمود که ژن‌های محافظ سلولی در ساده‌ترین جانور حقیقی به صورت تثبیت شده وجود دارد و از آنجایی که مکانیسم مرگ برنامه‌ریزی شده سلولی در گامت‌زایی هیدر (تولید تخمک و اسپرم) نقش دارد، بیان ژن محافظ سلولی-‌4 به عنوان ژن محافظ سلول در محل‌هایی که مرگ برنامه‌ریزی شده سلولی نقش ایفا می‌کند، منطقی به نظر می‌رسد.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Programmed cell death regulatory genes in primitive Euometazoa

نویسنده [English]

  • Mina Motamedi

Shahid bahonar university of Kerman

چکیده [English]

The aim of this manuscript is to study for the first time identification, extraction and expression pattern of lifeguard genes in fresh water polyp Hydra Vulgaris. To do this objective, 100 freshwater polyps were cultured and total DNA extraction was performed. Specific primers were designed for all genes and PCR reaction applied to amplify Lifeguard genes. In order to investigate the gene expression pattern, In situ hybridization experiment used. The experiments revealed that there are three lifeguard genes in hydra, which are called Lifeguard-4 and two homologous of invertebrates’ Lifeguard-1. In situ hybridization showed that Lifeguard-4 expressed in endodermic layer of polyps in all budding stages and also in different stages of oogenesis. Phylogenetic analysis indicated that lifeguard genes are well conserved and present at the base of Euometazoa like freshwater Hydra polyp. Since apoptosis signaling pathway is present during Hydra gametogenesis (oogenesis and spermatogenesis), expressions of Lifeguard-4 as an apoptosis regulatory gene, in places were apoptosis occur is logistic and confirms the regulatory function of these genes.

کلیدواژه‌ها [English]

  • Apoptosis
  • lifeguard proteins
  • in situ hybridization
  • Euometazoa

ژنهای تنظیم کننده مرگ برنامه ریزی شده سلولی در یومتازوآی ابتدایی

مینا معتمدی

کرمان، دانشگاه شهید باهنر کرمان، دانشکده علوم، گروه زیست شناسی

تاریخ دریافت: 5/10/94                تاریخ پذیرش: 26/9/96

چکیده

در این تحقیق برای اولین بار بهشناسایی، استخراج و بررسی بیان ژنهای محافظ سلولی (لایف­گارد) در هیدر آب شیرین
Hydra vulgarisپرداخته شده است. بدین منظور،100 عدد از پولیپهای هیدر آب شیرین پرورش یافته برای استخراج DNA مورد استفاده قرار گرفتند و جهت تکثیر ژنهای مورد نظر پرایمر­های خاص طراحی و واکنش PCR صورت گرفت. پس از تکثیر ژنهای لایف­گارد، به منظور بررسی محل بیان این ژنها،  از تکنیک هیبریداسیون درجا با استفاده از دیگوکسیژنین استفاده شد. نتایج نشان داد که سه توالی از پروتئین لایف­گارد به نامهای لایف­گارد-4 و دو هومولوگ از لایف­گارد-1 بی­مهرگان در هیدر وجود دارد. هیبریداسیون درجا مشخص کرد که پروتئین لایف­گارد-4 در لایه اندودرم پولیپ در مراحل مختلف جوانه زدن مشاهده می شود. همچنین این پروتئین در زمان تولید­مثل غیر­جنسی و مراحل مختلف تخمک­زایی در تخمدان پولیپ ماده بیان می­گردد.درخت فیلوژنی مشخص نمود که ژنهای لایف­گارد در ساده­ترین جانور حقیقی به صورت تثبیت شده وجود دارد و از آنجایی که مکانیسم آپوپتوسیز در گامت زایی هیدر (تولید تخمک و اسپرم) نقش دارد، بیان ژن لایف­گارد-­4 به عنوان ژن محافظ سلول در محلهایی که مرگ برنامه­ریزی شده سلولی نقش ایفاء می کند، منطقی به نظر می­رسد.

واژه­های کلیدی: آپوپتوسیز، پروتئین لایف­گارد، هیبریداسیون درجا، یومتازوآ

نویسنده مسئول، تلفن: 03431322075 ، پست الکترونیکی: m.motamedi@uk.ac.ir

مقدمه

 

اعضای شاخه مرجانیان (Cnidarian) به عنوان ساده­ترین گروه جانوران محسوب می­گردند و در درخت تکاملی در پایه جانوران حقیقی (Eumetazoa) قرار می­گیرند (شکل a1). ساختار بدنی هیدر آب شیرین به عنوان مدل معروف این گروه در شکل b1نشان داده شده است،  ساختار بدنی آنها از دو لایه سلولی اکتودرم و اندودرم تشکیل شده است و توسط پایه (pedancle) به سطوح مختلف متصل می شود و از طریق بازوهای(tentacles) اطراف دهان (hypostome) طعمه را وارد حفره بدنی می کند (7).

 

 

شکل 1- (a) محل قرارگیری مرجانیان (Cnideria) در درخت فیلوژنی (2)  و (b) طرح بدن پولیپ آب شیرین (1). مقیاس 100 میکرومتر.

 

هیدر آب شیرین به دو روش جوانه زدن (تولید مثل غیرجنسی) و تولید اسپرم و تخمک (تولید مثل جنسی) تکثیر پیدا می کند. در روش جوانه زدن که در زمان فراوانی مواد غذایی در دسترس صورت می گیرد، چهار مرحله بارز وجود دارد که این مراحل از زمان شروع جوانه تا زمانی که هیدر جدید قادر به زندگی مستقل می باشد، تقسیم بندی می شود (شکل 2)، (3).

 

شکل 2- تولید مثل در پولیپ آب شیرین.  مراحل 4B-1B نشان دهنده چهار مرحله مختلف جوانه زدن هیدر (تولید مثل غیر جنسی) است. داده شده است. مراحلF1-F3 برای جنس ماده و مراحل M1-M3 برای جنس نر نشان دهنده تکوین بیضه ها و تخمدان در پولیپ نر و ماده در زمان تولید مثل جنسی می باشد. (E) نشان دهنده تخمک لقاح یافته می باشد که در زمان مساعد شدن محیط شکفته شده (H) و به صورت پولیپ بالغ (O) در می آید (1).

اعضای این شاخه از جمله، هیدر آب شیرین به دلیل داشتن ویژگیهای منحصر به فرد، به عنوان مدل بسیار مناسبی برای انجام مطالعات سلولی تکوینی محسوب می­گردند. از جمله این ویژگیها می­توان به موارد زیر اشاره نمود؛ علاوه بر ساختار بدنی ساده و قابلیت تکثیر سریع در محیط آزمایشگاهی، گونه هیدر آب شیرین همانند دیگر گونه های پیشرفته­تر جانوری، واجد تمامی ژنها و پروتئینهای مرتبط با مکانیسم آپوپتوسیز (مرگ برنامه­ریزی شده سلولی) می­باشد (10). همچنین، مشخص شده است که فاگوسیتوز در سلولهای اپیتلیال هیدر صورت می­گیرد و این عمل در پاسخ به تفاوت در میزان غذای در دسترس، ترمیم، گامت­زایی و پایداری هوموستازی سلول انجام می شود (2 و 3). سلولهای جنسی در هیدر آب شیرین، از سلولهای بنیادی چند­توان ایجاد می­شوند و تحریک پولیپها در هر دو جنس نر و ماده از طریق قحطی غذا و کاهش دمای محیط است (2).  با رنگ­آمیزی توسط Acridine orange  مشخص شده است که سلولهای زیادی در بیضه هیدر آب شیرین دارای واکوئل فاگوسیتوزی هستند (9). علاوه بر این، از طریق آزمایش LTUNE که نشان دهنده فعالیت کاسپازها است، مشخص شده است که در سلولهای بیضه هیدر، مکانیسم آپوپتوسیز نیز در حال انجام است (9). مکانیسم آپوپتوسیز در تخمک زایی پولیپ ماده نیز نقش دارد و در زمان تکوین تخمک، کلیه سلولهای پرستار وارد مسیر آپوپتوسیز می شود و در نهایت توسط تخمک فاگوسیتوز می شود (11). در واقع سلولهای پرستار از طریق کانالهای ویژه­ایی، سیتوپلاسم خودشان را در اختیار تخمک در حال رشد گذاشته و از این طریق مواد مورد نیاز برای تکوین تخمک را در اختیار آن  قرار می­دهند (1). مطالعات بیشتر مشخص نمود که مسیر سیگنالی آپوپتوسیز در هیدر بدون تغییر است و دارای شباهتهای بسیاری با جانوران پیشرفته­تر از جمله پستانداران می­باشد (10). مطالعات قبلی انجام شده بر روی مکانیسم مرگ برنامه­ریزی شده سلولی نشان داد که علاوه بر وجود ژنهایBcl-2  و کاسپازها در هیدر، پروتئینهای این ژنها نیز از لحاظ عملکردی نیز کاملاً فعال هستند (10). ژنهای مرتبط با تنظیم مکانیسم آپوپتوسیز که نقش حفاظت سلولی دارند نیز در این گونه به صورت کاملاً حفاظت شده وجود دارد. به طور کلی این پروتئینها تحت عنوان خانواده TMBIM (The transmembrane Bax inhibitor-1 motif containing) شناخته می­شوند (8). تعداد 5 ژن متعلق به این خانواده در پستانداران وجود دارد که شامل GRINA، BI-1/TMBIM6، Lfg/FAIM2، GHITM، RECS1/TMBIM1، GAAP/TMBIM4 و TMBIM1b می­باشد (8 و 12). اعضای این خانواده در دو گروه اصلی لایف­گارد (Lifequard) و مهارکننده پروتئین Bax (1-BI-1/ Bax inhibitor) طبقه­بندی می­شوند (8). گروه پروتئینی لایف گارد شامل اعضای GRINA/Lfg-1، FAIM2/Lfg-2، RECS1/Lfg-3، GAAP/Lfg-4 و TMBIM1b/Lfg-5 می­باشند و گروه پروتئینی مهارکننده Bax (BI-1)  در شاخه مجزایی از درخت فیلوژنی قرار می­گیرد (8). وجه تشابه این گروهها علاوه بر ساختار و محل استقرار در نقش تنظیم کنندگی، در مکانیسم آپوپتوسیز می باشد و به گونه­ایی عمل می­کنند که مانع از مرگ برنامه­ریزی شده سلولی شده و از این طریق تعادل را در این مکانیسم ایجاد می­کنند. در رابطه با مکانیسمهای عملکردی این پروتئینها در مهار مرگ برنامه­ریزی شده سلولی، پروتئین BI-1 در پستانداران بر مهار آپوپتوسیز فعال شده از مسیر داخلیintrinsic apoptosis pathway نقش بسزایی دارد (3).  از میان پروتئینهای لایف­گارد، لایف­گارد-4 که محل استقرار آن دستگاه گلژی است، بیشتر مورد بررسی قرار گرفته و از این رو با نام (Golgi anti-apoptotic protein (GAAP)) نیز شناخته می شود (11). لایف­گارد-4 در مهار آپوپتوسیز نیز نقش دارد اما مکانیسمهای دقیق آن هنوز کشف نشده است (5). علاوه بر این، لایف­گارد­-4 از لحاظ تکاملی زودتر از اعضای دیگر این گروه جدا شده و دیگر اعضای لایف گارد از یک جد مشترک مستقل اشتقاق یافته­اند (10). همچنین لایف­گارد-­1 در بی­مهرگان گروه مجزایی را تشکیل می­دهد و از این رو تحت عنوان (( i-Lfg) lifeguard invertebrates) نام گذاری شده است (10).

با توجه به اینکه مکانیسم آپوپتوسیز در هیدر آب شیرین بسیار ثابت و بدون تغییر است و علاوه بر وجود تمامی پروتئینهای مؤثر در این مکانیسم، نقش عملکردی آنها نیز اثبات شده است، بنابراین، در این مطالعه برای اولین بار به شناسایی، استخراج و بررسی الگوی بیان ژنهای لایف­گارد (که نقش تنظیم­کنندگی مکانیسم آپوپتوسیز را دارند) در ابتدایی­ترین جانوران (هیدر آب شیرین) پرداخته شد تا از این طریق به بررسی دقیق­تر این مسیر مؤثر در تکوین پرداخته شود.

مواد و روشها

تکثیر هیدر آب شیرین (گونه Hydravulgaris) در محیط آزمایشگاهی: پولیپهای آب شیرین در محلولی شامل آب مقطر و املاح با غلظتهای  مشخص بر طبق روش استاندارد ندارد در ظرفهای استریل پرورش داده شد. دمای محیط به طور ثابت 18 درجه سانتی گراد بوده و کلیه پولیپها 24 ساعت قبل از استفاده برای آزمایشات بدون غذا نگهداری گردیدند. به منظور وارد کردن پولیپها به فاز تولید مثل غیر­جنسی (جوانه زدن)، 5 بار در هفته توسط آرتمیا  (Artemia nauplii) مورد تغذیه قرار گرفتند. پولیپهای هیدر آب شیرین 5 ساعت پس از تغذیه شسته و ظرفهای آنها یک بار در هفته تعویض گردید.  به منظور تحریک فاز تولیدمثل جنسی فقط یک بار در هفته پولیپها توسط آرتمیا تغذیه شدند و از این طریق بیضه و تخمدان در پایه­های مجزا شکل گرفتند. از آنجایی که سیستم عصبی پیشرفته در این جانوران وجود ندارد از لحاظ اخلاق زیستی ممانعتی برای انجام آزمایشات با این مدل وجود ندارد.

استخراج DNA، تعیین توالی و آنالیز مولکولی: با بلاست کردن پروتئینهای لایف­گارد انسانی در کل ژنوم هیدر آب شیرین، مشخص شد که سه توالی از پروتئین لایف­گارد به نامهای  لایف­گارد -4 ((Lfg-4 و دو هومولوگ از لایف­گارد-1 بی مهرگان (Lfg-1ia و Lfg-1ib) در هیدر وجود دارد.جهت تکثیر ژنهای مورد نظر، ابتدا استخراج DNA هسته­ایی با استفاده از کیت استخراج تجاری DNA به روش استاندارد انجام گردید (DNeasy Tissue Kit, Qiagen) ، حدود 100 پولیپ برای استخراج  DNA مورد استفاده قرار گرفت و با استفاده از پرایمرهای اختصاصی طراحی شده (جدول1)، واکنش زنجیرهای پلیمراز (PCR) طبق برنامه زمانی با سیکلهای حرارتی به ترتیب شامل: واسرشته شدن اولیه ((Denaturation در دمای 95 درجه سانتیگراد به مدت 4 دقیقه، 35 سیکل واسرشته شدن در دمای 95 درجه به مدت 30 ثانیه، مرحله اتصال ((Annealing به مدت 1 دقیقه در دمای ویژه برای هر ژن، و مرحله گسترش (Extention) در دمای 72 درجه برای یک دقیقه و سی ثانیه و مرحله گسترش نهایی در دمای 72 درجه به مدت 10 دقیقه تنظیم شد. پس از تعیین توالی، داده­های حاصل در نرم افزار Geneious R6 تصحیح و با سایر توالیهای مشابه موجود در بانک جهانی ژن (NCBI) همتراز گردیده و برای رسم درخت فیلوژنی مورد استفاده قرار گرفتند. درخت فیلوژنی از روش Neighbor Joining (NJ)  با استفاده از نرم افزار Geneious (Biomatters) و بوت استرپ سریع (10000  تکرار) انجام گردید.

 

جدول 1- لیست پرایمرهای استفاده شده در این تحقیق

Primer

Primer sequence

Lfg-4- Forward

GAA GGAAGT TTTTCTAAAAACGAACGAG

Lfg-4- Reverse

CTGGTGATAACTTATGAATCATCATATGTG

Lfg-1ia. Forward

GTGTACGCAATTCTTTTTTGTC

Lfg-1ia. Reverse

CTC AAGAATGTAAATAAATAACAGAC

Lfg-1ib. Forward

TTATAATGTTTTGGGCAGCATG

Lfg-1ib. Reverse

TTATATCAATGTACAAGTTCAATGC

 


هیبریداسون درجا با استفاده از دیگوکسیژنین: پس از تکثیر ژنهای لایف­گارد، توالی به دست آمده بر اساس پروتکل در وکتور pBluescriptII متعلق به شرکت  Fermentas  کلون شدند و به عنوان الگوی DNA برای تهیه پروب هیبریداسیون درجا استفاده شدند. هیبریداسیون درجا با استفاده از دیگوکسیژنین که یک نشانگر ایمنوهیستو- شیمیایی است صورت گرفت. این روش یک تکنیک بسیار قابل اعتماد است که در آن از DNA توالی مکمل نشاندار شده به عنوان پروب استفاده می شود. پروب نشاندار شده با توالی mRNA ژن مورد نظر در بافت هیبرید می شود و با دادن سیگنال در سلول یا بافتی خاص، به عنوان تأییدی برای بیان ژن مورد نظر در آن منطقه به کار می­رود. در این آزمایش پروب ژنهای لایف­گارد، توسط دیگوکسیژنین نشاندار شدند و پس از انجام واکنشها در طی آزمایش، با ایجاد رنگ آبی تیره محل بیان ژن مورد نظر در هیدر مشخص گردید. جزئیات مراحل انجام آزمایش هیبریداسیون درجا بر اساس پروتکل استاندارد (4) صورت گرفت.

نتایج

نتایج بررسی این توالیها نشان داد که این سه ژن به صورت کاملاً تثبیت شده و با ساختار مارپیچی آلفا در هیدر وجود دارد. ساختار آبگریز آنها نشان دهنده استقرار این پروتئینها بر روی غشای سلولی است (شکل 3).

 

 

شکل3- ساختار شماتیک پروتئینهای لایف­گارد با ساختار مارپیچی آلفا. ساختار پروتئینی شامل هفت لوپ و مارپیچ عبور کننده از عرض غشاء برای لایف­گارد 4، و دو هومولوگ لایف­گارد 1 در بی­مهرگان توسط برنامهTMHMM (http://www.cbs.dtu.dk/services/TMHMM)  پیش بینی شده است. مقیاس: 20 اسید امینه.

 

همچنین، تجزیه و تحلیل فیلوژنتیک بر پایه درخت فیلوژنی برای پروتئینهای محافظ سلولی در مهره­داران و بی­مهرگان به دست آمد (شکل 4). بر اساس نتایج به دست آمده، مشخص شد که دو شاخه مجزا متعلق به خانواده های پروتئینیlifeguard  و Bax-inhibitor-1 وجود دارد. در میان اعضای مختلف در شاخه lifeguard، لایف گارد-4 (Lfg-4) زودتر از دیگر اعضای این خانواده تکامل پیدا کرده است. توالیهای لایف گارد-­4 استخراج شده از هیدر آب شیرین با لایف گارد-­4 شقایق دریایی، یک گروه خواهری را ایجاد می­کنند. دو هومولوگ Lfg-1ia وLfg-1ib در هیدر، با دیگر گونه­های جانوری بی­مهره در گروه لایف­گارد-1 بی مهرگان قرار می­گیرند. دیگر اعضای خانواده لایف­گارد مانندLfg-2  ، Lfg-3وLfg-5 در گونه­های جانوری رده های بالاتر یافت می شوند و هر یک از این پروتئینها با اعضایشان در گروههای مختلف، در شاخه مستقلی قرار می­گیرند.

 

 

شکل4- درخت فیلوژنی پروتئینهای تنظیم کننده آپوپتوسیز (lifeguard (LFG) and Bax-Inhibitor (BI-1)). درخت فیلوژنی بر اساس (Clastal W) هم تراز شده  و از روش (Neighbor Joining, NJ) با استفاده از نرم افزار Geneious (Biomatters) و بوت استرپ سریع (10000 تکرار) ترسیم گردیده است.

 

نتایج بررسیها با انجام آزمایش هیبریداسیون درجا مشخص کرد که پروتئین لایف گارد-­4 (4 (Lfg- در تخمدان پولیپ ماده بیان می شود (شکل c5). بر خلاف روند تخمک­زایی، بیان این پروتئین در بیضه جنس نر و اسپرم­زایی دیده نشد (شکل b وc5). بررسیها در زمان تولید مثل غیر جنسی هیدر (جوانه زدن)،  مشخص کرد که پروتئین لایف­گارد-­4 (4 (Lfg-، در لایه اندودرم پولیپها بیان می شود و بیان آن در لایه اکتودرم دیده نمی­شود. به عبارت دیگر،  بیان ژن لایف­گارد-­4 در لایه اندودرمی، در مراحل مختلف جوانه زدن مشاهده می شود و در بازوهای هیدر سیگنال مربوط به بیان ژن لایف­گارد-­4 دیده نمی­شود (شکل F-D5).

 

شکل5- هیبریداسیون درجا برای ژن لایف گارد=­4. a، بیان ژن لایف گارد-4 در پولیپ بدون جوانه و ساختارهای تولید مثل جنسی. b، پولیپ نر با دو بیضه بارز. c، پولیپ دو­جنسی با بیضه­ها که با فلشهای مشکی نشان داده شده و تخمدان با فلش قرمز. d، e و f، نشان دهنده مراحل مختلف جوانه زدن هیدر است. مقیاس:  (a, b, c) 200 µm; (d, e, f) 100 µm .

بررسیهای بیشتر بر روی این پروتئین در زمان تولید مثل جنسی پولیپ ماده و مراحل مختلف تخمک­زایی در تخمدان، مشخص نمود که علاوه بر بیان این پروتئین در لایه اندودرم، پروتئین لایف­گارد-4 در تمامی مراحل تخمک­زایی بیان می شود  (شکل 6).

 

شکل 6- هیبریداسیون درجا برای ژن لایف گارد­-4 در مراحل مختلف تخمک­زایی پولیپ ماده. a، بیان ژن لایف گارد-4 در پولیپ ماده که به تازگی وارد فاز تولیدمثل جنسی شده. b و c، مراحل پیشرفته تر تخمک­زایی در پولیپ ماده. E، تخمک بالغ. مقیاس: (a, b, c) 200 µm, (d) 150 µm

در این مطالعه دو هومولوگ از لایف­گارد­-1 بی­مهرگان (Lfg-1ia و Lfg-1ib) موجود در هیدر نیز بررسی شدند اما با وجود تکرار آزمایشات، به غیر از بیان سیگنالهای غیر­تخصصی در نواحی اطراف دهان و پا، بیان ویژه­ایی از این پروتئینها در فاز جنسی و غیر­جنسی دیده نشد (شکلهای7 و 8).

 

 

شکل 7- هیبریداسیون درجا برای لایف گارد­-1 بی مهرگان (Lfg-1ia)  در فاز تولید مثل غیرجنسی (b وa) . فاز تولید مثل جنسی (d وc). e، تخمک بالغ.  مقیاس: (a,b) 200 µm, (c,d) 150 µm and (e) 200 µm.

 

شکل 8- هیبریداسیون درجا برای لایف گارد­­-1 بی­مهرگان (bLfg-1i) در فاز تولید مثل غیرجنسی (b وa)  و در فاز تولید مثل جنسی (d وc). e، تخمک بالغ.  مقیاس: (a, b) 200 µm, (c, d) 150 µm and (e) 200 µm.


بحث

در این مطالعه برای اولین بار مشخص گردید که ژنهای خانواده پروتئینی لایف­گارد در هیدر آب شیرین که ساده­ترین جانور حقیقی (متازوآ) می­باشد، وجود دارند. بررسیهای بیشتر و مقایسه توالیهای استخراج شده با دیگر گروههای جانوری مشخص نمود که این سه توالی، متعلق به خانواده لایف­گارد-4 ((Lfg-4 و دو هومولوگ از لایف­گارد- 1بی مهرگان Lfg-1ia و Lfg-1ib می­باشند. مقایسه روابط فیلوژنتیکی این پروتئینها در درخت تکاملی نشان می­دهدکه اعضای این خانواده از لحاظ تکاملی دارای ثبات زیادی بوده (conserve protein)  و توالی آنها در طول تکامل موجودات تغییر اندکی داشته است. این یافته­ها نشان دهنده ثبات توالی ژنی پروتئینهای لایف­گارد در هیدر آب شیرین می­باشد و مطالعات بیشتر در رابطه با این پروتئینها می تواند مشخص کننده نقش عملکردی آنها در محافظت از سلول در مقابل مکانیسمهای مرگ برنامه ریزی شده سلولی است.

 از آنجایی که در تمامی فازهای سیکل زندگی هیدر شیرین (تولید مثل جنسی و غیر­جنسی)، بیان ژن لایف­گارد -4 در لایه اندودرم دیده می شود، بنابراین می­توان نتیجه­گیری کرد که در مراحل مختلف از شروع جوانه زدن تا مرحله نهایی و کامل شدن جوانه جدید، ژن لایف گارد-4 بیان می شود.

ژن لایف­گارد-4 تحت عنوان پروتئین ضد آپوپتوسیز گلژی نیز تعریف شده است و علاوه بر این از آن تحت عنوان ژن محافظ سلول (cytoprotective) نیز نام برده شده است (5). از آنجایی که مکانیسم مرگ برنامه­ریزی شده سلولی کاملاً در مراحل مختلف تخمک­زایی هیدر اثبات شده است (11)، از این رو بیان ژنهای تنظیم کننده و مؤثر در مکانیسم آپوپتوسیز، مانند ژن لایف­گارد در مراحل تخمک­زایی هیدر منطقی به نظر می­رسد. در واقع وجود ژنهای لایف­گارد کمک می کند تا تعادلی میان حفظ و مرگ سلول ایجاد شود. هرچند مکانیسم دقیق عملکرد ژن لایف­گارد-­4 در تنظیم آپوپتوسیز شناخته شده نیست اما آزمایشات مختلف نشان داده است که این پروتئین به طور چشمگیری در کاهش مرگ سلولی تحریک شده توسط محرکهای داخلی، نقش دارد (5).

از آنجایی که پروتئینهای حفاظت کننده سلولی (لایف گارد ) در انسان بسیار مورد بررسی قرار گرفته اند و نقش حفاظتی آنها در برابر آپوپتوسیز اثبات شده است بنابراین، این مطالعه با مشخص نمودن وجود این پروتئینها در جانوران ساده مثل هیدر آب شیرین، کمک بسیاری برای مطالعات تکاملی و نقش تکوینی این مسیرهای سیگنالی از جانوران ابتدایی تا پیشرفته می کند. علاوه بر این، یافته­های این مطالعه نشان دهنده ثبات توالی ژنی پروتئینهای لایف­گارد در هیدر آب شیرین می­باشد و احتمالاً نقش عملکردی آنها در محافظت از سلول در مقابل مکانیسمهای مرگ برنامه­ریزی شده سلولی است.

1- Böttger A, Alexandrova O. 2007. Programmed cell death in Hydra, Seminars in Cancer Biology. 17:134–146.

2- Bosch TC and David CN. 1984. Growth regulation in Hydra: relationship between epithelial cell cycle length and growth rate. Developmental Biology. 104:161–171.

3- Burns TF, El-Deir WS. 2001. Identification of inhibitors of TRAIL-induced death (ITIDs) in the TRAIL-sensitive colon carcinoma cell line SW480 using a genetic approach. Journal of Biological Chemistry. 276:37879–37886.

4- Grens A, Mason E, Marsh JL, Bode HR. 1995. Evolutionary conservation of a cell fate specification gene: the Hydra achaete-scute homolog has proneural activity in Drosophila. Development. 4027–4035.

5- Gubser C, Bergamaschi D, Hollinshead M, Lu X, Van Kuppeveld FJ, Smith GL. 2007. A new inhibitor of apoptosis from vaccinia virus and eukaryotes, PLoS Pathog. 3:e17 29.

6- Harcet M, Roller M, Cetkovic H, Perina D, et al. 2010. Demosponge EST Sequencing Reveals a Complex Genetic Toolkit of the Simplest Metazoans.Molecular Biology and Evolution. 27:2747–2275.

7- Hoffmeister S, Schaller H.C. 1985. A new biochemical marker for foot-specific cell differentiation in hydra. Developmental Biology. 194:453–461.

8- Hu L, Smith TF, Goldberger G. 2009.  LFG: a candidate apoptosis regulatory gene family. Apoptosis. 14:1255–1265.

9- Kuznetsov S, Lyanguzowa M, Bosch TB. 2001. Role of epithelial cells and programmed cell death in Hydra spermatogenesis. Zoology. 104:25–31.

10- Lasi M, Pauly B, Schmidt N, Cikala M, Stiening B, et al. 2010. The molecular cell death machinery in the simple cnidarian Hydra includes an expanded caspase family and pro- and anti-apoptotic Bcl-2 proteins. Cell Research. 20:812–825.

11- Technau U, Miller MA, Bridge D, Steeleb RE. 2003. Arrested apoptosis of nurse cells during Hydra oogenesis and embryogenesis.Developmental Biology. 260:191–206

12- Zhou J, Zhu T, Hu C , Li H,. Chen G. et al., Comparative genomics and function analysis on BI1 family. Computational Biology and Chemistry.2008; 32:159–162.