نوع مقاله: مقاله پژوهشی

نویسندگان

1 کرمان، دانشگاه تحصیلات تکمیلی صنعتی و فناوری پیشرفته، گروه بیوتکنولوژی

2 گروه بیوتکنولوژی، پژوهشگاه علوم و تکنولوژی پیشرفته و علوم محیطی، دانشگاه تحصیلات تکمیلی صنعتی و فناوری پیشرفته، کرمان، ایران

3 تهران، پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری، گروه زیست فناوری دامی.

4 تهران، پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری، گروه زیست فناوری دامی

چکیده

سرطان معده چهارمین سرطان شایع و دومین سرطان منجر به مرگ در دنیا است که بالاترین مرگ و میر را در آسیا دارد. این سرطان یک بدخیمی پیشرونده می باشد که در 79% موارد در مرحله متاستاز تشخیص داده می شود. سلول های سرطانی برای افزایش قابلیت تهاجم تحت فرآیندی به نام گذر از حالت اپیتلیال به مزانشیم (EMT) قرار می گیرند. در سطح اپی ژنتیکی microRNAها (miRها) نقش به سزایی در سرکوب یا فعال سازی EMT ایفا می کنند. خانواده miR-200 در سرکوب EMT نقش دارند و بیان آنها در بافت سرطانی معده کاهش نشان می دهد. شاید بتوان از این خانواده برای تشخیص بیماری و درمان استفاده نمود. هدف از این مطالعه بررسی اثر متفورمین در دو محیط با غلظت متفاوت گلوکز بر بیان دو miR-141 و miR-200a در رده سلولی AGS سرطان معده بود. بدین منظور، پس از تعیین دوز موثر متفورمین mM) 10) با روش MTT، سلول ها به مدت 72 ساعت تحت تیمار با متفورمین قرار گرفته و سپس به روش Real-time PCR میزان بیان دو miR ارزیابی شد. نتایج بیانگر افزایش معنی دار وابسته به دوز هر دو miR-14 و miR-200a بود. این افزایش بیان تحت تاثیر گلوکز در دو خوشه ژنی مرتبط با خانواده miR-200 میزان متفاوتی را نشان داد. از آنجا که کاهش بیان خانواده miR-200 با کاهش بقای بیماران مرتبط شناخته شده است، امید می رود استفاده از متفورمین در کنار سایر روش های درمان سرطان معده گامی موثر در جهت بهبود روش های معمول درمان این بیماری باشد.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Glucose dependent effect of metformin on expression of two microRNAs-related to epithelial to mesenchymal transition in a gastric cancer cell line

نویسندگان [English]

  • Shiva Valaee 1
  • Mohhamad Mehdi Yaghoobi 2
  • Abbas Jamshidizad 3
  • Mehdi Shamsara 4

1 Research Department of Biotechnology, Institute of Science and High Technology and Environmental Sciences, Graduate University of Advanced Technology, Kerman, Iran

2 Department of Biotechnology, Institute of Science and High Technology and Environmental Sciences, Graduate University of Advanced Technology, Kerman, I.R. of Iran.

3 Department of Animal Biotechnology, National Institute of Genetic Engineering and Biotechnology.

4 Department of Animal Biotechnology, National Institute of Genetic Engineering and Biotechnology

چکیده [English]

Gastric cancer is the fourth most common cancer and the second most cancer related death in the world. It causes the highest mortality rates in Asia. Gastric cancer is a progressive malignancy, diagnosed in the metastasis stage in 79% of cases. Epithelial to mesenchymal transition (EMT) is a well-known process, in which tumor cells acquired their invasion properties. MircoRNAs (miRs) are small non-coding RNA molecules regulating EMT suppression/activation epigenetically. For instance, the miR-200 family members are important in EMT suppression and their downregulation occurred in gastric cancer tissue in compare with normal tissues. The members of this family, therefore, might be have diagnostic or therapeutic value. This study was aimed to investigate the glucose-related effects of metformin on expression of miR-141 and mir-200a in a gastric cancer cell line. For doing this, The AGS cells were treated with minimal effective dose of metformin (10 mM) determined by MTT for 72 hours and afterwards the target miRs levels were measured by real-time PCR. The results showed the upregulation of the both miR-141 and miR-200a depending on glucose level and metformin exposure time. Glucose differently regulated the expression of the both miRs. Since the suppression of miR-200 family members is associated with a reduction in the survival rate of patients, it is hoped that applying metformin with other standard treatments play a step forward in improving the common treatments of gastric cancer.

کلیدواژه‌ها [English]

  • gastric cancer
  • miR-141
  • miR-200a
  • metformin

تأثیر وابسته به گلوکز متفورمین بر بیان دو microRNA دخیل در گذر از حالت اپیتلیالی به مزانشیمی در رده سلولی سرطان معده

شیوا ولایی1، محمد مهدی یعقوبی1 ، عباس جمشیدی زاد2 و مهدی شمس آرا2*

1 ایران، کرمان، دانشگاه تحصیلات تکمیلی صنعتی و فناوری پیشرفته، پژوهشگاه علوم و تکنولوژی پیشرفته و علوم محیطی، گروه بیوتکنولوژی

2 ایران، تهران، پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری، گروه زیست فناوری دامی

تاریخ دریافت: 29/5/96                تاریخ پذیرش: 26/9/96

چکیده

سرطان معده چهارمین سرطان شایع و دومین سرطان منجر به مرگ در دنیاست که بالاترین مرگ و میر را در آسیا دارد. این سرطان یک بدخیمی پیشرونده می باشد که در 79درصد موارد در مرحله متاستاز تشخیص داده می شود. سلولهای سرطانی برای افزایش قابلیت تهاجم تحت فرآیندی به نام گذر از حالت اپیتلیال به مزانشیم (EMT) قرار می گیرند. در سطح اپی ژنتیکی microRNAها (miRها) نقش به سزایی در سرکوب یا فعال سازی EMT ایفاء می کنند. خانواده miR-200 در سرکوب EMT نقش دارند و بیان آنها در بافت سرطانی معده کاهش نشان می دهد. شاید بتوان از این خانواده برای تشخیص بیماری و درمان استفاده نمود. هدف از این مطالعه بررسی اثر متفورمین در دو محیط با غلظت متفاوت گلوکز بر بیان دو miR-141 و miR-200a در رده سلولی AGS سرطان معده بود. بدین منظور، پس از تعیین دز موثر متفورمین  mM) 10) با روش MTT،  سلولها به مدت 72 ساعت تحت تیمار با متفورمین قرار گرفته و سپس به روش Real-time PCR میزان بیان دو miR ارزیابی شد. نتایج بیانگر افزایش معنی دار وابسته به دز هر دو miR-14 و miR-200a بود. این افزایش بیان تحت تأثیر گلوکز در دو خوشه ژنی مرتبط با خانواده miR-200 میزان متفاوتی را نشان داد. از آنجا که کاهش بیان خانواده miR-200 با کاهش بقای بیماران مرتبط شناخته شده است، امید می رود استفاده از متفورمین در کنار سایر روشهای درمان سرطان معده گامی موثر در جهت بهبود روشهای معمول درمان این بیماری باشد.

واژه های کلیدی: سرطان معده؛ miR -141؛ miR -200a؛ متفورمین

* نویسنده مسئول، تلفن: 02144787414 ، پست الکترونیکی: shamsa@nigeb.ac.ir

مقدمه

 

سرطان معده، مشابه تمامی سرطانها بیماری پیچیده ای می باشد که در آن بسیاری از عوامل مستعدکننده اپی ژنتیکی و ژنتیکی نقش دارند. در میان علل اپی ژنتیکی که در فرآیندهای بالینی سرطان معده نقش دارند،  microRNAها (miRها) به عنوان تنظیم کننده های مهم، پس از رونویسی ایفای نقش می کنند. ویژگیهای خاص آنها، از جمله اختصاصی بودنشان برای بافت و حتی سلول و نیز پایداری آنها در مایعات مختلف بیولوژیکی و تنظیم مجدد آنها در طی تومور زایی، باعث شده است که miR ها به عنوان نشانگرهای بالقوه و اهداف درمانی در سرطانها مورد توجه قرار بگیرند(6). در سالهای اخیر، بسیاری از مقالات نشان داده اند که miR ها می توانند به عنوان انکوژنها یا سرکوب گرهای تومور در توسعه و پیشرفت سرطان عمل کنند (12, 17 و 32).

خانواده miR -200 شاملmiR -200a ، miR -200b، miR -200c، miR -141 وmiR-429  می باشد که به صورت دو خوشه ژنی مجزا در ژنوم قرار گرفته اند(14). در انسان یکی از خوشه ها شامل miR-200a، miR-429 و miR-200b می باشد که در منطقه بین ژنی روی کروموزوم یک واقع شده است و خوشه دوم شاملmiR-200c  و miR-141 است که روی کروموزوم 12 قرار دارد(3, 25). Gregory و همکارانش اولین بار با استفاده از سنجش مهاجرت اثر مهاری خانواده miR-200 را در مهاجرت سلولی گزارش کردند(14). این گروه نشان دادند که مهار این خانواده از miR، مهاجرت سلولهای اپیتلیال بافت کلیه سگ را افزایش می دهد. به طور مشابه، Park و همکارانش نشان دادند که بیان miR-200a/c در سلولهای سرطان پستان بسیار متاستاتیک MDA-MB-231 به طور قابل توجهی تحرک و مهاجرت آنها را کاهش می دهد(28). کاهش بیان اعضای خانوادهmiR-200  در سرطان تهاجمی پستان که فاقد بیان E-cadherin بوده و دارای فنوتیپ مزانشیمی می باشد، مشاهده شده است(14). بر اساس مطالعه Tang و همکارانش بررسی بیان دو miR از این خانواده (miR-200b/c) می تواند به عنوان نشانگر پیش آگهی در سرطان معده مورد استفاده قرار گیرد(33).

با توجه به تحقیقات می توان گفت خانواده miR-200 مهار کننده قوی گذر از حالت اپیتلیال به مزانشیم (EMT) (Epithelial to mesenchymal transition) است و عدم بیان آن همزمان با افزایش بیان  ZEB1و یا  ZEB2از عوامل منجر به  EMT می باشد. بنابراین خانواده miR-200 با هدف قرار دادن ZEB1/ZEB2 منجر به حفظ حالت اپیتلیالی سلول شده و از مهاجرت سلولها جلوگیری می کند. به نوبه خود، ZEB1، ZEB2 و نیز Snail1 می توانند با اتصال به جعبه E در نزدیکی محل شروع رونویسی خوشه های miR-200، رونویسی آن را مهار کنند، در نتیجه دو چرخه منفی شکل می گیرد که حفظ سلولها در هر دو حالت اپیتلیال یا مزانشیمی را باعث می شود(11). Cong و همکارانش دریافتند که miR-200a از طریق برهمکنش با β-catenin مسیر پیام رسانβ-catenin /Wnt را مهار کرده و در نتیجه مهاجرت، تهاجم و تکثیر را سرکوب می کند (10).

از طرف دیگر، این حقیقت که سلولهای سرطان معده که miR-200 را بیان می کنند، حساسیت بیشتری نسبت به شیمی درمانی دارند می تواند تأثیر مستقیمی روی نتایج بالینی داشته باشد؛ زیرا نشان داده شده است که بیمارانی که miR-200 را بیش از حد بیان می کنند نسبت به درمان حساس تر بوده، و شانس بقای بیشتری دارند. مهم تر از همه، این یافته ها نشان دهنده امکان استفاده از خانواده miR-200 به عنوان نشانگرهای پیش آگهی وجود دارد (37).

اهمیت پیش آگهی ضعیف مرتبط با کاهش بیان خانواده miR-200 در تومورهای اولیه گوارشی تأیید شده است (31). علاوه بر نقش miRهای خانواده miR-200 در ارزیابی پیش آگهی، ممکن است این خانواده به مقاومت در برابر درمان سیستمیک سرطان معده مرتبط باشند(6).

در دهه گذشته، به خواص ضد سرطانی متفورمین توجه گسترده ای شده است(20). مطالعات متعدد نشان داده اند که تیمار سلولهای سرطانی با متفورمین در شرایط برون تنی (In vitro) (آزمایشگاهی) رشد آنها را مهار می‍کند(22، 24، 29، 36، 38 و 39). از مدلهای متنوع شرایط درون تنی (In vivo) نیز برای نشان دادن تواناییهای ضد توموری متفورمین استفاده شده است. یکی از گزارشها توسطSchneider  و همکارانش ارائه شده است(30) که برای اولین بار نشان دادند متفورمین سرطان لوزالمعده را در هامستر با رژیم غذایی پرچرب مهار می کند. مطالعه دیگر بر روی مدل موش مبتلا به سرطان پستان نشان داد که درمان با متفورمین به طور قابل توجهی باعث کاهش رشد تومور و کاهش تجمع آدنوکارسینوم پستان و نیز افزایش طول عمر موش تراریخته HER-2/neu می شود (4).

اخیراً متفورمین به عنوان یک درمان کمکی بالقوه در درمان سرطان مورد توجه قرار گرفته است. فعالیت بالقوه ضدسرطانی متفورمین در مقابل داروهای دیگر کنترل گلوکز خون،  با بروز کمتر سرطان در دیابت نوع دو مرتبط است (19). این اثر ابتدا به تنظیم سیستمیک گلوکز و انسولین نسبت داده شد. فعالیت ضد سرطانی متفورمین به احتمال زیاد ترکیبی از کنترل اثرات سازمان یافته انسولین و اثر مستقیم بر سلولهاست. چندین مطالعه عملکرد متفورمین را در شرایط آزمایشگاهی در انواع مختلف سرطانها نشان داده اند (13, 15, 35 و 40). با این حال، برای مشاهده اثرات متفورمین در شرایط آزمایشگاهی مشابه آنچه در داخل بدن قرار است اتفاق بیفتد، غلظت بالایی از متفورمین (معمولاً 20-5 میلی مولار) لازم است. مطالعات اخیر پیشنهاد می دهند که موضوع ممکن است به دلیل استفاده از گلوکز بالا در محیط کشت باشد، و هنگامی که گلوکز کاهش می یابد، سمیت سلولی متفورمین به طور فزاینده برای سلولهای سرطانی افزایش می یابد(23 و 27). علاوه بر این، منبع کربن سلولهای سرطانی هنگامی که گلوکز را با گلوتامین جایگزین کردند، به طور قابل توجهی اثرات ضد سرطانی متفورمین را تحت تأثیر قرار داد. در مطالعه آنها سلولهای سرطانی در غیاب گلوکز و در حضور گلوتامین بالا حساسیت بیشتری به متفورمین داشتند (18).

اگر چه ثابت شده است که miR ها در تهاجم تومور و متاستاز دخالت می کنند، تاکنون در بسیاری از مطالعات ارتباط miR ها و EMT در سرطان معده موضوع بحث باقی مانده است(6). خانواده miR-200 به طور گسترده در سرطان تحقیق می شود، این مقاله به طور خاص بر نقش متفورمین بر بیان خانواده miR-200 در سرطان معده متمرکز خواهد بود. هدف از این مطالعه بررسی اثر متفورمین روی بیان دو miR-141 و miR-200a  در رده سلولی آدنوکارسینومای معده انسان می باشد.

مواد و روشها

رده سلولی: سلولهای رده AGS سرطان معده در محیط DMEM / F12 با دو غلظت گلوکز 8/7 و 5/17 میلی مولار و FBS 10درصد و پنی سیلین-استرپتومایسین 1 درصد در دمای 37 درجه سانتی گراد در رطوبت 95 درصد و 5درصد CO2 کشت داده شدند. تأثیر متفورمین بر بیان miRهای هدف، در دو غلظت متفاوت گلوکز محیط کشت مورد بررسی قرار گرفت.

آزمون MTT: براساس نتایج به دست آمده از آنچه در مطالعه گذشته مربوط به این تحقیق انجام شده بود (34).

تهاجم سلولی: یک روز قبل از آغاز آزمایش، سلولهای AGS در یک محیط بدون سرم قرار گرفتند. تهاجم سلولی به روش trans-well و با استفاده از کیت تهاجم سلولی Culturex 96 well BME انجام شد. به طور خلاصه، محفظه بالا با محلولx  5/0 BME پوشانیده شد و به مدت 4 ساعت در دمای 37 درجه سانتی گراد در انکوباتور CO2 قرار گرفت. سپس BME از چاهک خارج شد و تعداد
104 × 5 سلول در محیط DMEM / F12 بدون سرم با 10 میلی مولار متفورمین قرار گرفت. محفظه پایین با محیط حاوی FBS 10درصد پر شده و در دمای 37 درجه سانتی گراد با CO2 5درصد به مدت 24 ساعت انکوبه شد. بعد از شستن محفظه ها، محلول رقیق شده Calcein-AM به داخل چاهکها افزوده شد و با میکروسکوپ فلورسانس از سه منطقه از هر چاهک عکس برداری شد. تعداد کل سلولهای مهاجم توسط نرم افزار (NCBI) ImageJ شمارش شد. میانگین تعداد سلولهای شمارش شده در نمونه تیمار با میانگین تعداد سلولهای مهاجم در نمونه کنترل مقایسه شد. تمام آزمایشها به طور مستقل حداقل سه بار تکرار شد(34).

استخراج RNA و Real-time PCR: سلولهای AGS به مدت سه روز در دو محیط با غلظت متفاوت گلوکز با متفورمین تیمار شدند. RNA کل سلول هر 24 ساعت به مدت سه روز با استفاده از محلول TriPure (Roche) مطابق با دستورالعمل شرکت تولید کننده استخراج شد. تمامیت RNA استخراج شده به کمک الکتروفورز بر ژل آگارز تأیید شد. غلظت RNA با استفاده از اسپکتروفتومتر (nm260) اندازه گیری شد. 1 میکروگرم از RNA کل در کنار پرایمر stem-loop اختصاصی هر miR برای سنتز cDNA با استفاده از کیت PrimeScriptTM RT (Clontech) مورد استفاده قرار گرفت. آغازگرهای خاص برای تجزیه و تحلیل miR های بالغ طراحی شد (جدول 1).  واکنش در حجم 10 میکرولیتر آماده شد و تحت شرایط دمایی 37 درجه سانتی گراد به مدت 15 دقیقه و سپس 85 درجه سانتیگراد برای 5 ثانیه قرار گرفت. برای سنجش کمی miRها، PCR real-time در دستگاه Rotor Gene 6000 (Corbett) توسط کیت SYBR® Premix Ex TaqTM II با استفاده از چرخه های حرارتی، یک مرحله 95 درجه سانتی گراد به مدت 30 ثانیه، 40 دوره 95 درجه سانتی گراد به مدت 5 ثانیه و 58 درجه سانتی گراد به مدت 30 ثانیه انجام شد. از ژن  RNU44به عنوان ژن مرجع استفاده شد و سطح بیان miRها با روش –ΔΔC 2 تعیین گردید.

 

جدول 1- توالی آغازگرهای استفاده شده در این پژوهش

آغازگر

(5´ 3´) توالی

miR200a-stem loop

GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTACATCGTT*

miR141-stem loop

GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCCATCTTT*

miR200a-F (NR_029834)

CCGCTAACACTGTCTGGTAACG

miR141-F(NR_029682)

GGG CGTAACACTGTCTGGTAAAG

Universal-R

CAGTGCAGGGTCCGAGGTA

RNU44-F

CCTGGATGATGATAAGCAAAT

RNU44-R

GTCAGTTAGAGCTAATTAAGACC

* بخشی از توالی پرایمری که مکمل توالی انتهای َ3 miR است

 

محاسبات آماری: همه آزمایشها سه بار تکرار شد و تجزیه و تحلیل آماری به کمک آزمون T-test انجام شد. مقدار 05/0p≤ به عنوان تفاوت آماری معنی دار در نظر گرفته شد.

نتایج

اثر مهاری متفورمین بر رشد سلول: کمترین دز متفورمین مهارکننده رشد سلولهای AGS با استفاده از آزمون MTT محاسبه شد(34). MIC (Minimum Inhibitory Concentration) متفورمین بر رشد سلولی 10 میلی مولار و پس از 48 ساعت در محیط کم گلوکز و گلوکز بالا تعیین شد.

اثر مهاری متفورمین بر تهاجم سلولی: تهاجم سلولی در حضور و عدم حضور متفورمین و در دو محیط گلوکزی متفاوت پس از 24 ساعت انکوباسیون با استفاده از شمارش تعداد سلولها در هر میدان دید به کمک میکروسکوپ فلورسانس انجام شد.  میانگین تعداد سلولها در دو گروه آزمایشی و گروه کنترل مقایسه شد که نتایج آن در (شکل1) آورده شده است. همان طور که در شکل 1 نشان داده شده، تیمار با متفورمین باعث کاهش قابل توجهی در قدرت تهاجم سلولهایAGS  شده است.

 

شکل 1- اثر مهاری متفورمین بر تهاجم سلولهای سرطانیAGS. سلولهایAGS  با متفورمین به مدت 24 ساعت تحت درمان قرار گرفتند و تهاجم سلول به روش trans-well و با شمارش سلولهای مهاجم به چاهک زیرین اندازه گیری شد (*p≤0.01، **p≤0.001 و ***p≤ 0.0001)(34).

تغییرات بیان نسبی miR-141 و miR-200a تحت تیمار با متفورمین در شرایط متفاوت غلظتی گلوکز: تغییر بیانmiR  های خانواده miR-200 در سلولهای تیمار شده با متفورمین با RT-qPCR اندازه گیری شد. همان طور که در شکل 2 نشان داده شده است، miR-141 به میزان 3/1، 5/1 و 2/2 برابر در محیط با گلوکز بالا، و 5،5/6 و7/8 برابر در محیط کم گلوکز به ترتیب پس از 24، 48 و 72 ساعت تیمار با متفورمین، افزایش بیان داشت. در مقابل،miR-200a  به میزان 15/3،8/5 و35/17 برابر در محیط با گلوکز بالا، و 6/0، 95/0و 2/2 برابر در محیط کم گلوکز در همان دوره زمانی افزایش بیان نشان داد. (شکلهای 2 و 3). این داده ها یک الگوی تغییر بیان ژن وابسته به زمان در تیمار با متفورمین را نشان می دهند.


 

شکل 2- نتیجه بررسی بیان رونوشت miR-141 در نمونه­های تیمار شده با غلظت mM10 متفورمین با PCR کمی. سلولها تا 72 ساعت در دو غلظت گلوکز با متفورمین تحت تیمار قرار گرفتند و میزان بیان ژنهای مورد نظر با RT- qPCR نسبت به نمونه کنترل اندازه گیری شد. افزایش بیان در هر دو محیط مشاهده شده و میزان افزایش در محیط با غلظت پایین گلوکز بیشتر بود. هر ستون میانگینها و انحراف را در سه تکرار نشان می دهد. (آزمونT، *p≤0.01، **p≤0.001 و***p≤ 0.0001)

 

 

شکل 3- نتیجه بررسی بیان رونوشت miR-200a در نمونه­های تیمار شده با غلظت mM10 متفورمین با PCR کمی. سلولها تا 72 ساعت در دو غلظت گلوکز با متفورمین تحت تیمار قرار گرفتند و میزان بیان ژنهای مورد نظر با RT- qPCR نسبت به نمونه کنترل اندازه گیری شد. افزلیش بیان در هر دو محیط مشاهده شده و میزان افزایش در محیط با غلظت بالا گلوکز بیشتر بود. هر ستون میانگینها و انحراف را در سه تکرار نشان می دهد. (آزمونT، *p≤0.01، **p≤0.001 و***p≤ 0.0001)


بحث

سرطان معده به دلیل تأخیر در تشخیص و متاستاز، یکی از مهم ترین مشکلات سلامتی در سراسر جهان است (1، 2 و 7). مطالعات گذشته نشان داده است که خانوادهmiR-200  جزء سرکوب گرهای تومور می باشند که با هدف قرار دادن ZEB1/2 (که به عنوان یک نشانگر EMT شناخته می‍شود) ویژگیهایEMT  را مهار می کنند. Chang و همکارانش نشان دادند که کاهش معنی داری در میزان بیان خانواده miR-200 در بافت توموری سرطان معده در مقایسه با بافت سالم وجود دارد، آنها اظهار کردند که این خانواده پتانسیل تشخیص بیماری و درمان را دارد(9).

این مطالعه بر روی سلولهای سرطان معده موافق با بررسیهایBao  و همکارانش بود که نشان دادند، در سلولهای سرطانی لوزالمعده، تحت تیمار با متفورمین بیان نسبی miR-200c وmiR-200b  در حالت وابسته به دز افزایش می یابد (5).

اگرچه تیمار با متفورمین باعث افزایش معنی دار وابسته به زمان دو miR-141 و miR-200a در هر دو محیط گلوکزی شد، اما میزان افزایش در این دو محیط الگوی متفاوتی داشت. در مقایسه بیان دو محیط گلوکزی، miR-200a در محیط با گلوکز بالا افزایش بیان بیشتری را نشان داد، در حالی که miR-141 در محیط با گلوکز پایین افزایش بیان بیشتری داشت. از آنجایی که این دو miR هر یک بر روی خوشه ژنی جداگانه ای روی کروموزومهای متفاوت قرار دارند، به نظر می رسد الگوی بیان این دو خوشه ژنی واکنش متفاوتی نسبت به میزان گلوکز محیط نشان می دهند.

مطالعات اخیر نشان می دهد که تغییر در مناطق پروموتر هر یک از خوشه های miR-200 می تواند موجب از دست رفتن آنها در سرطان شود(16). منطقه پروموتری خوشه miR-200c / -141 ازطریق افزایش متیلاسیون (8 و 27)، و خوشه miR-200b / -200a / -429 به طور عمده  از طریق تغییر هیستونها خاموش می شود(21). در ابتدا یک فرضیه درموردmiR-141  مطرح شد که آنزیم DNA متیل ترنسفراز برای فعالیت خود نیاز به کوفاکتور، SAM (S-Adenosyl methionine) دارد. از آنجا که سنتز SAM نیازمند ATP است، کاهش گلوکز باعث کاهش نسبت ATP/AMP شده و بر روی متیلاسیون ژنهای مربوطه تأثیرگذار خواهد بود، از طرفی دیگر این نتیجه برای تأثیر متیلاسیون هیستون در مورد miR-200a اثر عکس داشت، پس دلیل دیگری باید مطرح باشد که در تحقیقات آینده جای بررسی دارد.

Blanco وهمکارانش پیشنهاد کرده اند که راه حل بالقوه درمانی برای بیماران مبتلا به سرطان معده که با کاهش بیان miR-200 پاسخ ضعیفی به درمان می دهند می تواند تجویز هر عامل دمتیله کننده در ترکیب با درمان استاندارد باشد(6). این روش درمانی ممکن است بتواند بیان مهارکننده های اصلی تومور(26)، از جمله خانواده miR-200 را بازگرداند، بنابراین باعث به حداقل رساندن ظرفیت تهاجمی سلولهای سرطانی معده و افزایش حساسیت به شیمی درمانی معمول می شود(6). از آنجا که دمتیلاسیون تصادفی همچنین می تواند باعث بیان ژنهای ناخواسته و عوارض متعاقب آن شود، این روش مناسب به نظر نمی رسد. در حالی که متفورمین از جمله داروهایی است که تا کنون عوارض شناخته شده ای بر بیان ناخواسته ژنها نداشته و در عین حال باعث افزایش بیان خانواده miR-200 می شود. تحقیقات بیشتر بر باقی اعضا خانواده miR-200 و نیز بررسی درون تنی اثرات متفورمین بر بیان این خانواده می تواند نوید بخش راه کارهای جدید درمانی در سرطان معده باشد.

1- میمندی ک و یعقوبی م م.  2015. اثرات عصاره آبی و اتانولی گل محمدی (Rose damascena mill L.) بر علیه سلول‌های سرطانی معده انسان. مجله پژوهش‌های سلولی و مولکولی. 28(2): 309-299.

2- رنجی ن. پادگانه ع. صادقی زاده د و صادقی زاده م.  2014. بررسی بیان ژنهای hTERT و Survivin در رده سلولی آدنوکارسینومای معده انسان (AGS) تحت تیمار با نانوکورکومین. مجله پژوهش‌های سلولی و مولکولی. 27(2): 241-233.

 

3- Altuvia Y. Landgraf P. Lithwick G. Elefant N. Pfeffer S. Aravin A. Brownstein M J. Tuschl T and Margalit H.  2005. Clustering and conservation patterns of human microRNAs. Nucleic Acids Res. 33(8): p. 2697-2706.

4- Anisimov V N. Berstein L M. Egormin P A. Piskunova T S. Popovich I G. Zabezhinski M A. Kovalenko I G. Poroshina T E. Semenchenko A V. Provinciali M. Re F and Franceschi C.  2005. Effect of metformin on life span and on the development of spontaneous mammary tumors in HER-2/neu transgenic mice. Experimental Gerontology. 40(8–9): p. 685-693.

5- Bao B. Wang Z. Ali S. Ahmad A. Azmi A S. Sarkar S H. Banerjee S. Kong D. Li Y. Thakur S and Sarkar F H.  2012. Metformin inhibits cell proliferation, migration and invasion by attenuating CSC function mediated by deregulating miRNAs in pancreatic cancer cells. Cancer Prev Res (Phila). 5(3): p. 355-364.

6- Blanco-Calvo M and Valladares-Ayerbes M.  2014. Clinical and molecular aspects of miR-200 family in gastric cancer. Translational Gastrointestinal Cancer. 3(3): p. 130-132.

7- Brzozowa M. Mielanczyk L. Michalski M. Malinowski L. Kowalczyk-Ziomek G. Helewski K. Harabin-Slowinska M and Wojnicz R.  2013. Role of Notch signaling pathway in gastric cancer pathogenesis. Contemp Oncol (Pozn). 17(1): p. 1-5.

8- Castilla M A. Diaz-Martin J. Sarrio D. Romero-Perez L. Lopez-Garcia M A. Vieites B. Biscuola M. Ramiro-Fuentes S. Isacke C M and Palacios J.  2012. MicroRNA-200 family modulation in distinct breast cancer phenotypes. PLoS One. 7(10): p. e47709.

9- Chang L. Guo F. Huo B. Lv Y. Wang Y and Liu W.  2015. Expression and clinical significance of the microRNA-200 family in gastric cancer. Oncol Lett. 9(5): p. 2317-2324.

10- Cong N. Du P. Zhang A. Shen F. Su J. Pu P. Wang T. Zjang J. Kang C and Zhang Q.  2013. Downregulated microRNA-200a promotes EMT and tumor growth through the wnt/beta-catenin pathway by targeting the E-cadherin repressors ZEB1/ZEB2 in gastric adenocarcinoma. Oncol Rep. 29(4): p. 1579-1587.

11- Diaz-Martin J. Diaz-Lopez A. Moreno-Bueno G. Castilla M A. Rosa-Rosa J M. Cano A and Palacios J.  2014. A core microRNA signature associated with inducers of the epithelial-to-mesenchymal transition. J Pathol. 232(3): p. 319-329.

12- Gong J. Li J. Wang Y. Liu C. Jia H. Jiang C. Wang Y. Luo M. Zhao H. Dong L. Song W. Wang F. Wang W. Zhang J and Yu J.  2014. Characterization of microRNA-29 family expression and investigation of their mechanistic roles in gastric cancer. Carcinogenesis. 35(2): p. 497-506.

13- Gotlieb W H. Saumet J. Beauchamp M C. Gu J. Lau S. Pollak M N and Bruchim I.  2008. In vitro metformin anti-neoplastic activity in epithelial ovarian cancer. Gynecol Oncol. 110(2): p. 246-250.

14- Gregory P A. Bert A G. Paterson E L. Barry S C. Tsykin A. Farshid G. Vadas M A. Khew-Goodall Y and Goodall G J.  2008. The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1. Nat Cell Biol. 10(5): p. 593-601.

15- Hirsch H A. Iliopoulos D. Tsichlis P N and Struhl K.  2009. Metformin selectively targets cancer stem cells, and acts together with chemotherapy to block tumor growth and prolong remission. Cancer Res. 69(19): p. 7507-7511.

16- Humphries B and Yang C.  2015. The microRNA-200 family: small molecules with novel roles in cancer development, progression and therapy. Oncotarget. 6(9): p. 6472-6498.

17- Hutchison J. Cohen Z. Onyeagucha B C. Funk J and Nelson M A.  2013. How microRNAs influence both hereditary and inflammatory-mediated colon cancers. Cancer Genet. 206(9-10): p. 309-316.

18- Javeshghani S. Zakikhani M. Austin S. Bazile M. Blouin M J. Topisirovic I. St-Pierre J and Pollak M N.  2012. Carbon source and myc expression influence the antiproliferative actions of metformin. Cancer Res. 72(23): p. 6257-6267.

19- Knowler W C. Barrett-Connor E. Fowler S E. Hamman R F. Lachin J M. Walker E A and Nathan D M.  2002. Reduction in the incidence of type 2 diabetes with lifestyle intervention or metformin. N Engl J Med. 346(6): p. 393-403.

20- Kourelis T V and Siegel R D.  2012. Metformin and cancer: new applications for an old drug. Med Oncol. 29(2): p. 1314-1327.

21- Lim Y Y. Wright J A. Attema J L. Gregory P A. Bert A G. Smith E. Thomas D. Lopez A F. Drew P A. Khew-Goodall Y and Goodall G J.  2013. Epigenetic modulation of the miR-200 family is associated with transition to a breast cancer stem-cell-like state. J Cell Sci. 126(Pt 10): p. 2256-2266.

22- Liu J. Li M. Song B. Jia C. Zhang L. Bai X and Hu W.  2013. Metformin inhibits renal cell carcinoma in vitro and in vivo xenograft. Urol Oncol. 31(2): p. 264-270

23- Matsuo J. Tsukumo Y. Saito S. Tsukahara S. Sakurai J. Sato S. Kondo H. Ushijima M. Matsuura M. Watanabe T and Tomida A.  2012. Hyperactivation of 4E-binding protein 1 as a mediator of biguanide-induced cytotoxicity during glucose deprivation. Mol Cancer Ther. 11(5): p. 1082-1091.

24- Menendez J A. Oliveras-Ferraros C. Cufi S. Corominas-Faja B. Joven J. Martin-Castillo B and Vazquez-Martin A.  2012. Metformin is synthetically lethal with glucose withdrawal in cancer cells. Cell Cycle. 11(15): p. 2782-2792.

25- Michael M Z. SM O C. van Holst Pellekaan N G. Young G P and James R J.  2003. Reduced accumulation of specific microRNAs in colorectal neoplasia. Mol Cancer Res. 1(12): p. 882-891.

26- Mikata R. Yokosuka O. Fukai K. Imazeki F. Arai M. Tada M. Kurihara T. Zhang K. Kanda T and Saisho H.  2006. Analysis of genes upregulated by the demethylating agent 5-aza-2'-deoxycytidine in gastric cancer cell lines. Int J Cancer. 119(7): p. 1616-1622.

27- Neves R. Scheel C. Weinhold S. Honisch E. Iwaniuk K M. Trompeter H I. Niederacher D. Wernet P. Santourlidis S and Uhrberg M.  2010. Role of DNA methylation in miR-200c/141 cluster silencing in invasive breast cancer cells. BMC Res Notes. 3: p. 219.

28- Park S M. Gaur A B. Lengyel E and Peter M E.  2008. The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2. Genes Dev. 22(7): p. 894-907.

29- Rattan R. Giri S. Hartmann L C and Shridhar V.  2011. Metformin attenuates ovarian cancer cell growth in an AMP-kinase dispensable manner. J Cell Mol Med. 15(1): p. 166-178.

30- Schneider M B. Matsuzaki H. Haorah J. Ulrich A. Standop J. Ding X Z. Adrian T E and Pour P M.  2001. Prevention of pancreatic cancer induction in hamsters by metformin. Gastroenterology. 120(5): p. 1263-1270.

31- Song F. Yang D. Liu B. Guo Y. Zheng H. Li L. Wang T. Yu J. Zhao Y. Niu R. Liang H. Winkler H. Zhang W. Hao X and Chen K.  2014. Integrated microRNA network analyses identify a poor-prognosis subtype of gastric cancer characterized by the miR-200 family. Clin Cancer Res. 20(4): p. 878-889.

32- Sun X. He Y. Huang C. Ma T T and Li J.  2013. Distinctive microRNA signature associated of neoplasms with the Wnt/beta-catenin signaling pathway. Cell Signal. 25(12): p. 2805-2811.

33- Tang H. Deng M. Tang Y. Xie X. Guo J. Kong Y. Ye F. Su Q and Xie X.  2013. miR-200b and miR-200c as prognostic factors and mediators of gastric cancer cell progression. Clin Cancer Res. 19(20): p. 5602-5612.

34- Valaee S. Yaghoobi M M and Shamsara M.  2017. Metformin inhibits gastric cancer cells metastatic traits through suppression of epithelial-mesenchymal transition in a glucose-independent manner. PLoS One. 12(3): p. e0174486.

35- Vazquez-Martin A. Oliveras-Ferraros C and Menendez J A.  2009. The antidiabetic drug metformin suppresses HER2 (erbB-2) oncoprotein overexpression via inhibition of the mTOR effector p70S6K1 in human breast carcinoma cells. Cell Cycle. 8(1): p. 88-96.

36- Wang L W. Li Z S. Zou D W. Jin Z D. Gao J and Xu G M.  2008. Metformin induces apoptosis of pancreatic cancer cells. World J Gastroenterol. 14(47): p. 7192-7198.

37- Wu X M. Shao X Q. Meng X X. Zhang X N. Zhu L. Liu S X. Lin J and Xiao H S.  2011. Genome-wide analysis of microRNA and mRNA expression signatures in hydroxycamptothecin-resistant gastric cancer cells. Acta Pharmacol Sin. 32(2): p. 259-269.

38- Zakikhani M. Dowling R. Fantus I G. Sonenberg N and Pollak M.  2006. Metformin is an AMP kinase-dependent growth inhibitor for breast cancer cells. Cancer Res. 66(21): p. 10269-10273.

39- Zakikhani M. Dowling R J. Sonenberg N and Pollak M N.  2008. The effects of adiponectin and metformin on prostate and colon neoplasia involve activation of AMP-activated protein kinase. Cancer Prev Res (Phila). 1(5): p. 369-375.

40- Zhuang Y and Miskimins W K.  2008. Cell cycle arrest in Metformin treated breast cancer cells involves activation of AMPK, downregulation of cyclin D1, and requires p27Kip1 or p21Cip1. J Mol Signal. 3: p. 18.