نوع مقاله: مقاله پژوهشی

نویسندگان

1 گروه میکروبیولوژی، دانشکده علوم، واحد قم، دانشگاه آزاد اسلامی، قم، ایران

2 دانشیار، پژوهشکده مواد و سوخت هسته ای، پژوهشگاه علوم و فنون هسته ای، سازمان انرژی اتمی، تهران، ایران

3 گروه بیوتکنولوژی، دانشکده زیست شناسی، دانشگاه الزهرا (س)، تهران، ایران

چکیده

فرایند اکسیداسیون و احیاء کانسنگ اورانیوم توسط باکتری اسیدیتیوباسیلوس فرواکسیدانس، با کمک زنجیره انتقال الکترون انجام می گیرد که یکی از مهم ترین اجزاء این زنجیره که در فرایند اکسیداسیون آهن دخیل است، ژن cycA1 می باشد. در این پروژه، جهت افزایش راندمان بیولیچینگ اورانیوم، بیان ژن cycA1 در باکتری اسیدیتیوباسیلوس فرواکسیدانس در حضور چگالی های مختلف از کانسنگ اورانیوم، بررسی شده است. بدین منظور، باکتری مورد نظر در حضور چگالی پالپ های مختلف از کانسنگ اورانیوم (5/2، 5، 10 و 25%)، کشت داده شد. در توالی های 24 ساعته میزان استخراج اورانیوم، تغییرات pH ، Eh و آهن فریک آنها اندازه گیری شد. زمانی که بازده استخراج اورانیوم به 100% رسید، بیان ژن cycA1 باکتری با استفاده از روش Real-time PCR مورد بررسی قرار گرفت. نتایج حاصل از آزمایشات نشان داد، با افزایش میزان چگالی پالپ، سرعت استخراج اورانیوم و فعالیت اکسیداسیونی باکتری کاهش پیدا کردند. همچنین، بیان ژن cycA1 درحضور کانسنگ اورانیوم به نسبت نمونه عاری از کانسنگ افزایش می‌یابد و با افزایش بیشتر چگالی پالپ، به دلیل سمیت اورانیوم، روند کاهشی مشاهده شد. نتایج حاصل از آزمایشات نشان می‌دهد تغییرات Eh، pH و استخراج اورانیوم در فرآیند بیولیچینگ توسط باکتری اسیدیتیوباسیلوس با چگالی پالپ بالای کانسنگ نسبت به باکتری‌های کشت یافته با چگالی پالپ پائین‌تر به تأخیر افتاده است. نتایج حاصل از بررسی بیان ژن cycA1 باکتری در غلظت های مختلف کانسنگ نشان داد که غلظت کانسنگ بر روی بیان ژن های مذکور موثر بوده است.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Effect of different uranium ore concentration in the bioleaching process by analysis of Acidithiobacillus sp. FJ2 cytochrome A1 gene expression

نویسنده [English]

  • Faezeh Fatemi 2

2 Associate Professor, Materials and Nuclear Fuel Research School, Nuclear Science and Technology Research Institute, Tehran, Iran

چکیده [English]

The iron and sulfur oxidation process in Acidithiobacillus ferrooxidans is performed using an electron transport chain, which cycA1 as the most important component. Regarding the importance of this protein in the bioleaching process, the study of Acidithiobacillus ferrooxidans cycA1 gene in the presence of different pulp densities is the one of the main objectives to increase the efficiency of uranium bioleaching. For this purpose, the bacteria cultivated in the presence of different pulp densities of uranium ore (2.5, 5, 10 and 25%). Uranium extraction, variation of pH, Eh and ferrous iron values measured at 24 h intervals. Then, when the uranium extraction yield reached to 100%, gene expressions of cycA1 Acidithiobacillus ferrooxidans were analyzed. The results showed, with increasing pulp density, the uranium extraction rate and oxidation activity of bacteria was reduced. In addition, the results of cycA1 gene expression showed that the target gene expression increases in the presence of uranium ore compare to sample with absence of uranium ore, and with further increase of pulp density, due to the toxicity of uranium, show a decreasing trend. In addition, the changes of Eh, pH and uranium extractions at bioleaching process Acidithiobacillus have been delayed in the presence of high pulp density in compare with lower one. The results of cycA1 gene expressions bacteria in the presence of ore different concentrations showed that mutations and ore concentration has been effective on the expression of this gene.

کلیدواژه‌ها [English]

  • Acidithiobacillus ferrooxidans
  • Cytochrome A1
  • Iron oxidation
  • Uranium bioleaching

تاثیر غلظت های مختلف کانسنگ اورانیوم در فرآیند بیولیچینگ از طریق آنالیز بیان ژن سیتوکروم A1 باکتری اسیدیتیوباسیلوسگونه FJ2

سمانه جهانی1،فائزه فاطمی2* و سبا میری3

1 قم، دانشگاه آزاد اسلامی، واحد قم، دانشکده علوم، گروه میکروبیولوژی

2 تهران، سازمانانرژیاتمی، پژوهشگاهعلوموفنونهسته ای، پژوهشکده مواد و سوخت هسته ای

3 تهران، دانشگاه الزهرا (س)، دانشکده زیست شناسی، گروه بیوتکنولوژی

تاریخ دریافت: 18/10/95              تاریخ پذیرش: 30/8/96

چکیده

فرایند اکسیداسیون و احیاء کانسنگ اورانیوم توسط باکتری اسیدیتیوباسیلوس فرواکسیدانس، با کمک زنجیره انتقال الکترون انجام می گیرد که یکی از مهم ترین اجزاء این زنجیره که در فرایند اکسیداسیون آهن دخیل است، ژن cycA1 می باشد. در این پروژه، جهت افزایش راندمان بیولیچینگ اورانیوم، بیان ژن cycA1 در باکتری اسیدیتیوباسیلوس فرواکسیدانس در حضور چگالی های مختلف از کانسنگ اورانیوم، بررسی شده است. بدین منظور، باکتری مورد نظر در حضور چگالی پالپ های مختلف از کانسنگ اورانیوم (5/2، 5، 10 و 25%)، کشت داده شد. سپس در توالی های 24 ساعته میزان استخراج اورانیوم، تغییرات pH ، Eh و آهن فریک آنها اندازه گیری شد. زمانی که بازده استخراج اورانیوم به 100% رسید، بیان ژن cycA1 باکتری با استفاده از روش Real-time PCR مورد بررسی قرار گرفت. نتایج حاصل از آزمایشات نشان داد، با افزایش میزان چگالی پالپ، سرعت استخراج اورانیوم و فعالیت اکسیداسیونی باکتری کاهش پیدا می کند. همچنین، بیان ژن cycA1 درحضور کانسنگ اورانیوم به نسبت نمونه عاری از کانسنگ افزایش یافته و با افزایش بیشتر چگالی پالپ، به دلیل سمیت اورانیوم، روند کاهشی مشاهده می شود. نتایج حاصل از آزمایشات نشان می­دهد تغییرات Eh، pH و استخراج اورانیوم در فرآیند بیولیچینگ توسط باکتری اسیدیتیوباسیلوس با چگالی پالپ بالای کانسنگ نسبت به باکتری­های کشت یافته با چگالی پالپ پائین­تر به تأخیر افتاده است. نتایج حاصل از بررسی بیان ژن cycA1 باکتری در غلظت های مختلف کانسنگ نشان داد که غلظت کانسنگ بر روی بیان ژن مذکور موثر بوده است.

واژه های کلیدی: باکتری اسیدیتیوباسیلوس فرواکسیدانس، سیتوکروم A1، اکسیداسیون آهن، بیولیچینگ اورانیوم

* نویسنده مسئول، تلفن: 02188216690 ، پست الکترونیکی: ffatemi@aeoi.org.ir

مقدمه

 

بیولیچینگ، فرآیندی را توصیف می­کند که درآن انحلال فلزات از منبع معدنی آنها­، توسط میکروارگانیسم­های طبیعی معینی، صورت می­گیرد (7). در این فرآیند، باکتری­های اکسید­کننده فلزات با واکنش­های اکسیداسیون، باعث بازیابی فلزات از کانسنگ کم عیار می­شوند. به علاوه، امکان بازیابی فلزات، حتی فلزاتی که به میزان کمی در کانسنگ معدن وجود دارند و به طور معمول باطله در نظر گرفته می­شوند، را فراهم می­کند. این فرایند بسیار مهم است و تا حد زیادی به ارزش فلزی که بازیابی می­شود بستگی دارد (31). استخراج اورانیوم از کانسنگ­های معدنی کم عیار و پسماندهای هسته­ای، از نظر تولید انرژی هسته‍ای حایز اهمیت است. اکسید اورانیوم چهارظرفیتی (UO2) که در کانسنگ وجود دارد، نامحلول می­باشد که این ماده را می­توان به وسیله اکسیداسیون شیمیایی با یون فریک بصورت اورانیوم 6 ظرفیتی که محلول است، درآورد. البته، دستیابی به این اکسیدکننده­ها هزینه زیادی را در بر دارد که می­توان با استفاده از باکتری اسیدیتیوباسیلوس فرواکسیدانس با هزینه کمتری، اکسیدکننده­­ای مانند آهن فریک را تولید کرد (23).

اسیدیتیوباسیلوس فرواکسیدانس (با نام سابق تیوباسیلوس فرواکسیدانس) اولین بار در سال 1947 توسط Kolmer و Hinkel از آب اسیدی یک معدن ذغال کانسنگ جدا شد و اولین میکروارگانیسم اکسیدکننده سولفید فلزی است که خصوصیاتش شرح داده شده و بیشترین مطالعات مربوط به آن می­باشد (12). این باکتری، یک شیمیولیتواتوتروف است که از انرژی حاصل از اکسیداسیون مواد معدنی شامل آهن وگوگرد برای رشد استفاده می­کند (36). بعلاوه، یکی از معدود میکروارگانیسم­هایی است که انرژی خود را از طریق اکسیداسیون آهن فرو در محیط­های اسیدی به دست می­آورد و از pH پایین محیط طبیعی استفاده می­کند تا جریان معکوس الکترون، از آهن فرو به NADH را ایجاد کند (37). وجود یک جریان معکوس الکترون از سیتوکروم c، از طریق سیتوکروم bc1 به کوئینون و NAD(P)H دهیدروژناز به صورت واضح در باکتری اسیدیتیوباسیلوس فرواکسیدانس ATCC19859 شناسایی شده است. همچنین، ویژگی­های اپرون کد­کننده کمپلکس bc1 مربوط به سویه‏های ATCC19859 و ATCC33020 باکتری اسیدیتیوباسیلوس فرواکسیدانس مشخص شده است. القاء این ژن در باکتریهای اکسیدکننده آهن نسبت به باکتری های اکسیدکننده گوگرد، بیشتر است (30، 8). این اپرون علاوه بر سه زیرواحد از کمپلکس bc1 (PetA1B1C1)، یک سیتوکروم c (CycA1) و یک آنزیم ریبیتول گلوگز دهیدروژناز (SdrA1) را کد می‏نماید که عملکرد آخرین پروتئین ناشناخته است (22) و سیتوکروم c4 کد­شده توسط ژن cycA1 نیز شناسایی شده است (18). در مسیر معکوس انتقال الکترون، کمپلکس bc1 الکترون‏ها را از یک سیتوکروم c دریافت نموده و آنها را به کوئینون پول منتقل می‏نمایند (19). نوع این سیتوکروم، سیتوکروم c4 پیشنهاد شده است که توسط ژن cycA1 کد می‏شود (8 و 30). از آنجائیکه در بیولیچینگ مهمترین واکنشی که باکتری در آن دخیل می­باشد، اکسیداسیون آهن فرو می­باشد (24، 13) و به علاوه، چگالی پالپ در فرایند فروشویی زیستی تأثیر بسیار زیادی در فعالیت باکتری­ها دارد (39)­، بررسی ژنهای دخیل در این مسیر و تاثیر چگالی پالپ بر آنها حائز اهمیت فراوانی می­باشد. در واکنش اکسیداسیون آهن فرو، بیان ژن cycA1،  به عنوان اولین آنزیم در مسیر تولید NADH در زنجیره انتقال الکترون است. بنابراین، یکی از اهداف اصلی در این پروژه، چگالی پالپ­های کانسنگ اورانیوم مختلف بر روی بیان این ژن است. قابل ذکر است که تاکنون بیان این ژن در چگالی پالپ های مختلف کانسنگ اورانیوم مورد بررسی قرار نگرفته است.

مواد و روشها

کانسنگ مورد استفاده در تحقیق: کانسنگ استفاده شده در این تحقیق، از معدن ساغند (آنومالی 2 ساغند) با اندازه 106µm انتخاب گردید (16). کانسار اورانیوم ساغند در شمال شرقی استان یزد و در فاصله 185 کیلومتری شهرستان یزد و در منطقه ای به طول جغرافیائی"30' 25˚55 و عرض"30' 30˚32 در کویر مرکزی ایران قرار گرفته است. به منظور اطلاع از ترکیبات شیمیایی نمونه، کانسنگ خرد شده برای آنالیز XRF ارسال گردید.

سازگار کردن باکتری اسیدیتیوباسیلوس فرواکسیدانس با غلظت های متفاوت پودر کانسنگ اورانیوم: باکتری بومی اسیدیتیوباسیلوس فرواکسیدانس اس. پیFJ2(42)، در محیط کشت اختصاصی K9، تلقیح گردید. ترکیبات تشکیل دهنده این محیط کشت در جدول 1 نشان داده شده است. سپس، با استفاده از اسید سولفوریک 10 نرمال، سود 10 نرمال و دستگاه  pHمتر ((Metrohm827،pH  محیط کشت به روی 2 تنظیم شد (41، 10). در مرحله بعدی، به میزان 90 میلی لیتر از محیط کشت در داخل ارلن 250 میلی لیتری ریخته و 10 میلی لیتر از باکتری اسیدیتیوباسیلوس فرواکسیدانس به آن افزوده گردید (10% مایه تلقیح) و در نهایت مجدداًpH  محلول بوسیله اسیدسولفوریک10 نرمال تنظیم شد. سپس، ارلن حاوی باکتری و محیط کشت، در دمای 30 درجه سانتیگراد و در انکوباتور شیکر دار با دور همزن rpm180 انکوبه شد (35). در این تحقیق، از غلظت های متفاوت کانسنگ اورانیوم (5/2%، 5%، 10% و 25%) برای سازگاری باکتری استفاده گردید. پس از آماده سازی محیط کشتk9 (100 میلی لیتر محیط کشت مایع)، تلقیح با باکتری مورد نظر به میزان 10% صورت گرفت و محیط کشت با 0.5 g/L پپتون، 1.0 g/L تریپتیک سوی براث و 0.01% عصاره مخمر غنی گشت (28، 15)(جدول 1). سپس، به این سوسپانسیون 5/2% کانسنگ اورانیوم افزوده و در نهایت نمونه در انکوباتور با دمای C°35 و دور همزن rpm150 انکوبه شد (14). زمانیکه استخراج اورانیوم در حضور 5/2% کانسنگ اورانیوم به صورت کامل انجام شد، باکتری جمع آوری شده و به ترتیب در غلظت های بالاتر پودر کانسنگ اورانیوم (که در بالا ذکر شد)، به عنوان مایه تلقیح مورد استفاده قرار گرفت و آزمایشات بیولیچینگ تکرار گردیدند. لازم به توضیح می باشد که غلظت باکتری استفاده شده در تمامی غلظت های کانسنگ، ثابت در نظر گرفته شده است (1×108).

نمونه گیری و آنالیز: در توالی های 24 ساعته، تغییرات pH و Eh اندازه گیری و pH بر روی 2 تنظیم گشت. میزان آهن فرو با اندازه گیری آهن فریک و آهن کل به روش کالرومتریک اندازه گیری و محاسبه شد (20). همچنین، برای تعیین زمانی که میزان استخراج اورانیوم به 100% رسیده است، در توالی­های 24 ساعته میزان cc­5 از لیچ­لیکور برداشته شد و با فیلتر 2/0 میکرون، فیلتر شد. سپس، محلول حاصل از آن برای آنالیز طیف­سنجی نشر اتمی ارسال گردید. لازم به ذکر است میزان لیچ­لیکور برداشته شده با آب مقطر  pH=2 جبران شد. در نهایت، در هر چگالی پالپ، زمانی که میزان استخراج اورانیوم به 100% رسید، باکتریها برای بررسی بیان ژن cycA1 جمع آوری شده تا برای فرایند استخراج RNA مورد استفاده قرار گیرند.

جدول 1- ترکیبات محیط کشتK9

مقادیر

مواد مورد نیاز

g 3

(NH4)2SO4

g 5/0

K2HPO4

g 5/0

MgSO4.7H2O

g 1/0

KCl

g 01/0

Ca(NO3)2.4H2O

g 7/44

FeSO4.7H2O

cc 1000

Distilled Water

استخراج RNA و ساخت cDNA: به منظور استخراج RNA از کیت استخراج RNA شرکت Thermo Scientific (#K0731) استفاده گردید. سپس، برای حذف DNA از RNA استخراج شده، از آنزیم DNase شرکت Thermo Scientific استفاده شد. لازم به ذکر می باشد که به جهت یکسان بودن غلظت RNA مصرفی در ساخت cDNA، غلظت RNA موجود در نمونه­های تیمار شده با Dnase، توسط دستگاه نانودراپ NanoDrop 2000)) خوانده شد. در نهایت، میزان معینی از RNA برای ساخت تمامی cDNAها استفاده گردید. برای ساخت cDNA از RNA استخراج شده، از کیت شرکت Thermo Scientific (#K1622) استفاده شد.

انجام واکنش PCR : واکنش زنجیره ای پلیمراز و Real time PCR با استفاده از پرایمرهای اختصاصی ژن cycA1 و 16sدر باکتری اسیدیتیوباسیلوس فرواکسیدانس انجام و محصول آن بر روی ژل آگارز 1% بارگذاری گردید. پرایمر مورد نظر با استفاده از اطلاعات موجود در بانک ژن NCBI طراحی و پس از اطمینان، جهت سنتز به شرکت تکاپوزیست ارسال شدند.جدول 2 مشخصات پرایمرهای مورد استفاده را نشان می دهد.

جدول 2- توالی پرایمرهای مورد استفاده

ژن

توالی پرایمرها (5´→3´)

cycA1

GCTCCCTATCTGGTCAAACAACT  F=

 

GGTGGAGTCTGGGTAGAGAAGT  R= 

 

16s

CCTACGGGAGGCAGCAG                F=

 

R= CGGTGCTTCTTCTTGGATTCACG  

انجام واکنش Real time PCR : واکنش Real time PCR با استفاده از پرایمر اختصاصی و کیت مخصوص ­ SYBER Ò Premix Ex Taq Ô II (TaKaRa) انجام پذیرفت. این کیت حاوی تمام مواد لازم برای انجام واکنش PCR (آنزیم Taq، بافر همراه باMgCl2  و dNTPs) و رنگ سایبرگرین می باشد که به عنوان مستر میکس مورد استفاده قرار می­­گیرد. هر واکنش­ Real time PCR (حجم نهایی10 میکرولیتر) حاوی μl 5 مسترمیکس،μl 4/0 پرایمرهای Forward و Reverse­ (جدول 2)، μl 5/0 cDNA، μl 2/0 رنگ ROX  و μl 9/3  آب عاری از Nuclease می­باشد. پس از مخلوط کردن مواد مذکور، به جهت اطمینان از صحت انجام واکنش، نمونه­های حاوی ژن مورد آزمایش (CycA1) و نمونه حاوی ژن کنترل داخلی )­s16 ( در پلیت­ها به صورت سه تایی ریخته شد. لازم به توضیح می باشد که ژن کنترل داخلی به جهت نرمالایز کردن تمامی نتایج برای تمام نمونه ها گذاشته شد. نرمالایز کردن برای تصحیح و حذف اختلافها در بازده تکثیر، شرایط تخلیص و مقدار حجم اولیه نمونه می باشد.  همچنین، برای اطمینان حاصل کردن از عدم آلودگی و خطاهای حاصل از آن، برای هر ژن، سه کنترل منفی در نظر گرفته شد که میزان الگوی مورد نظر (cDNA­) با آب مقطر جایگزین گردید. در نهایت، از چرخه حرارتی ذکر شده در جدول 3 استفاده و برای محاسبه میزان تغییرات بیان ژن CycA1از روشCT  DD استفاده گردید.

جدول 3- چرخه حرارتی واکنش Real-Time PCR

تعداد سیکل

        زمان

         دما 

   مرحله

1

²30

oC 95

1

40

²15

oC 95

2

 

²20

oC 60

 

 

²20

oC 72

 

1

²15

oC 95

3

 

²60

oC 60

 

 

²15

oC 95

 

آنالیز آماری: تفاوت های بین داده ها با استفاده از نرم افزار SPSS و تست ANOVA تعیین گردید. با استفاده از این نرم افزار P- value داده ها، محاسبه گردید و P

نتایج و بحث

استخراج اورانیوم توسط باکتری اسیدیتیوباسیلوس فرواکسیدانس:نتایج حاصل از آنالیز XRF در جدول 4 قابل مشاهده می باشد.

 

 

جدول4- ترکیبات کانسنگ اورانیوم با استفاده از آنالیز XRF (کانسنگ مورد استفاده دارای میزان قابل قبولی اورانیوم جهت فرایند بیولیچینگ می باشد. به علاوه، میزان آهن و گوگرد موجود در سنگ به فعالیت باکتری در زمینه اکسیداسیون آهن و گوگرد کمک شایانی می کند)

 

 

استفاده از باکتریهای اکسیدکننده آهن و گوگرد در بیولیچینگ فلزات موجود در کانیهای سولفیدی، ضمن به کارگیری کانسنگهای کم عیار در استخراج فلزات، هزینه کمتری در بردارد و اثرات زیست محیطی منفی روشهای مرسوم استخراج فلزات را نیز در بر ندارد (1).

فرایند بیولیچینگ اورانیوم برای چگالی های پالپ مختلف کانسنگ اورانیوم، در شکل 1 مشخص شده است، همانطور که مشاهده می شود، باکتری اسیدیتیوباسیلوس فرواکسیدانس در حضور چگالی پالپ 5/2، 5، 10 و 25% از کانسنگ معدن اورانیوم توانسته به ترتیب طی 2، 2، 3 و 8 روز اورانیوم را به طور کامل (100%) استخراج کند.


 

 

شکل 1- میزان استخراج اورانیوم توسط باکتری اسیدیتیوباسیلوس فرواکسیدانس در حضور چگالی پالپ های مختلف کانسنگ معدن اورانیوم.

 

 

نتایج این آزمایشات حاکی از آن است که کاهش نرخ استخراج اورانیوم با افزایش چگالی پالپ رخ می دهد. به بیان دیگر، هر چه میزان چگالی پالپ افزایش پیدا کند توانایی استخراج اورانیوم رو به کاهش است و مدت زمان بیشتری جهت استخراج کامل نیاز می باشد (P<0.05) به طوریکه، باکتری در حضور چگالی پالپ 25% توانسته طی 8 روز، اورانیوم را به طور کامل استخراج کند.

تحقیقات مختلفی نشان داده است که عوامل متعددی بر سرعت و کیفیت فرآیند فروشویی فلزات تاثیر می گذارند. برخی از این عوامل با توجه به محدوده عملکرد بهینه خود، باعث مهار یا بهبود فرآیند بیولیچینگ می شوند و مواردی نظیر چگالی پالپ و اندازه ذرات، متعلق به فلز درگیر در فرآیند می باشند که بر روی فعالیت باکتری تاثیرگذارند (7). عناصر سنگین به شدت اثر مهاری روی رشد میکروارگانیسم ها دارند و می توانند برای میکروارگانیسم ها مرگ آور باشند. این فلزات شامل توریوم (Th)، اورانیوم (U)، جیوه (Hg) و نقره (Ag) می باشند که متابولیت های سلول را مهار می کنند و اثر سمی برای باکتری ها دارند (7). میزان مقاومت به فلزات سنگین در هر باکتری، به سویه بستگی دارد. تجربه نشان می دهد که با اعمال فشار انتخابی بر جمعیت میکروارگانیسم‏ها برای رشد در حضور یون فلزی، میزان مقاومت آنها به میزان قابل توجهی نسبت به اغلب فلزات افزایش می‏یابد؛ هر چند که ممکن است این فرآیند در برخی موارد زمان زیادی طول بکشد (33).

یکی از دلایل دیگری که در چگالی پالپ های پایین، میزان استخراج اورانیوم نرخ بالایی دارد و سریعتر انجام می شود این است که O2 یکی از اساسی ترین مواد مغذی برای رشد باکتری ها محسوب می شود و با افزایش چگالی پالپ میزان O2 کاهش می یابد. در چگالی پالپ های پایین، میزان انتقال جرمی اکسیژن بین تولید و مصرف آن متعادل است در حالی که برای چگالی پالپ های بالا نرخ اکسیژن مورد نیاز با میزان اکسیژن تولید شده طی انتقال آن بین گاز و مایع کمتر می باشد (26، 6).

همچنین، در تحقیقاتی مشخص شد که کاهش میزان اکسیژن، سبب کاهش غلظت باکتری­های مؤثر در فرایند فروشویی زیستی و همین طور کاهش غلظت یون فریک و در نهایت کاهش استخراج مس می گردد. زمانی­که غلظت اکسیژن به کمتر از 15 درصد برسد، رشد باکتری­ها نیز محدود خواهد شد (38). در این مطالعه نیز با توجه به نتایج استخراج اورانیوم مشاهده می­شود که با افزایش چگالی پالپ در روند استخراج، کاهش قابل توجهی صورت گرفته است.

تغییرات pH در حضور چگالی پالپ های مختلف از کانسنگ معدن اورانیوم: تغییرات pH محیط کشت توسط باکتری اسیدیتیوباسیلوس فرواکسیدانس در حضور غلظت های مختلف از کانسنگ معدن اورانیوم در شکل 2 قابل مشاهده می باشد. همانطور که در تحقیقات مختلف نشان داده شده است باکتری مورد بررسی در این مطالعه اسیددوست می باشد (2). در شکل 2 کاملاً مشخص است که میزان pH در حضور غلظت های مختلف از کانسنگ معدن، در روزهای ابتدایی روند افزایشی داشته است. به گونه ای که، در چگالی پالپ 25% بعد از گذشت یک روز میزان pH به 4/3 رسیده که این میزان برای چگالی پالپ های 5/2، 5 و 10% به ترتیب 45/2، 2 و 11/2 می باشد. با گذشت زمان این روند افزایشی رو به کاهش رفته و میزان pH دارای روند کاهشی شده است. بدین صورت که در روز هشتم در حضور چگالی پالپ 25% میزان pH تا 97/1 کاهش داشته است. لازم به ذکر می باشد که این روند در حضور تمامی چگالی پالپ های کانسنگ معدن اورانیوم مشاهده شده است.

 

 

 

شکل 2- میزان تغییرات pH توسط باکتری اسیدیتیوباسیلوس فرواکسیدانس در حضور چگالی پالپ های مختلف کانسنگ معدن اورانیوم.

 

افزایش pH در حضور باکتری اسیدیتیوباسیلوس فرواکسیدانس را می توان درگیر با واکنش هایی دانست که مصرف کننده اسید هستند (واکنش1) (24،13). مکانیسم اصلی باکتریایی دخیل در انحلال سولفید های معدنی، اکسیداسیون آهن فرو می باشد، در این واکنش اکسیژن گیرنده الکترون می­باشد (21،27،29).

Fe2+ ‏ + 1/4 O2 +‏ H‏+ Fe3+‏ +‏ 1/2 H2O   (1)

در طی فرآیند فروشویی زیستی، آهن فریک و اسید سولفوریک به منظور استحصال اورانیوم ضروری هستند. آهن فریک یک عامل اکسید­کننده‌ی مؤثر(IV)U می‌باشد و زمانیکه به کانسنگ معدن­های اورانیومی که تحت شرایط اسیدی هستند اضافه ‌شود، اورانیوم را به صورت محلول یا (VI)U تبدیل می­کند.

با پیشرفت زمان، میزان آهن فریک در محیط افزایش می‍یابد و این آهن در واکنش­های هیدرولیزی که منجر به تولید H+ می­شود شرکت می­کند (واکنش 2) که این واکنش ها می­توانند باعث کاهش pH محیط در مراحل بعدی فرآیند شوند (13).

Fe3+ + H2O →Fe (OH)3+ H+  (2)

تغییرات Eh در حضور چگالی پالپ های مختلف از کانسنگ معدن اورانیوم: شکل 3 میزان تغییرات Eh توسط باکتری اسیدیتیوباسیلوس فرواکسیدانس در حضور چگالی پالپ های مختلف از کانسنگ معدن اورانیوم را نشان می دهد. همانگونه که قابل مشاهده است، میزان Eh، با افزایش میزان چگالی پالپ کاهش معنی دار پیدا کرده است(P<0.05). به بیانی دیگر، هر چه میزان چگالی پالپ افزایش پیدا کرده، میزان پتانسیل اکسیداسیون و احیا باکتری اسیدیتیوباسیلوس فرواکسیدانس کاهش یافته است. به طور مثال، در روز اول در حضور چگالی پالپ %5/2 از کانسنگ معدن اورانیوم، میزان Eh به 586 میلی ولت رسیده است، در حالی که در همین روز، در حضور چگالی پالپ 25%، میزان Eh 366 میلی ولت می باشد.


 

شکل 3- میزان تغییرات Eh توسط باکتری اسیدیتیوباسیلوس فرواکسیدانس در حضور چگالی پالپ های مختلف کانسنگ معدن اورانیوم.

 

 

در فروشویی اورانیوم، باکتریها مستقیماً به کانسنگ معدن اورانیوم حمله نمی­کنند، بلکه این میکروارگانیسم­ها پیریت و آهن فرو را اکسید می­کنند و باعث تولید آهن فریک (واکنش 3) می­شوند. سپس، آهن فریک براحتی به اورانیوم (IV) که به صورت ترکیب با مواد معدنی وجود دارد حمله می­کند (واکنش4) و آنرا به اورانیوم (VI) که محلول در اسید سولفوریک رقیق است تبدیل می­کند (34).

4FeSO4 + O2 + 2H2SO4              2Fe2(SO4)3 + 2H2O       (3)

UO2 +Fe2(SO4)3 +2H2SO4                UO2(SO4) 3 + 2FeSO4 +4H+       (4)

آهن فریک از اکسیداسیون پیریت که اغلب همراه با کانسنگ معدن اورانیوم است و یا در طی فرآیند بیولیچینگ اضافه می­گردد، تولید می­شود. در تحقیقات پیشین نشان داده شده است که مهمترین عامل استخراج اورانیوم در بیولیچینگ، یون فریک تشکیل شده از اکسیداسیون یون فرو توسط باکتری می باشد. بنابراین، افزایش Eh در استخراج اورانیوم دارای نقش تعیین کننده­ای می باشد (4). چگالی پالپ در فرآیند بیولیچینگ تأثیر بسیار زیادی در فعالیت باکتری­ها دارد، به این صورت که هر چه چگالی پالپ افزایش یابد، فعالیت باکتری­ها کاهش می­یابد (39)، بنابراین، تاخیر در افزایش Eh در چگالی پالپ­های بالا را می توان اینگونه توضیح داد.

همانطور که در نمودارهای مربوط به تغییرات ­Eh، قابل مشاهده می­باشد (شکل 3)، در نمونه کنترل منفی به دلیل عدم وجود باکتری در محیط، تغییرات  Eh کمتر بوده و افزایش اندک Eh به دلیل اکسیداسیون یون فرو توسط هوا می باشد (4).

تغییرات آهن فرو در حضور چگالی پالپ های مختلف از کانسنگ معدن اورانیوم: شکل 4 نشان دهنده تغییرات آهن فرو در فرآیند بیولیچینگ اورانیوم توسط باکتری اسیدیتیوباسیلوس فرواکسیدانس می­باشد. نتایج حاصل نشان دهنده این است که میزان آهن فرو در حضور کانسنگ اورانیوم با پیشرفت زمان روند کاهشی داشته است و با افزایش میزان چگالی پالپ، روند تغییرات کاهشی با تاخیر انجام شده است (P<0.05). به طوریکه در روز دوم در حضور چگالی پالپ %5/2 از کانسنگ معدن اورانیوم، میزان آهن فرو به  ppm250 رسیده است، در حالی که در همین روز، در حضور چگالی پالپ 25%، میزان آن ppm 10705 می باشد.

 

 

شکل 4- میزان تغییرات آهن فرو توسط باکتری اسیدیتیوباسیلوس فرواکسیدانس در حضور چگالی پالپ های مختلف کانسنگ معدن اورانیوم.

 

 

همانطور که در  واکنش 3 و 1 قابل مشاهده می­باشد، باکتری در طی فرآیند بیولیچینگ، آهن فرو را به آهن فریک اکسید می­ کند وبه طوریکه میزان آهن فرو محیط کشت با پیشرفت فرآیند کاهش می­یابد که این کاهش نشان دهنده فعالیت اکسیداسیونی باکتری می­باشد اما، با افزایش میزان چگالی پالپ، روند تغییرات کاهشی با تاخیر انجام می­پذیرد. مطالعات و آزمایشات مختلفی در رابطه با تأثیر چگالی پالپ بر روی فرایند فروشویی زیستی روی و منگنز انجام شده است. نتایج بدست آمده نشان می­دهد که استخراج روی، در چگالی پالپ 1 درصد به میزان 100 درصد است و اگر چگالی پالپ به 8 درصد افزایش یابد، میزان استخراج روی به 9/29 درصد کاهش پیدا می­کند. در رابطه با استخراج منگنز، در چگالی پالپ 1 درصد، میزان استخراج 94 درصد است و با افزایش چگالی پالپ به 8 درصد، این میزان به 5/2 درصد کاهش می­یابد که کاهش چشم­گیری است (39). در این مطالعه نیز با توجه به نتایج استخراج اورانیوم مشاهده می­شود که با افزایش چگالی پالپ در روند استخراج، کاهش قابل توجهی صورت گرفته است. در نمونه کنترل منفی به دلیل عدم وجود باکتری در محیط،  کاهش آهن فرو کمتر از سایر نمونه های حاوی باکتری می باشد که این کاهش اندک به دلیل اکسیداسیون یون فرو توسط هوا می باشد (4). تحقیقات اخیر نشان می دهد که در یک محلول اسیدی که فاقد باکتری است، مقدار آهن فرو ثابت می­ماند و سرعت فروشویی غیر­مستقیم که به واسطه آهن فریک انجام می­شود، آهسته خواهد بود (3).

تغییرات بیان ژن cycA1 باکتریاسیدیتیوباسیلوس فرواکسیدانس در حضورچگالی پالپ های مختلف از کانسنگ معدن اورانیوم: شکل 5 نمودار ترسیم شده مربوط به بیان ژن cycA1 باکتری اسیدیتیوباسیلوس فرواکسیدانس در حضور غلظت های مختلف کانسنگ معدن اورانیوم (5/2، 5،  10 و 25% پودر کانسنگ معدن اورانیوم کم عیار ساغند یزد آنومالی 2) را نشان می دهد. همانگونه که از نتایج مشخص می باشد، بیان ژن مورد نظر با افزایش میزان چگالی پالپ نسبت به نمونه کنترل (بدون چگالی پالپ) افزایش پیدا کرده است. همچنین، در چگالی پالپ 5% بیشترین میزان بیان ژن و در چگالی پالپ 5/2% کمترین میزان بیان ژن مشاهده شده است(P<0.05).

 

 

شکل 5- میزان تغییرات به بیان ژن cycA1 باکتری اسیدیتیوباسیلوس فرواکسیدانس در حضور چگالی پالپ های مختلف کانسنگ معدن اورانیوم.

 

 

نتایج حاصل از بیان این ژن (شکل 5) نشان دهنده این امر است که در فرآیندهای ابتدایی بیولیچینگ که با درصد کانسنگ کمتری آغاز می­شود، باکتری، سعی در تطبیق خود با محیط دارد و بیان ژن مورد نیاز برای اکسیداسیون آهن بالا می­رود و با افزایش چگالی پالپ افزایش بیشتری مشاهده می­شود (از چگالی پالپ 5/2 به 5%). اما با پیشرفت فرآیند و افزایش بیشتر کانسنگ اورانیوم محیط، ژنهای دخیل در اکسیداسیون آهن دراثر مواجهه شدن با عوامل تنشی که از حد آستانه تحمل باکتری بیشتر می­باشد، روند کاهشی نشان می­دهند (چگالی پالپ های 10و 25%) که این تغییرات کاهشی نیز به طور واضح در نتایج استخراج اورانیوم مشهود می­باشد. به طوریکه، باکتری در چگالی پالپ های پائین تر(5/2 و 5%) توانسته اورانیوم را در طی دو روز به طور کامل استخراج کند ولی در چگالی پالپ های بالاتر(10و 25%) نیاز به روزهای بیشتری برای استخراج کامل اورانیوم دارد.    

در طی فرایند اکسیداسیون آهن، cyc2 الکترون­ها را مستقیماً از آهن فرو می­پذیرد و با جایگاهی که در غشای خارجی دارد، اولین مرحله در اکسیداسیون آهن فرو را انجام می دهد (40). تصور می­شود که این پروتئین­ یک سوپر کمپلکس تنفسی را شکل می­دهند که غشاهای داخلی و خارجی را فرا گرفته و الکترون­ها را از آهن (یا پیریت) به اکسیژن منتقل می­کند (5، 9، 17). بر اساس مطالعات ژنتیکی و متابولیکی، مشخص شد که الکترون­های حاصل از اکسایش آهن فرو از طریق cyc2 به راستی­سیانین منتقل می­شوند. از آنجا، برخی الکترون­ها مسیر سرازیری الکترون را از طریق سیتوکروم cyc1 به سیتوکروم اکسیداز  aa3طی کرده و برخی نیز مسیر سربالایی الکترون را طی می­کنند که در این مسیر، دهنده عمومی الکترون، یعنی NADH توسط جریان معکوس الکترون از طریق سیتوکرومcycA1  (اولین گیرنده سربالایی) به کمپلکس bc1 و سپس به منبع یوبی­کینون و در نهایت NAD دهیدروژناز، تولید می­شود (36).

از سوی دیگر، افزایش بیان این ژن در حضور چگالی پالپ کانسنگ اورانیوم یک مکانیسم برای تولید NADH از طریق انتقال الکترون از Fe(II)  به NAD(P) می­باشد که باکتری را قادر به مواجهه با عوامل تنش زای اکسیداتیو می­کند، زیرا NADH برای این مبارزه در مقابل عوامل تنشی مثل اورانیوم، ضروری می­باشد (11).

همچنین، سمیت اورانیوم برای اسیدیتیوباسیلوس فرواکسیدانس توسط محققان زیادی بررسی شده است. آقایان دان کن و بروینستین در طی تحقیقاتی مشاهده کرده اند که فعالیت اسیدیتیوباسیلوس فرواکسیدانس در معادن اورانیوم در غلظت 12 گرم بر لیتر اورانیوم  (U3O8) می باشد، در حالی که ابنر و شوارتز مقدار اورانیوم 75/0 Kg/m3 را گزارش کرده اند. آقایان تووینن و کلی اظهار داشتند سمیت اورانیوم باعث ضعیف شدن پیوند و اتصال بین سطوح و سلولها می­شود که در نتیجه باعث کاهش CO2 و اکسیداسیون یون فرو می گردد. به علاوه، بیان کردند که غلظت های اورانیوم بالای (mol/dm33-10-4-10´5) برای اسیدیتیوباسیلوس فرواکسیدانس سمی است (32). در این مطالعه نیز، نتایج نشان می­دهد که باکتری تا چگالی پالپ 5% قادر به تحمل سمیت اورانیوم می­باشد ولی در چگالی پالپ­های بیشتر، سمیت اورانیوم تاثیرات منفی در فعالیت این باکتری دارد.

نتیجه گیری

نتایج به دست آمده از این تحقیق حاکی از آن است که تغییرات بیان ژن cycA1 که نقش مهمی را در فرایند اکسیداسیون آهن و در نتیجه میزان استخراج اورانیوم دارد، درحضور کانسنگ اورانیوم به نسبت نمونه عاری از کانسنگ افزایش می­یابد و با افزایش بیشتر چگالی پالپ به دلیل سمیت اورانیوم روند کاهشی نشان می­دهد. در نتیجه، با افزایش میزان چگالی پالپ سرعت استخراج اورانیوم و فعالیت اکسیداسیونی باکتری کاهش پیدا می کند و باکتری برای استخراج کامل اورانیوم نیاز به مدت زمان بیشتری دارد.   

  1. نقوی، ه.، سام، ع و سالاری، ح. 1394. امکان سنجی پیریت زدایی از زغالسنگ با استفاده از بیوفلوتاسیون. مجله پژوهشهای سلولی و مولکولی. 28 (3). 430-437.
  2. مهدی صادقی پور مروی، احمد علی پوربابایی، حسینعلی علیخانی، احمد حیدری، زهرا منافی. 1396. ارزیابی عملکرد باکتریهای اکسید کننده گوگردی جدا سازی شده از خاک معدن مس و شناسایی مولکولی آنها بر اساس توالی 16S rRNA. مجله پژوهشهای سلولی و مولکولی. 30 (1).

 

3. Abhilash S, Mehta K.D, Kumar V, Pandey B.D, Tamrakar P. K.­ 2010. "Bioleaching - An Alternate Uranium Ore Processing Technology for India". Energy Procedia. 7, 158–162.

4. Akcil A. 2004. "Technical note: potential bioleaching developments towards commercial reality".Minerals Engineering. 17, 477–480.

5. Appia-Ayme C, Guiliani N, Ratouchniak J, Bonnefoy V. 1999. "Characterization of an operon encoding two c-type cytochromes, an aa3-type cytochrome oxidase and rusticyanin in Thiobacillus ferrooxidans ATCC 33020". Appl Environ Microbiol. 65, 4781–4787.

6. Boon M, Heijnen J.J. 1998. Gas-liquid mass transfer phenomena in biooxidation experiments of sulphide minerals: a review of literature data. Hydrometallurgy. 48:187-204.

7. Brandl H. 2008. "Microbial leaching of metals". Wiley-VCH. 8.

8. Bruscella P.  2004. Etude des opérons petI et petII codant pour deux complexes bc1 chez la bactérie acidophile chimioautotrophe stricte Acidithiobacillus ferrooxidans. Université de la Méditerranée, Aix-Marseille II.

9. Castelle C, Guiral M, Malarte G, Ledgham F, Leroy G, Brugna M, Giudici-Orticoni M.T. 2008. A new iron-oxidizing/O2-reducing supercomplex spanning both inner and outer membranes, isolated from the extreme acidophile Acidithiobacillus ferrooxidans. J Biol Chem. 283:25803–25811.

10. Chen P, Yan L, Wang Q, Li Y, Li H. 2012. "Surface alteration of realgar (As4S4) byAcidithiobacillus ferrooxidans"International microbiology. 15: 9-15.

11. Dekker L, Arsene-Ploetze F, Santini J.M. 2016. Comparative proteomics of Acidithiobacillus ferrooxidans grown in the presence and absence of uranium. Research in Microbiology. 167:234–239.

12. Donati E. R, Sand W. 2007. "Microbial processing of metal sulfides".151-168.

13. Dong Y, Lin H, Wang H, Mo X, Fu K, Wen H. 2011 “Effects of ultraviolet irradiation on bacteria mutation and bioleaching of low-grade copper tailings” Minerals Engineering. 24: 870–875.

14. Fatemi F, Arabieh M, Jahani S.  2016.Application of response surface methodology to optimize uranium biological leaching at high pulp density. Radiochimica Acta. 104 (4): 239–246.

15. Fatemi F, Jahani S, Miri S. 2017. The effect of peptone and Tryptic Soy Broth (TSB) on uranium bioleaching efficiency. In local language, In press.

16. Fatemi F, Rashidi A, Jahani S .2015. Isolation and Identification of Native Sulfur-Oxidizing Bacterium Capable of Uranium Extraction. Journal of Science University of Tehran. Progress in Biological Sciences. 5:207–221.

17. Fukumori Y, Yano T, Sato A, Yamanaka T. 1988. "FeII oxidizing enzyme purified from Thiobacillus ferrooxidans". FEMS Microbioliogy. 20, 169–172.

18. Giudici-Orticoni M. T, Leroy G, Nitschke W, Bruschi M. 2000. Characterization of a new dihemic c4-type cytochrome isolated from Thiobacillus ferrooxidans. Biochemistry.  39: 7205–7211.

19. Griesbeck C, Hauska G, Schütz M. 2000. Biological sulfide oxidation: sulfide-quinone reductase (SQR), the primary reaction. In: Pandalai SG (ed) Recent research developments in microbiology. Research Signpost, Trivadrum. 4: 179–203.

20. Karamanev D.G, Nikolov L.N, Mamatarkova V. 2002. ”Rapid simultaneous quantitativedetermination of ferric and ferrous ions in drainage waters and similar solutions” MineralEngineering. 15 (5): 341–346.

21. Kupka D, Kupsa´kova´ I. 1999. "Iron(II) oxidation kinetics in Thiobacillus ferrooxidans in the presence of heavy metals". In: Amils, R., Ballester, A. (Eds.), Biohydrometallurgy and the environment toward the mining of the 21st century, Part A, Elsevier Press, Amsterdam. 387– 396.

22. Levican G, Bruscella P, Guacunano M, Inostrroza C, Bonnefoy V, Holmes D, Jedlicki E. 2002. Characterization of the petI and res operons of Acidithiobacillus ferrooxidans. J Bacteriol. 184: 1498–1501.

23. McCready R.G.L, Gould W.B. 1990. "Bioleaching of uranium". In: Ehrlich HL, Brierley CL (eds) Microbial mineral recovery. McGraw-Hill, New York. 107–125.

24. Meruane G, Vargas T. 2003. "Bacterial oxidation of ferrous iron by Acidithiobacillus ferrooxidans in the pH range 2.5–7.0". Hydrometallurgy. 71 (1–2), 149–158.

25. Meruane G, Vargas T. 2003. "Bacterial oxidation of ferrous iron by Acidithiobacillus ferrooxidans in the pH range 2.5–7.0". Hydrometallurgy. 71 (1–2), 149–158.

26. Moon-Sung C, Kyung-Suk C, Dong-Su K, Hee-Wook R. 2005. Bioleaching of uranium from low grade black schists by Acidithiobacillus  ferrooxidans. World Journal of Microbiology & Biotechnology. 21:377-380.

27. Nakamura K, Noike T, Matsumoto J. 1986. "Effect of operation conditions on biological Fe2+ oxidation with rotating biological contactors". Water Resources. 20 (1), 73–77.

28. Patel M, Tipre D, Dave S. 2011. "Isolation, identification, characterization and polymetallic concentrate leaching studies of tryptic soy- and peptone-resistant thermotolerant Acidithiobacillus ferrooxidans SRDSM2". Bioresource Technology. 102, 1602–1607.

29. Pesic B, Oliver D.J, Wichlacz P. 1989. "An electrochemical method of measuring the oxidation rate of ferrous iron to ferric iron in presence of Thiobacillus ferrooxidans". Biotechnol.Bioengineering. 33, 428–439.

30. Quatrini R, Appia-Ayme C, et al. 2005. Global analysis of the ferrous iron and sulfur energetic metabolism of Acidithiobacillus ferrooxidans by microarrays transcriptome profiling. In: Harrison STL, Rawlings DE, Petersen J (eds) 16th international biohydrometallurgy symposium  proceedings, Cape Town. 761–771.

31. RawlingsD.E. 2004. Microbially assisted dissolution of minerals and its use in the mining industry, Pure and Applied Chemistry. 76: 847–859.

32. Rossi G. 1990. "Biohydrometallurgy". McGraw-Hill, Hamburg.

33. Sand W, Gehrke T, Hallmann R, Schippers A. 1995. Sulfur chemistry, biofilm, and the (in) direct attack mechanism – critical evaluation of bacterial leaching. App Microbiol Biotechnol. 43:961–966.

34. Sapsford D.J, Bowell R.J, Geroni J.N, Penman K.M, Dey M. 2012. "Factors influencing the releaserate of uranium, thorium, yttrium and rare earth elements from a low grade ore". Minerals Engineering. 39, 165–172.

35. Shahroz K, Faizul H, Fariha H, Kausar S, Rahat U. 2012. ”Growth and Biochemical Activities of Acidithiobacillus thiooxidans Collected from Black Shale” Journal of  MicrobiologyResearch. 2(4): 78-83.

36. Valdés J, Pedroso I, Quatrini R, Dodson R, Tettelin H, Blake R, Eisen J, Holmes D. 2008a. "Acidithiobacillus ferrooxidans metabolism: from genome sequence to industrial applications". BMC genomics. 9:597.

37. Valdés J, Pedroso I, Quatrini R, Holmes D.S. 2008b. "Comparative genome analysis of Acidithiobacillus ferrooxidans, A. thiooxidans and A. caldus: Insights into their metabolism and ecophysiology". Hydrometallurgy. 94, 180–184.

38. Witne J, Philips A. 2001. "Bioleaching of Ok Tedi copper concentratrni oxygen and carbon dioxide-enriched air". Minerals Engineering. 14, 25-48.

39. Xin B, Jiang W, Li X, Zhang K, Liu C, Wang R, Wang Y. 2012. "Analysis of reasons for decline of bioleaching efficiency of spent Zn-Mn batteries at high pulp densities and exploration measure for improving performance". Bioresource Technology. 112, 186-192.

40. Yarzabal A, Brasseur G, Ratouchniak j, lund k, lemesle-meunier d. 2002. "The high-molecular-weight cytochrome c Cyc2 of Acidithiobacillus ferrooxidans is an outer membrane protein". JBacteriology. 184, 313–317.

41. Zhang Y, Qin W, Wang J, Zhen S, Yang C, Zhang J, Nai S, Qiu G. 2008. ”Bioleaching ofchalcopyrite by pure and mixed culture” Trans. Nonferrous Met. Soc. China. 18: 1491-1496.

42. Jahani S, Fatemi F, Firoz-e-zare M.A, Zolfaghari M.R. 2015. “Isolation and Characterization of Acidithiobacillus ferrooxidans Strain FJS from Ramsar, Iran”Electronic Journal of Biology. 11(4), 138-146.