نوع مقاله: مقاله پژوهشی

نویسندگان

1 گروه زیست فناوری، دانشگاه سمنان

2 گروه زیست شناسی سلولی و مولکولی دانشگاه سمنان

چکیده

امروزه، بشر برای حل مشکلات صنایع دارویی، غذایی و شیمیایی، به سمت طبیعت و ترکیبات فعال زیستی روی آورده است. از جمله منابع این ترکیبات، متابولیتهای ثانویهی تولید شده توسط میکروارگانیسمهایی است که از مناطق بسیار سخت جداسازی شدهاند. هدف از این مطالعه، بررسی سویه‌های هالوتولرانت جدا شده از دریاچه حاج‌علی‌قلی‌خان با قابلیت‌های تولید متابولیت‌های ثانویه است. میکروارگانیسمهای نمکدوست و تحملکننده نمک مقاوم به نیکل، کادمیم، مس و کبالت از دریاچه حاجعلیقلیخان جدا شدند. توانایی ژنتیکی این جدایه ها برای تولید متابولیتهای ثانویه، با استفاده از تکثیر ژن‌های nrpS با آغازگرهای اختصاصی NS1/NS2، A3/A7 ارزیابی گردید. از غربالگری میکروارگانیسمهای دریاچه نمک به ترتیب 13% ، 5/19% ، 75/43 % و 7/3 % جدایهها از محیطهای کشت MGM، MH ، SWN LNSWNو 62/20 % از جدایهها از محیط بدون نمک نوترینت آگار بدست آمد. سنجش مقاومت به فلزات در جدایههای غربال شده از دریاچه نشان داد که بیشترین فراوانی جدایه‌ها در مقاومت به نیکل و حساسیت به فلز کادمیم است. نتایج تکثیر ژن‌های nrpS در جدایههای هالوتولرانت مقاوم به فلزات با دو جفت آغازگرهای اختصاصی 3 تا 7 قطعه DNA را نشان داد. حضور ژن nrpS در بین میکروارگانیسمهای نمک دوست نسبی و تحمل کننده نمک، ارتباط مستقیم بین مقاومت به فلزات سنگین و توانایی ژنتیکی تولید متابولیت‌های ثانویه را نشان می دهد.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Screening heavy metal resistant halotolerant strains producing non-ribosomal peptides

نویسندگان [English]

  • Fatemeh Shahrestani 1
  • shakiba Darvish Alipour 1

1 Dep Biotechnology, Semnan University

چکیده [English]

Todays, secondary metabolites from microorganisms have been to improve food, pharmaceutical and chemical industries . Extremophile microorganisms are one of the resources for the secondary metabolites. The heavy metal resistant halotolerants were isolated from Haj AliGholi Khan Salt Lake. The potential of the isolates for producing secondary metabolites were molecularly investigated by amplification of nrpS genes with specific primers A3/A7 and NS1/NS2. In the screening of Haj AliGholi Khan Lake microorganisms; 13% of isolates from MGM, 19.5% from MH, 43.75% from SWN, 3.7% from LNSWN and 20.62% from normal Nutrient agar were obtained. The halotolerant were highly resistant against Ni and highly susceptible to Cd. Three to 7 PCR products were identified from optimized PCR reaction of nrpS genes of heavy metal resistant halotolerant with specific primers. Existence of nrpS genes among halotolerant and semi- halophile microorganisms from Haj AliGholi Khan Salt Lake revealed a direct relation between heavy metal resistance and genetic potential for producing secondary metabolites.

کلیدواژه‌ها [English]

  • "Cadmium"
  • "Halotolerant"
  • " Heavy metal"
  • "Nickel"
  • "nrpS"

غربالگری جدایه‌های هالوتولرانت مقاوم به فلزات سنگین و تولیدکننده پپتیدهای غیرریبوزومی

فاطمه شهرستانی1، شمس‌الضحی ابوالمعالی2* و شکیبا درویش علیپور آستانه1

1 ایران، سمنان، دانشگاه سمنان، گروه زیست‌فناوری

2 ایران، سمنان، دانشگاه سمنان، گروه زیست‌شناسی

تاریخ دریافت: 14/7/96                تاریخ پذیرش: 16/11/96

چکیده

امروزه، بشر برای حل مشکلات صنایع دارویی، غذایی و شیمیایی، به سمت طبیعت و ترکیبات فعال زیستی روی آورده است. از جمله منابع این ترکیبات، متابولیتهای ثانویه تولید شده توسط میکروارگانیسمهایی است که از مناطق بسیار سخت جداسازی شده اند. هدف از این مطالعه، بررسی سویه‌های هالوتولرانت‌ جدا شده از دریاچه حاج‌علی‌قلی‌خان با قابلیتهای تولید متابولیتهای ثانویه است. میکروارگانیسمهای نمک‌دوست و تحمل‌کننده نمک مقاوم به نیکل، کادمیم، مس و کبالت از دریاچه حاج‌علی‌قلی‌خان جدا شدند. توانایی ژنتیکی این جدایه‌ها برای تولید متابولیتهای ثانویه، با استفاده از تکثیر ژنهای nrpS با آغازگرهای اختصاصی NS1/NS2، A3/A7 ارزیابی گردید. از غربال‌گری میکروارگانیسمهای دریاچه نمک به ترتیب 13 ، 5/19 ، 75/43  و 7/3 درصد جدایه‌ها از محیطهای کشت MGM، MH ، SWN  LNSWNو 62/20 درصد از جدایه‌ها از محیط بدون نمک نوترینت آگار به دست آمد. سنجش مقاومت به فلزات در جدایه‌های غربال شده از دریاچه نشان داد که بیشترین فراوانی جدایه‌ها در مقاومت به نیکل و حساسیت به فلز کادمیم است. نتایج تکثیر ژنهای nrpS در جدایه‌های هالوتولرانت مقاوم به فلزات با دو جفت آغازگرهای اختصاصی 3 تا 7 قطعه DNA را نشان داد. حضور ژنnrpS در بین میکروارگانیسمهای نمک دوست نسبی و تحمل کننده نمک، ارتباط مستقیم بین مقاومت به فلزات سنگین و توانایی ژنتیکی تولید متابولیتهای ثانویه را نشان می دهد.

واژه های کلیدی: فلزات سنگین، کادمیم، نیکل، هالوتولرانت، nrpS

* نویسنده مسئول، تلفن: 02331533197 ، پست الکترونیکی: s_abolmaali@semnan.ac.ir

مقدمه

 

امروزه افزایش تولید پسابهای کارخانجات و فاضلابهای شهری سبب رهاسازی ترکیبات آلی و معدنی، آلودگی آب و خاک شده است. از طرف دیگر فرآیندهای طبیعی مانند سیل، زلزله، آتشفشان نیز به این آلودگی افزوده است. با توسعه فناوریها، اخیراً فلزات سنگین مس، کبالت، نیکل، کادمیم، روی و سرب به عنوان مهم‌ترین آلاینده‌های پساب شناخته شده‌اند که با روند متعارف تصفیه فاضلاب قابل حذف نمی‌باشند(21). انباشت فلزات سنگین در گیاهان حاصل از خاکهای آلوده، هشدار دهنده‌ترین اثرات مضر فلزات بر سلامت انسان است (3 و 5). علی رغم سمیت فلزات سنگین برای اعصاب، کبد، استخوان برخی از این فلزات تا سطوح معینی برای رشد میکروارگانیسمها ضروری بوده و در مقادیر بالاتر از آن برای سلول سمی می‌باشند. کبالت، مس، نیکل و روی در تنظیم بیان ژن و فعالیت زیست ‌مولکولها،آنزیمها یا کوفاکتورهای آنزیم، نقش حیاتی دارند(19).

در چند دهه اخیر حذف فلزات سمی از فاضلابهای صنعتی به روشهای فیزیکی و شیمیایی تصفیه آب، اکسیداسیون و احیاء، رسوب شیمیایی، فیلتراسیون، روش الکتروشیمیایی، تبخیر، تبادل یونی و اسمز معکوس صورت گرفته است. نیاز به محلولهای قوی و حذف یونهای فلزی غیر قابل پیش‌بینی، برخی از معایب این روشها هستند. علاوه بر این، استفاده از محلولهای قوی برای پاکسازی فلزات سنگین، باعث آلودگی ثانویه محیط زیست می‌گردد(13). زیست پالایی با کمک میکروارگانیسمها می‌تواند به طور مؤثری باعث کاهش فلزات سنگین در محیط زیست گردد(15). توانایی میکروارگانیسمها برای حذف فلزات سنگین از محلولهای آبی، به ویژه در محدوده کمتر از 1 تا 100 میلی گرم، روش زیست‌پالایی را از دیگر روشهای پالایش متمایز می‌نماید(2). در دهه ‌اخیر، تحقیقات زیادی بر روی معرفی میکروارگانیسمهای توانا با توجه به دو ویژگی زیست‌پالایی و زیست‌سازگاری انجام گرفته و با توجه به همین خصوصیت مطالعات بسیاری برروی میانکنش میکروارگانیسمها با فلزات سمی در حال انجام است(19). در سال 2014 محمدزاده و همکاران در یک مطالعه توصیفی، از خاک آلوده به لجن فاضلاب مزارع مجاور تصفیه‌خانه غرب اهواز نمونه برداری کرده و باکتریهای مقاوم به کادمیم و نیکل را جداسازی و میزان تجمع زیستی و جذب زیستی نیکل و کادمیم توسط این باکتریها را مورد مطالعه قراردادند (18). در این مطالعه باکتریهای جداسازی شده به جنسهای Bacillus، Staphylococcus وActinomyceteتعلق داشتند که از این میان Actinomycete بیشترین مقدار تجمع زیستی را برای هر دو فلز نشان داد. در غلظتهای کمتر، مقدار تجمع زیستی کادمیم و نیکل بیشتر از جذب زیستی و در سطوح آلودگی بالا مقدار جذب زیستی بیشتر بود. در هر دو روش زیست پالایی، باکتریها توانایی بیشتری برای پالایش کادمیم نسبت به نیکل نشان دادند(18).

با توجه به اینکه میکروارگانیسمها تنوع زیادی در واکنشهای متابولیکی دارند مسیرهای متابولیت ثانویه و فراورده‌های تولید شده در میکروارگانیسمها، آنها را برای سازگاری در زیستگاههای اکولوژیکی متنوع و مقابله با تنشهای محیطی آماده می‌کند که این امر می‌تواند از جنبه‌های صنعتی مورد توجه قرار گیرد(5). در این موارد، اساسی‌ترین فرآیندی که سلولها در مقابله با فلزات سنگین به کار می‌برند تا به زیست‌پالایی بینجامد، هم بند کردن این کاتیونها با گروههای عاملی در سطح سلول و نیز هم بند کردن با پروتئینهای خاصی در درون سلول می‌باشد. اما تنوع ترکیبات و فلزات سمی از یک سو و تنوع میکروارگانیسمها از سوی دیگر باعث می‌شود که به روشهای دیگری نیز برای مقابله با فلزات و ترکیبات سمی در سلول توجه شود(8 و 17).

پپتیدهای پلی کتاید و پپتیدهای غیرریبوزمی دو دسته مهم از متابولیتهای ثانویه‌ای باکتریایی هستند که در تولید فراورده‌های بیولوژیک در میکروارگانیسم و تحمل شرایط سخت محیطی نقش مهمی ایفاء می‌کنند. این دسته از پپتیدها با ساختار متنوع که حاصل فعالیتهای آنزیمهای دستجات ژنیnrpS هستند، توانایی ترکیب با فلزات سنگین را دارند(9). آنزیمهای nrpS ترکیبات چند آنزیمی هستند که پروتئینهای اختصاصی با طیف گسترده فعالیتهای زیستی را از پپتیدهایی با ساختارهای متفاوت و وزن مولکولی کم، به روشی مستقل از نوکلئیک اسید می‌سازند. در این سازوکار غیرریبوزومی ساخت پپتید، ترکیباتی مانند لیپوپپتیدها، دپسی‌پپتیدها و پپتیدولاکتونها از پیش‌سازهایی شامل: اسیدهای چرب، آمینواسیدهای غیرپروتئینوژنیک، هیدروکسی آمینواسیدها، آمینواسیدها با نیتروژن متیله شده، شبه آمینواسیدها و D-آمینواسیدها ترکیب بندی می‌گردند(23). هدف از این مطالعه بررسی توانایی میکروارگانیسمهای مقاوم به فلزات سنگین نیکل، کبالت، کادمیم و مس غربال شده از دریاچه نمک حاج‌علی‌قلی‌خان برای تولید محصولات ژنهای nrpS بود. در این مطالعه میکروارگانیسمهای مقاوم به فلزات سنگین با توانایی تولید محصولات ژنهای nrpS معرفی شدند.‌

مواد و روشها

نمونهبرداری: نمونه‌برداری از نواحی مختلف جنوب غربی دریاچه نمک حاج‌علی‌قلی‌خان سمنان (موقعیت جغرافیایی N3550 تا N3600 و E5426 تا E5454) به صورت تصادفی انجام گرفت. نمونه‌ها شامل خاک، آب و نمک دریاچه بود که در محل نمونه‌برداری کدگذاری و در شرایط استریل به آزمایشگاه منتقل و برای کشت آماده شدند.

جداسازی میکروارگانیسمها: از نمونه‌های خاک و نمک، 1 گرم به 10 میلی‌لیتر سرم فیزیولوژی و از نمونه آب دریاچه 1 میلی‌لیتر به 9 میلی‌لیتر سرم فیزیولوژی اضافه شد.  نمونه‌های خاک، آب و نمک، در سری رقت های شامل 1- 10، 2- 10، 3- 10  هریک به صورت جداگانه به مدت دو ساعت در 200 دور در دقیقه گرماگذاری گردید. از مایع رویی آنها در محیط کشت نوترینت براث ­(مرک) با 3، 7، 10، 15 و 20 درصد کلرید سدیم (مرک) و محیطهای کشت (SWN) Sea water  Nutrient Agar  (10)، (MH ) Moderate  halophilic medium  (16)، (LNSWN) Low nutrient Modified halophilic medium ، MGM) ) Medium Modified Growth (24) به ترتیب با 2، 2،10 و 23 درصد کلرید سدیم کشت انجام و در فواصل زمانی 24 ساعت، 72 ساعت و 14 روز پس از انجام کشت اولیه، با روش کشت چهار مرحله‌ای، جداسازی و خالص شدند. جدایه‌های خالص شده درگلیسرول 20 درصد و در فریزر 70- درجه سلسیوس نگهداری شدند.

شناسایی جدایهها بر اساس ویژگیهای ریخت شناسی و بیوشیمیایی: بعد از خالص‌سازی میکروارگانیسمها، شناسایی هر یک از آنها برروی محیط کشت‌ جداسازی شده، بر‌ اساس ویژگیهای ماکروسکوپی شامل اندازه کلنی، شکل ظاهری، رنگ، سطح، حاشیه و جنس کلنی انجام گرفت. در مرحله بعد شناسایی بر اساس ویژگیهای میکروسکوپی شامل شکل میکروارگانیسم (میله‌ای، کروی، مارپیچی)، اندازه، نحوه قرار گرفتن میکروارگانیسمها در روی لام (مجتمع یا پراکنده وشکل اجتماع آنها)، نوع واکنش به رنگ‌آمیزی گرم، وجود اسپور، محل و شکل اسپور انجام شد. با آزمونهای حرکت، کاتالاز و اکسیداز، برخی از ویژگیهای بیوشیمیایی جدایه‌ها تعیین گردید. در بررسی فعالیت کاتالازی جدایه‌ها، از پراکسید هیدروژن 3 درصد و کشت جامد تازه میکروارگانیسم و برای بررسی فعالیت اکسیدازی، از محلول 1 درصد تترامتیل پارافنیلن دی‌آمین دی‌هیدروکلراید استفاده شد(10).

غربالگری بر اساس میزان تحمل نمک کلرید سدیم: برای تعیین هالوفیل یا هالوتولرانت بودن میکروارگانیسمها، هر یک از جدایه‌ها بر روی محیط با درصد کلرید سدیم کمتر یا بیشتر نسبت به محیط جداسازی خود، کشت شدند؛ بدین‌‌ترتیب که جدایه‌های حاصل از محیط MGM (23 درصد کلرید سدیم) روی محیط SWN (2 درصد کلرید سدیم) و برعکس و جدایه‌های حاصل از محیط MH (10 درصد کلرید سدیم) روی هر دو محیط مذکور کشت گردیدند.

غربالگری بر اساس مقاومت به فلز با روشهای لکهگذاری در محیط جامد و میکروپلیت: میکروارگانیسمهای مقاوم به 10 درصد تا 23 درصد کلرید سدیم (21 جدایه حاصل از جداسازی از محیط کشتهای MGM و MH) به منظور بررسی مقاومت به فلزات سنگین،  NiSO4. 6H2O, CdCl2. H2O, CoSO4. 7H2O, CuSO4. 5H2O  انتخاب گردیدند.

برای سنجش مقاومت جدایه‌ها به فلزات با روش لکه‌گذاری، (1) محیط کشت MH حاوی  فلزات نیکل، مس، کبالت و کادمیم،  با غلظتهای  5/0، 1، 2، 3، 5 ،7  و صفر میلی مولار تهیه شد. سپس با استفاده از رقتهای 3-10و  6-10 نیم مک‌فارلند  هر باکتری  در محیط MH  لکه‌گذاری به صورت نقطه‌ای انجام گرفت. پلیتها به مدت 36 ساعت در دمای 37 درجه سلیسیوس گرماگذاری شدند.

در روش (2) در هر چاهک از میکروپلیت، 200 میکرولیتر محیط کشت MH حاوی غلظتهای mM 5/0، 1، 12/3، 25/6، 5/12، 25، 50  اضافه گردید. 20 میکرولیتررقت
1-10 از OD نیم مک‌فارلند جدایه‌های حاصل از محیط کشت MGM و محیط کشت MH ، به محیط مایع تلقیح شدند. در این روش، فلز و محیط کشت بدون میکروارگانیسم، به عنوان شاهد منفی و محیط کشت حاوی میکروارگانیسم بدون فلز به عنوان شاهد مثبت در نظر گرفته شدند. میکروپلیتها حاوی هر جدایه به مدت 36 ساعت در دمای 37 درجه سلیسیوس گرماگذاری شدند(1).

استخراج DNAژنومی و بررسی وجود ژن nrpS به روش واکنش زنجیره‌ای پلیمراز: استخراج DNA از جدایه‌ها با استفاده از کیت DNP TM KIT از شرکت سیناژن طبق روش ارائه شده در کیت انجام شد.   DNA   استخراج شده با تیمارRNAse A   خالص گردید. بررسی وجود ژن nrpS به وسیله واکنش زنجیره‌ای پلیمراز و با کمک آغازگرهای اختصاصی (جدول1) انجام شد. اجزا واکنش شامل 1 نانوگرمDNA  الگو، بافر 1X،mM  (2-5/1) MgCl2،  mM (25/0) dNTP،mM  25/0 از هر پرایمر (جدول 1) و 1 واحد آنزیم Taq Polymerase درحجم نهایی 25 میکرولیتر بود. واسرشتگی اولیه در دمای 95 درجه سانتی گراد به مدت 5 دقیقه با کمک دستگاه ترموسایکلر مدلLabcycler (SensoQuesT)  انجام شد. تکثیر در 35 چرخه شامل: واسرشتگی در دمای 95 درجه سانتی گراد به مدت 30 ثانیه، جفت‌شدگی در دمای 56-45 درجه سانتی گراد به مدت 40 ثانیه و طویل سازی در دمای 72 درجه سانتی گراد به مدت 1 دقیقه انجام گرفت. مرحله طویل شدن نهایی نیز در دمـای 72 درجه سانتی گراد به مدت 10 دقیقه انـجـام شد .در نـهایـت مـحصـول واکنش زنجیره‌ای پلیمراز به روش الکتروفورز با استفاده از ژل آگارز 8/0 درصد بررسی گردید. شرایط واکنش زنجیره‌ای پلیمراز با کمک غلظتهای متفاوت MgCl2 شامل 5/1، 8/1 و 2 میلی مولار و دماهای جفت شدگی 47، 51، 53، 55، 57 درجه سانتی گراد در هر مورد بهینه‌سازی گردید.

 

جدول 1- مشخصات پرایمر مورد استفاده

Ref

Annealing (ºc)

temp (˚C)

Sequence (5'-3')

Genes

Primer ID

(4)

60

GCSTACSYSATSTACACSTCSGG

nrpS

A3

SASGTCVCCSGTSCGGTAS

nrpS

A7

(27)

64-52

CAACCCCTATGCCTTTTGAA

nrpS

NS1

TAAACAACCCATGCTCCACA

nrpS

NS2


آنالیز داده‌ها: تجزیه وتحلیل آماری، نتایج این پژوهش با کمک نرم افزار SPSS22 انجام گرفته و میزان 05/0 >  p به عنوان تفاوت آماری معنی دار در نظر گرفته شد.

نتایج

جداسازی میکروارگانیسمها: از محیط کشت MGM، 20 جدایه؛ MH، 31 جدایه؛SWN ،  70 جدایه؛LNSWN ، 6 جدایه و NA بدون کلریدسدیم 33 جدایه خالص سازی گردید. زمان رشد میکروارگانیسمها در محیطهای SWN،LNSWN  و NA 1-2 روز، در محیط MH بین 2-3 روز و در محیط MGM بین 2 تا 10 روز بود.

مشاهدات ماکروسکوپی جدایه‌های غربال شده نشان داد که کلنیها رنگهای بی‌رنگ، شیری، مایل به قهوه‌ای و صورتی مایل به قرمز داشتند. پیگمان قرمز اغلب در جدایه های حاصل از محیط MGM مشاهده شده است و اندازه کلنیها از بسیار کوچک (با قطر حدود 1 میلی‌متر) تا بزرگ (قطر حدود 1 سانتیمتر) متغیر بود. شکل کلنیها به صورت دایره‌ای با حاشیه منظم/ غیرمنظم، ریزوئیدی/ جوانه­دار، سطوح کلنی برجسته صاف/ چروکیده، سطوح فرورفته بود. قوام کلنی‍ها حالتهای متفاوت جامد، سفت، لزج وکشسان داشت.

ویژگیهای ریخت‌شناسی جدایهها: براساس نتایج بررسیهای میکروسکوپی حدود 90 درصد جدایه‌ها باسیل گرم مثبت و 10 درصد باقیمانده شامل باسیلهای گرم منفی، کوکسی‍های گرم مثبت، گرم منفی و Actinomycete بودند. حدود 5 درصد جدایه‌ها دارای اسپور (مرکزی، انتهایی و نیم انتها) با اندازه بزرگ‌تر از سلول و برخی نیز هم‌اندازه سلول بودند.

20 درصد سویه‌های جدا شده از محیط کشت MGM، کاتالاز منفی و 80 درصد کاتالاز مثبت بودند. همه میکروارگانیسم‍های جدا شده از محیط کشت MH کاتالاز مثبت بودند. 10 درصد سویه‌های جدا شده از محیط کشت MGM، با افزودن محلول آزمون اکسیداز، تغییر رنگ نشان ندادند.80 درصد سویه­ها تغییر رنگ شدید به بنفش را نشان دادند (اکسیداز قوی) و در 10 درصد دیگر، رنگ کلنیها کمی مایل به بنفش دیده شد (اکسیداز ضعیف). در مورد سویه‌های جدا شده از محیط کشت MH، 42 درصدمیکروارگانیسمها در پاسخ به معرف اکسیداز تغییر رنگ ندادند (اکسیداز منفی)، 6 درصد سویه‌ها دارای اکسیداز قوی و در 52 درصد رنگ کلنی‍ها کمی مایل به بنفش شد (اکسیدازمثبت).

بررسی مقاومت به فلز جدایه ها: در سنجش مقاومت به فلز تمامی جدایه‌های محیط  MGM که ازنظر مورفولوژی وخصوصیت بیوشیمیایی یکسان نبودند، بررسی شدند. نتایج نشان داد که  در روش میکروپلیت،  بیشترین مقاومت را نسبت به فلز نیکل و بیشترین حساسیت را نسبت به فلز کادمیم نشان دادند. بیشترین غلظتی که میکروارگانیسمها در آن رشد کردند برای فلز نیکل mM 6 و برای فلزات کبالت، کادمیم و مس به ترتیب 3، 5/0 و mM 5/0 بود. همان‌طور که در تصویر 1 مشاهده می‌شود، در این روش تعداد میکروارگانیسمهایی که در غلظت mM 5/0 فلز مس رشد کردند بیشتر از کادمیم بود (تصویر1).

 

 

تصویر1- نتایج بررسی مقاومت به فلزات نیکل، کبالت، مس و کادمیم به روش میکروپلیت. جدایه‌ها حداکثر mM 6 فلز نیکل،  Mm3 فلز کبالت، mM 5/0 مس و کادمیم را تحمل کردند. برای وضوح بهتر تصویر شناسه جدایه‌ها فقط با شماره و بدون شاخص کلکسیون؛ DDBCC، نشان داده شده است.

 

بررسی مقاومت جدایه‌های هالوتولرانت نسبت به فلز نیکل با روش لکه­گذاری در محیط جامد نشان داد که 10 درصد جدایه­ها حداکثر 3میلی­مولار، 30 درصد جدایه­ها 2 میلی­مولار، 5 درصد جدایه­ها 1 میلی­مولار، 5 درصد جدایه­ها 5/0 میلی­مولار از فلز نیکل و 20 درصد جدایه‌ها هیچ غلظتی از فلز را تحمل نکردند. در بررسی مشابه نسبت به فلز کبالت، 25 درصد جدایه­ها غلطت 3 میلی‌مولار، 5 درصد جدایه‌ها غلظت 2 میلی‌مولار، 25 درصد جدایه‌ها غلظت 1 میلی‌مولار، 10 درصد جدایه غلظت 5/0 میلی­مولار، 5 درصد جدایه‌ها نسبت به فلز کبالت حساس بودند. این در حالی است که این جدایه‌ها نسبت به فلز کادمیم در هیچ غلظتی رشد نداشتند ولی نسبت به فلز مس، 25 درصد جدایه‌ها غلظت 2 میلی‌مولار، 25 درصد جدایه‌ها غلظت 1 میلی‌مولار، 20 درصد جدایه‌ها غلظت صفر را تحمل کردند و 30 درصد سویه‌ها عدم رشد را نشان دادند. نتیجه این آزمایش برای یک جدایه مقاوم به فلز نیکل، کبالت، مس و حساس به کادمیم و یک جدایه حساس به فلزات کبالت، مس و کادمیم و نسبتاً مقاوم به نیکل، در تصویر 2 نشان داده شده است. جدایه شماره 151 روی محیط کشت حاوی فلزات نیکل و کبالت تا حدود 3 میلی‌مولار رشد ضعیفی داشت. این جدایه حداکثر روی 2 میلی‌مولار مس رشد داشت اما قادر به رشد برروی محیط کشت حاوی کادمیم نبود. جدایه شماره 11 فقط برروی محیط حاوی 2 میلی‌مولار نیکل رشد کرد. رشدی از این جدایه برروی محیطهای دارای 5/0 و یا 1 میلی‌مولار کبالت، مس، کادمیم مشاهده نشد.

 

 

تصویر 2- نتایج غربالگری جدایه‌ها به روش لکه گذاری، (الف) جدایه 151 مقاوم نسبت به فلزات نیکل، کبالت و مس؛ (ب) جدایه11 نسبتاً مقاوم به نیکل و حساس به کبالت، مس و کادمیم.


نتایج بررسی وجود ژن nrpSبا استفاده از واکنش زنجیره‌ای پلیمراز: تکثیر با کمک آغازگرهایNS1  و NS2 و دمای جفت شدگی 50 درجه سانتی گراد و غلظت منیزیم 2 میلی مولار، وجود قطعات ژنی با اندازه بین 400 تا 1500 جفت بازی را در جدایه‌های 5، 11، 130، 133، 138، 144و 151 نشان داد. در اغلب جدایه‌ها قطعه DNA بین800 تا 900 جفت بازی ظاهر گردید (تصویر 3).

 

 

تصویر3- نتایج تکثیر ژنهایnrpS : الف) با استفاده از جفت آغازگرهایA3/A7 ؛ ب) با استفاده از جفت آغازگرهای NS1/NS2.  مسیرها با شماره جدایه‌ها مشخص گردیده‌اند. مسیرM نردبان مولکولی bp50.

 

براساس نتایج تیمارهای بهینه‌سازی شرایط واکنش زنجیره ای پلیمراز با استفاده از غلظتهای  mM2، 8/1و 5/1 از MgCl2 بیشترین تعداد قطعاتDNA  در شرایط MgCl2 mM2 مشاهده گردید. تیمار MgCl2 mM2 تغییر دمای جفت‌شدگی از 47 درجه سانتی گراد تا 53 درجه سانتی گراد تاثیری بر تعداد قطعات DNA به دست آمده نداشت.

بحث و نتیجه گیری

میکروارگانیسمهای قابل کشت دریاچه نمک سمنان در مقایسه با جامعه میکربی سهم کمتری را شامل می‌شود. این پژوهش برروی گروههای قابل کشت انجام شده و پیش از این نیز پژوهشی بر روی میکروارگانیسمهای غیرقابل کشت این دریاچه انجام نگرفته است. ابعاد مورد مطالعه در پژوهشهای بوم شناختی به بازده تعداد میکروارگانیسمهای غربال شده از روشهای کشت، اندازه‌های فیزیکی میکروارگانیسمها، گستردگی فضاهای مورد بررسی و نیز تعداد نمونه برداری وابسته است. به همین دلیل در میکروب شناسی در روشهای مستقل ازکشت، تنوع گونه‌های شناسایی شده مورد بحث است، و نسبت دادن آن به تنوع موجود و جامعه اصلی میکربی از نظر آماری صحیح نمی‌باشد(26).

دریاچه نمک حاج علی قلی خان سمنان از نظر موقعیت جغرافیایی در جنوب شرقی شهر دامغان واقع شده است .2391 کیلومتر مربع مساحت و بین 1050 تا 1094 متر از سطح دریا ارتفاع دارد. آنالیز نمونه‌های خاک آن وجود یونهای سدیم و کلر و آلودگیهای فلزی از قبیل کادمیم؛ نیکل و سرب را تأیید کرده است. بنابراین غربال‌گری مقاومت فلزی کادمیم و نیکل در این پژوهش انتخاب شدند. اگرچه به دلیل شرایط سخت در بوم این ناحیه تعداد باکتریها و تنوع آنها به ازای هر گرم خاک کاهش داشته است، بخش اعظم میکروارگانیسمهای این ناحیه به جنسهای مقاوم باکتریایی از جمله Bacillus sp و سپس Actinomyceteشباهت دارند.

در پژوهش حاضر، در غربالگری میکروارگانیسمهای دریاچه حاج‌علی‌قلی‌خان به ترتیب (20جدایه) 13 درصد، (31 جدایه) 5/19 درصد، (70 جدایه) 75/43 درصد و (6 جدایه) 7/3 درصد جدایه ها از محیطهای کشت MGM، MH، SWN، LNSWN و (33 جدایه) 62/20 درصد از جدایه‌ها از محیط بدون نمک نوترینت آگار به دست آمد، در مجموع  160 جدایه رشد کردند که با حذف جدایه‌های مشابه از نظر خصوصیت مورفولوژی و بیوشیمیایی در نهایت 21 جدایه برای مراحل بعدی آزمایش انتخاب گردید. جدایه‌های مذکور از دو نوع میکروارگانیسم باکتری و قارچ بودند. بیشترین فراوانی مربوط به باکتریها است، که در گروه باسیلهای گرم مثبت قرار می‌گیرد. مشابه این نتیجه در بررسی میکروارگانیسمهای دریاچه آران و بیدگل و دریاچه ارومیه نیز به دست آمده است. در بررسی تنوع زیستی میکروارگانیسمهای نمک‌دوست و تحمل کننده نمک توسط آموزگار و همکاران، از 217 جدایه، 120جدایه باسیل گرم مثبت، 48 جدایه باسیل گرم منفی و بقیه کوکسی گرم مثبت بودند(11 و 16). در بررسی باکتریهای سخت‌زی تالاب گمیشان توسط شاهین‌پی و همکاران (1392)، نیز از بین 224 باکتری جداسازی شده، باسیلهای گرم مثبت با 131 جدایه بیشترین فراوانی را داشتند. باسیل گرم منفی با 54 جدایه، اشکال خمیده گرم منفی با 32 جدایه و کوکوسهای گرم مثبت با 7 جدایه به ترتیب در رتبه‌های بعد قرار داشتند(22).

نتایج پژوهش حاضر نشان داد که میکروارگانیسمهای هالوتولرانت جداشده از محیطهای 10 و 23 درصد نمک به دلیل توانایی تحمل محیطهای سخت توانستند نسبت به فلزات سنگین مقاومت بیشتری نشان دهند. در صورتی که میکروارگانیسمهای جداشده از محیط 2 درصد نمک و یا کمتر چنین ویژگی را بروز ندادند. سنجش مقاومت به فلزات در جدایه‌های غربال شده از دریاچه نمک حاج‌علی‌قلی‌خان نشان داد که جدایه ها در مقاومت به نیکل و حساسیت به فلز کادمیم، بیشترین فراوانی را دارند. بعد از نیکل بیشترین مقاومت مربوط به فلز کبالت و سپس مس بود. اگر فراوانی رشد جدایه‌ها در غلظتهای مختلف شاخص مناسبی برای تعیین حساسیت و مقاومت به فلز در میکروارگانیسمها باشد، با مقایسه درصد فراوانی رشد جدایه‌ها در غلظت 1 میلی مولار و بیشتر فلزات نیکل، کبالت، مس و کادمیم می‌توان نتیجه گرفت که میکروارگانیسمهای جدا شده از محیط­کشت MH بیشترین مقاومت را به فلزات نیکل و کبالت و بیشترین حساسیت را به فلزات کادمیم و مس نشان داده‌اند. مشابه نتایج فوق توسط گابالا و همکاران در سال 2003 به دست آمد. مطابق آزمایشات گابالا با استفاده از پنج فلز  Cd, Cu, Zn , Ni و Co و در شیب غلظتی 5/0 تا 10 میلی مولار برروی 22 گونه؛ بیشترین مقاومت نسبت به فلز نیکل، بیشترین سمیت نسبت به فلز کادمیم بود و تقریبا 50 درصد گونه‌ها به کادمیم حساس بودند(7).

در پژوهشی که توسط خدابخش و همکاران انجام شد، مقاومت باکتری نمک دوست  Salinovibrio costicolaجدا شده از دریاچه آران و بیدگل نسبت به فلزات سنگین نیکل، کبالت، مس، کادمیم، سرب، نقره و روی سنجیده شد (14). باکتری Salinovibrio costicola بیشترین مقاومت را به ترتیب نسبت به فلزات نیکل (mM 11)، کبالت (mM 8) ، سرب (mM 8)، مس (mM2)، کادمیم (mM 5/0)، روی (mM 1/0) و نقره (mM 05/0) نشان داد. در مورد ترتیب مقاومت به فلزات نیکل، کبالت، مس و کادمیم نتایج، مشابه پژوهش حاضر است(14).

با توصیف این نکته که پپتیدهای غیرریبوزومی، جزء متابولیتهای ثانویه میکروارگانیسمها به شمار می‌آیند و از نظر ساختار و عملکرد بسیارمتنوع هستند(25)، شواهد نشان می‌دهد که تولید متابولیتهای ثانویه پاسخی به تنشهای محیطی از جمله تنش فلزات سنگین می‌باشد(9). در این پژوهش تنوع کمی و کیفی ژن nrpS مسئول رمزگذاری آنزیم سنتزکننده پپتیدهای غیرریبوزومی به عنوان شاخصی برای توانایی میکروارگانیسم در تولید ترکیبات ثانویه و احتمالا" مقاومت نسبت به فلزات سنگین مورد مطالعه قرار گرفت. برای ارزیابی حضور ژن nrpS در بین میکروارگانیسمهای نمک دوست نسبی و تحمل کننده نمک، غربال شده از دریاچه نمک حاج‌علی‌قلی‌خان، دو جفت آغازگر (27) NS1/NS2 و A3F/A7R استفاده شد (4). این آغازگرها هردو مربوط به نواحی حفاظت شده دمین A هستند(12). انتخاب این دو جفت آغازگر با هدف شناسایی تعداد بیشتری از این ژنها در تعداد زیادتری از میکروارگانیسمهای جدا شده از دریاچه نمک انجام گرفت. تنوع قطعات DNA حاصل از تکثیر ژنهای nrpS در پژوهشهای انجام شده توسط ساکیدو و همکاران (4) و ایرن‌قایش و همکاران (6) نشان داده است که قطعات 900، 900 تا 1000 ،700 و 800 جفت بازی با استفاده از آغازگرهای  A3/A7،MTR/MTF2 از ژنوم Cyanobacteria و  Actinomycetesتکثیر یافته‌اند. در این پژوهش که با استفاده از آغازگرهای اختصاصی NS1/NS2 برای  بررسی حضور ژنهای nrpS انجام گرفت، نتایج نشان داد که جدایه‌هایی که می‌توانستند غلظت بالاتری از فلزات سمی را تحمل کنند، تعداد قطعات تکثیریافته بیشتری داشتند.

در تأیید این نتایج، بررسی نوردن‌جل  برروی Actinomycetes نشان داد تعداد قطعات DNA ظاهر شده در واکنش تکثیر ژنهای nrpS ، با تعداد ترکیبات ظاهر شده نسبت مستقیم دارد (20). اما نوع متابولیتهای ثانویه بسته به نوع باکتری و محل زیست آن متفاوت و متنوع است که نوع و عملکرد این ترکیبات ثانویه بایستی با آزمایشات شیمیایی و زیستی مختلف تعیین گردد. تعداد قطعات DNA حاصل از تکثیر ژنهای nrpS می‌تواند مؤید حضور آنزیمهای مختلف در این گروه باشد که هریک نقشی در تکمیل ساخت متابولیت ثانویه دارند، لذا تعداد بیشتر قطعات DNA نمایانگر تعداد بیشتر آنزیم و تعداد بیشتر آنزیم مؤید ساخت تعداد ترکیبات ثانویه بیشتر است(20). بررسیهای مولکولی وغربال‌گری مقاومت به فلزات‌ سنگین در این پژوهش نشان داد که بین توانایی ژنتیکی تولید پپتیدهای غیرریبوزومی و مقاومت به فلز سنگین ارتباط مستقیم وجود دارد.

نتایج این پژوهش نشان داد که میکروارگانیسمهای هالوتولرانت جداشده از محیطهایMH  وMGM  نسبت به فلزات سنگین در محیط مقاومت بیشتری داشتند. بنابراین می‌توان حضور فلزات سنگین، را نیز عامل القای ژنهای خاموش مربوط به ساخت متابولیتهای ثانویه دانست. با توجه به اینکه پپتیدهای غیرریبوزومی، جزء متابولیتهای ثانویه در میکروارگانیسمها به شمار می‌آیند و از نظر ساختار و عملکرد متنوع هستند. در این پژوهش تنوع ژن nrpS، مسئول رمزگذاری آنزیم سنتزکننده پپتیدهای غیرریبوزومی، به عنوان شاخص برای توانایی میکروارگانیسمها در تولید ترکیبات ثانویه و احتمالا" مقاومت نسبت به فلزات سنگین مورد استفاده قرار گرفت.حضور ژن nrpS در بین میکروارگانیسمهای نمک دوست نسبی و تحمل کننده نمک، ارتباط مستقیم بین مقاومت به فلزات سنگین و توانایی ژنتیکی تولید متابولیتهای ثانویه را نشان می دهد. به بیان جزئی‌تر، می‌توان از این میکروارگانیسمهای هالوتولرانت مقاوم به فلزات سنگین برای اهداف زیست‌پالایی بهره برد، در حالی که آنها به عنوان یک مزرعه تولید متابولیتهای ثانویه هم کاربرد دارند.

تشکر و قدردانی

این پژوهش با حمایت معاونت پژوهشی دانشگاه سمنان انجام شد. از آقای دکترعلیرضا اصغری برای همکاری در بررسی جذب اتمی انجام شده در دانشکده شیمی پردیس علوم پایه، دانشگاه سمنان قدردانی می‌شود.

1- Abolmaali S, Mitterbauer R, Spadiut O, Peruci M, Weindorfer H, Lucyshyn D, Ellersdorfer G, Lemmens M, Moll W-D, Adam G (2008) Engineered bakers yeast as a sensitive bioassay indicator organism for the trichothecene toxin deoxynivalenol. Journal of Microbiological Methods 72:306-312.

2- Ahluwalia SS, Goyal D (2007) Microbial and plant derived biomass for removal of heavy metals from wastewater. Bioresource technology 98:2243-2257.

3- Alinezhadian A, Mohammadi J, Karimi A, Nikookhah F (2014) Effect of municipal effluent irrigation on accumulation of indicator bacteria and some of heavy metal in soil and plant. Journal of molecular and cellular research (Iranian journal of biology) 26:508-523.

4- Ayuso-Sacido A, Genilloud O (2005) New PCR primers for the screening of NRPS and PKS-I systems in actinomycetes: detection and distribution of these biosynthetic gene sequences in major taxonomic groups. Microbial ecology 49:10-24.

5- Dixit R, Malaviya D, Pandiyan K, Singh UB, Sahu A, Shukla R, Singh BP, Rai JP, Sharma PK, Lade H (2015) Bioremediation of heavy metals from soil and aquatic environment: an overview of principles and criteria of fundamental processes. Sustainability 7:2189-2212.

6- Ehrenreich IM, Waterbury JB, Webb EA (2005) Distribution and diversity of natural product genes in marine and freshwater cyanobacterial cultures and genomes. Applied and environmental microbiology 71:7401-7413.

7- Gaballa A, Amer A, Hussein H, Moawad H, Sabry H (2003) Heavy metals resistance pattern of moderately halophytic bacteria. Arab Journal of  Biotechnology 6:267-278.

8- Garbisu C, Alkorta I (2001) Phytoextraction: a cost-effective plant-based technology for the removal of metals from the environment. Bioresource technology 77:229-236.

9- Haferburg G, Groth I, Möllmann U, Kothe E, Sattler I (2009) Arousing sleeping genes: shifts in secondary metabolism of metal tolerant actinobacteria under conditions of heavy metal stress. Biometals 22:225-234.

10- Jookar KF, Owlia P, Amoozegar M, Yakhchali B (2014) Culturable prokaryotic diversity of urmia salt lake. Modern genetics journal (MGJ) 9:313-328.

11- Kafilzadeh F, Chittaei M (2014) Investigation of Growth Rate, Resistance, and Zinc Elimination Ability of Resistant Bacteria Isolated from Water and Sediment of Karun River. Journal of Health 5:103-114.

12- Kafilzadeh F, Javid H, Kargar M (2007) Isolation of halophilic and halotolerant microorganisms from the Bakhtegan lake and the effect of physicochemical factors on their frequency. Water and Wastewater 18:81-87.

13- Kapoor A, Viraraghavan T (1995) Fungal biosorption—an alternative treatment option for heavy metal bearing wastewaters: a review. Bioresource Technology 53:195-206.

14- Khodabakhsh F, Nazeri S, Amoozegar MA, Khodakaramian GR (2011) Isolation of a moderately halophilic bacterium resistant to some toxic metals from Aran & Bidgol Salt Lake and its phylogenetic characterization by 16S rDNA gene. Feyz Journals of Kashan University of Medical Sciences 15:50-57.

15- Khosravan A, Amini J, Sarsalary S, Rohanian E (2009) Comparison of biosorption of heavy metal zinc by four different microbial biomas (Activated sludge) in industrial waste water in order to biological refinement JMW 2:23-30.  

16- Mehrshad M, Amoozegar M, Yakhchali B, Shahzade-Fazeli S (2012) Biodiversity of moderately halophilic and halotolerant bacteria in the western coastal line of Urmia Lake. Biol. J. Microorg 1:49-70.

17- Mejáre M, Bülow L (2001) Metal-binding proteins and peptides in bioremediation and phytoremediation of heavy metals. TRENDS in Biotechnology 19:67-73.

18- Mohammadzadeh KR, Chorom M, Motamedi H, Mohabat A (2014) Biosorption and bioaccumulation of cd and ni in competitive solution by three bacteria isolated from polluted soils to sewage sludge. Journal of microbial world 7:241-251.

19- Mosa KA, Saadoun I, Kumar K, Helmy M, Dhankher OP (2016 Mar 15) Potential Biotechnological Strategies for the Cleanup of Heavy Metals and Metalloids. Frontiers in plant science 7.

20- Nordenfjäll E (2014) Isolation of antibiotic producing microorganisms by screening for antibiotic resistance. In: NL, NJ) > Dept. of Microbiology. NK002 Biotechnology - Bachelor's Programme 180 HEC.

21- Rajendran P, Muthukrishnan J, Gunasekaran P (2003) Microbes in heavy metal remediation. Indian journal of experimental biology 41:935-944.

22- Shahinpei A, Amoozegar MA, Akhavan SA (2013) Isolation and identification of poly-extremophilic alkalophilic, halophilic and halotolerant bacteria from alkaline thalassohaline gomishan wetland. Journal of taxonomy and biosistematics 5:79-100.

23- Strieker M, Tanović A, Marahiel MA (2010) Nonribosomal peptide synthetases: structures and dynamics. Current opinion in structural biology 20:234-240.

24- Vreeland RH (2012) Advances in Understanding the Biology of Halophilic Microorganisms. Springer.

25- Williams GJ (2013) Engineering polyketide synthases and nonribosomal peptide synthetases. Current opinion in structural biology 23:603-612.

26- Zarparvar P, Amoozegar MA, Fallahian MR (2014) Diversity of culturable Moderate halophilic and Halotolerant Bacteria in Incheh Boroun hyper saline wetland in Iran. Journal of Cellular and Molecular Researches 27:44-56.

27- Zhang W, Li Z, Miao X, Zhang F (2009) The screening of antimicrobial bacteria with diverse novel nonribosomal peptide synthetase (NRPS) genes from South China Sea sponges. Marine biotechnology 11:346-355.