نوع مقاله: مقاله پژوهشی

نویسندگان

1 مدیر گروه پژوهشی نانو و بیوتکنولوژی-دانشگاه مازندران

2 دانشجوی کارشناسی ارشد میکروبیولوژی

چکیده

پیل سوختی میکروبی، سیستم بیوالکتروشیمیایی است که انرژی موجود در ترکیبات آلی را از طریق عملکرد کاتالیسیتی میکروارگانیسم‌ها در شرایط بی‌هوازی به انرژی الکتریکی تبدیل می‌کند. جداسازی و بررسی مشخصات باکتری‌ شوانلا از رسوبات بستر دریای مازندران و نیز بررسی توانایی تولید الکتریسیته از اهداف پژوهش حاضر بود. نمونه‌های جمع‌آوری شده از رسوبات بستر دریا به محیط کشت کلیگلرآگار منتقل شد و کلنی‌های سیاه رنگ جداسازی شد. پس از شناسایی جدایه‌ها توانایی تولید الکتریسیته ارزیابی شد. پیل سوختی میکروبی دومحفظه‌ای طراحی گردید و جدایه منتخب به محفظه آند حاوی محیط کشت LB تلقیح شد. از رسوبات بستر دریای مازندران، باکتری احیا کننده سولفات جداسازی شد و با عنوان جدایه ME1 نامگذاری شد. نتایج بررسی مشخصات مرفولوژیکی و فیزیولوژیکی جدایه ME1، نشان داد این باکتری متعلق به جنس شِوانلا بود. همچنین بررسی توالی ژن 16S rRNA و رسم درخت فیلوژنی نشان داد که جدایه ME1 دارای 38/96 درصد هومولوژی با شِوانلا زیامِننسیس (Shewanella xiamenensis) بود. نتایج نشان داد که باکتری جداشده توانایی تولید الکتریسیته در پیل سوختی میکروبی را داشت. همچنین نتایج مطالعات حاضر نشان داد که جدایه ME1 توانایی تولید الکتریسیته با ولتاژ ثابت مدار باز 765 میلی‌ولت را داشت. بیشترین چگالی توان و جریان به ترتیب 817/140 میلی‌وات بر مترمربع و 5/395 میلی‌آمپر بر متر‌مربع سنجیده شد. نتایج تحقیق حاضر نشان داد که شوانلاME1 جداشده از رسوبات بستر دریای مازندران، توانایی تولید الکتریسیته در پیل سوختی میکروبی را داشت. این جدایه می‌تواند برای تولید همزمان الکتریسیته در سیستم‌های تصفیه پساب، معرفی شود.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Electricity production in two-chamber microbial fuel cells using exoelectrogenic Shewanella sp. isolated from sediments of the Caspian Sea

نویسنده [English]

  • Mojtaba Mohseni 1

1 University of Mazandaran

چکیده [English]

A microbial fuel cell is a bioelectrochemical system that converts chemical energy in organic compounds to electrical energy through catalytic reactions of microorganisms under anaerobic conditions. Isolation and characterization of Shewanella sp. from sediments of the Caspian Sea and investigation of its ability to produce electricity were the aims of this study. Samples collected from the sea sediments were cultured in Kligler agar, black colonies were selected. After identification of isolates its ability to produce electricity was evaluated. A two-chamber microbial fuel cell was designed and the selected isolate ME1 was inoculated into the anode chamber containing the LB medium. A sulfate reducing bacterium was isolated from sediments of the Caspian Sea and named as isolate ME1. The results of morphological and physiological characteristics of ME1 showed that this bacterium belonged to the Shewanella sp. Moreover, 16S rRNA sequencing and phylogenetic analyses exhibited that ME1 was similar to Shewanella xiamenensis with 96.38% homology. The results of current studies showed that the isolate ME1 had the ability to produce electricity with a constant open circuit voltage of 765 mV. A maximum power density and a maximum current density were evaluated at 140.817 mW m-2 and 395.50 mA m-2, respectively. The results of this study revealed that the Shewanella sp. ME1 isolated from sediments of the Caspian Sea had the ability to produce electricity in microbial fuel cells. This isolate could be a candidate for the production of electricity in wastewater treatment systems.

کلیدواژه‌ها [English]

  • Shewanella
  • microbial fuel cells
  • Caspian Sea

تولید الکتریسیته در پیل سوختی میکروبی دو محفظه‌ای توسط باکتری شِوانلا اگزوالکتروژنیک جداشده از رسوبات بستر دریای مازندران 

مجتبی محسنی1،2* و سیده‌مریم اکرامی1

1 بابلسر، دانشگاه مازندران، گروه زیست شناسی سلولی و مولکولی

2 بابلسر، دانشگاه مازندران، گروه پژوهشی نانو و بیوتکنولوژی

تاریخ دریافت: 3/6/95                  تاریخ پذیرش: 24/11/95

چکیده

پیل سوختی میکروبی، سیستم بیوالکتروشیمیایی است که انرژی موجود در ترکیبات آلی را از طریق عملکرد کاتالیسیتی میکروارگانیسم‌ها در شرایط بی‌هوازی به انرژی الکتریکی تبدیل می‌کند. جداسازی و بررسی مشخصات باکتری‌ شوانلا از رسوبات بستر دریای مازندران و نیز بررسی توانایی تولید الکتریسیته از اهداف پژوهش حاضر بود. نمونه‌های جمع‌آوری شده از رسوبات بستر دریا به محیط کشت کلیگلرآگار منتقل شد. پس از گرمخانه گذاری پلیتها در دمای 30 درجه سانتی گراد، کلنیهای سیاه رنگ جداسازی شد. پس از شناسایی جدایه‌ها بر اساس مشخصات مورفولوژی، فیزیولوژی و مولکولی، توانایی تولید الکتریسیته ارزیابی شد. پیل سوختی میکروبی دومحفظه‌ای طراحی گردید و جدایه منتخب به محفظه آند حاوی محیط کشت LB تلقیح شد. نوترال رِد به عنوان واسطه انتقال الکترون استفاده شد و الکترودها از گرافیت ساخته شده بود. از رسوبات بستر دریای مازندران، باکتری احیا کننده سولفات جداسازی شد و با عنوان جدایه ME1 نام گذاری شد. نتایج بررسی مشخصات مرفولوژیکی و فیزیولوژیکی جدایه ME1، نشان داد این باکتری متعلق به جنس شِوانلا بود. همچنین بررسی توالی ژن 16S rRNA و رسم درخت فیلوژنی نشان داد که جدایه ME1 دارای 87/98 درصد هومولوژی با شِوانلا سوهائنسیس
(Shewanella seohaensis)بود. نتایج نشان داد که باکتری جداشده توانایی تولید الکتریسیته در پیل سوختی میکروبی را داشت. همچنین نتایج مطالعات حاضر نشان داد که جدایه ME1 توانایی تولید الکتریسیته با ولتاژ ثابت مدار باز 765 میلی‌ولت را داشت. بیشترین چگالی توان و جریان به ترتیب 817/140 میلی‌وات بر مترمربع و 5/395 میلی‌آمپر بر متر‌مربع سنجیده شد. نتایج تحقیق حاضر نشان داد که شوانلاME1 جدا شده از رسوبات بستر دریای مازندران، توانایی تولید الکتریسیته در پیل سوختی میکروبی را داشت. این جدایه می‌تواند برای تولید همزمان الکتریسیته در سیستمهای تصفیه پسآب، معرفی شود.

واژه‌های کلیدی: باکتری شوانلا، پیل سوختی میکروبی، دریای مازندران

* نویسنده مسئول، تلفن: 01135302497 ، پست الکترونیکی: M.Mohseni@umz.ac.ir

مقدمه

 

مصرف انرژی در صنایع مختلف به سرعت در حال افزایش است. سوختهای فسیلی منبع اصلی تأمین انرژی به شمار می‌روند اما به علت محدودیت منابع و ناپایداری آن و نیز به دلیل آلودگیهای زیست محیطی و انتشار گازهای گلخانه‌ای، استفاده از سوختهای فسیلی مشکلات زیادی را ایجاد کرده است. بنابراین تأمین انرژی از منابع جایگزین و تجدید پذیر، ضروری است (30 و 37). پیلهای سوختی میکروبی (Microbial fuel cell) سیستم بیوالکتروشیمیایی هستند که از طریق واکنش کاتالیستی میکروارگانیسم‌ها، انرژی شیمیایی موجود در ترکیبات آلی را در شرایط بی‌هوازی به انرژی الکتریکی تبدیل می‌کند. در واقع باکتریها قادرند مواد آلی را اکسید کرده و الکترونها را به آند پیل سوختی میکروبی منتقل کنند و جریان الکتریکی ایجاد ‌شود. مهم ترین کاربرد برجسته پیل سوختی میکروبی، تصفیه فاضلابها و پسآبهای صنعتی برای تولید انرژی پاک یا انرژی سبز می‌باشد. یعنی فرآیند تولید الکتریسیته و تصفیه فاضلاب به طور همزمان انجام می‌شود (13 و 35). پیل سوختی میکروبی از سه قسمت اصلی شامل محفظه کاتدی، محفظه آندی و غشای انتقال پروتون تشکیل شده است. میکروارگانیسم‌ها به سوبسترا موجود در محفظه آند شامل محیط کشت یا پسآب تلقیح می‌شوند. اکسیداسیون سوبسترا توسط میکروارگانیسم‌ها در شرایط بی‌هوازی، منجر به تولید الکترون و پروتون می‌شود. الکترونها از طریق مدار الکتریکی و نیز پروتونها به طور جداگانه از طریق غشاء وارد محفظه کاتدی‌ می‌شوند تا برای احیاء در اختیار پذیرنده نهایی الکترون قرار گیرند. در این فرآیند تولید جریان الکتریسیته و تجزیه مواد آلی بطور همزمان صورت می‌گیرد (16 و 29). در پیل سوختی میکروبی، میکروارگانیسم‌ها نقش کاتالیستی در تجزیه سوبسترا را بر عهده دارند. برخی میکروارگانیسم‌ها از نظر الکتروشیمیایی فعال می‌باشند به این معنی که قادر به دریافت الکترونها از منبع دهنده خارجی و یا انتقال الکترونها به یک جسم خارجی نظیر الکترود می‌باشند (40 و 41). این گروه از میکروارگانیسم‌ها تحت عنوان اگزوالکتروژن یا میکروارگانیسم‌های الکتروژنیک معرفی می‌شوند (17 و 18). میکروارگانیسم‌های فعال از نظر الکتروشیمیایی به کمک پیلی و سیتوکرومهای غشایی خود، الکترونها را مستقیماً به پذیرنده آن نظیر الکترود انتقال می‌دهند. در حالی که میکروارگانیسم‌های غیرفعال از نظر الکتروشیمیایی برای انتقال الکترون به مولکولهای واسطه نیاز دارند. مولکولهای واسطه، الکترون را از میکروارگانیسم‌ها دریافت کرده و آنها را در سطح الکترود آند تخلیه می‌کنند (21 و 31). همچنین استفاده از کشت مخلوط میکروارگانیسم‌ها در محفظه آندی پیل سوختی نظیر رسوبات دریایی یا لجن بی‌هوازی، موجب تجزیه انواع سوبسترا شده و عملکرد پیل سوختی بهبود می‌یابد (4). میکروارگانیسم‌های فعال الکتروشیمیایی بکار گرفته شده در پیل سوختی میکروبی، عموماً متعلق به گروه پروتئوباکترها، فیرمی‌کوتسها و اسیدوباکترها می‌باشد. بیشترین میکروارگانیسم‌های فعال الکتروشیمیایی متعلق به گروه پروتئوباکترهاست (9). علاوه بر این اغلب میکروارگانیسم‌های فعال الکتروشیمیایی شامل باکتریهای‌ گرم منفی، بی‌هوازی اجباری یا بی‌هوازی اختیاری‌اند. همچنین طبقه بندی آنها بر اساس توانایی و یا عدم توانایی در احیا فلزات نظیر آهن می‌باشد. بیشترین مطالعات در پیل سوختی میکروبی مربوط به جنسهای شوانلا و ژئوباکتر می‌باشد. این باکتریها می‌توانند به عنوان مدلی برای دستیابی به مکانیسم انتقال الکترون از باکتری به سطح الکترود مورد بررسی قرار گیرند. اولین میکروارگانیسم فعال الکتروشیمیایی گزارش شده که احیاء کننده آهن نیز می‌‌‌‌‌‌باشد، شوانلا پوتریفَشینس متعلق به گاماپروتئوباکترها می‌باشد (10 و 39). شوانلا حدود 65 سال پیش شناخته شد. اعضای این جنس با فساد مواد غذایی پروتئینی در ارتباط می‌باشند و به عنوان پاتوژن فرصت‌طلب در جانوران آبزی شناخته شده‌اند (33). شوانلا در ابتدا به عنوان یکی از اعضای جنس آکروموباکتر طبقه‌بندی شد. سپس چندین بار بر اساس تاژه قطبی به عنوان یک باکتری دریازی غیرتخمیری و نیز بر اساس محتویات ژنتیکی‌اش در گروههای مختلف طبقه‌بندی قرار گرفت. سرانجام در سال 1985براساس توالی ژن 5S rRNA‌ به عنوان جنس شوانلا در خانواده شوانلاسه قرار گرفت. این جنس متعلق به شاخه پروتئوباکترها و کلاس گاماپروتئوباکترها می‌باشد (7 و 19). شوانلا باکتری گرم منفی، میله‌ای‌شکل، دارای یک تاژه قطبی و متحرک است. اغلب بی‌هوازی اختیاری‌اند و در رسوبات دریایی یافت می‌شوند. گونه‌های شوانلا توانایی احیای فلزات مختلف نظیر منگنز، آهن و اورانیوم را دارند. یکی از مهم ترین ویژگیهای آن احیای سولفات و تولید H2S می‌باشد (22 و 36). در این پژوهش برای اولین بار در ایران، جداسازی و بررسی ویژگیهای باکتری شوانلا از رسوبات بستر دریای مازندران انجام شد. همچنین توانایی این باکتری بومی برای تولید جریان الکتریسیته در پیل سوختی میکروبی دومحفظه‌ای مورد ارزیابی قرار گرفت.

مواد و روشها

نمونه‌برداری، جداسازی و شناسایی شِوانلا از رسوبات بستر دریا: نمونه‌های رسوب از بستر سواحل دریای مازندران در بابلسر جمع‌آوری شد و در ظروف استریل در دمای 4 درجه سانتی گراد به آزمایشگاه منتقل شد. یک گرم از هر نمونه رسوب در 9 میلی لیتر محلول نمکی (9/0 درصد سدیم کلرید) استریل رقیق شد و رقتهای متوالی
1-10 تا 5-10 تهیه شد. برای جداسازی شوانلا از ویژگی بارز احیاکنندگی سولفات و تولید H2S استفاده شد. بر این اساس نمونه‌های رقیق شده در سطح محیط کشت کلیگلر آگار (مِرک، آلمان) پخش شد و در دمای 30 درجه سانتی گراد به مدت 48 ساعت گرمخانه‌گذاری شد. کلنیهای سیاه و مجزا انتخاب شد و در محیط کشت تازه کلیگلر آگار رشد داده شد.

برای شناسایی باکتریهای جداشده، صفات مورفولوژی و فیزیولوژی آنها بررسی شد. مورفولوژی سلولی جدایه‌ها و واکنش گرم به کمک رنگ‌آمیزی گرم مطالعه شد. همچنین فعالیت کاتالازی و اکسیدازی، تولید اندول، حرکت، مصرف سیترات، تخمیر قندها، مصرف گلوکز از مسیر تخمیر اسیدهای مخلوط (متیل‌رد) یا مسیر تخمیر بوتاندیول (وژزپروسکوئر) مطابق جدول شناسایی کتاب سیستماتیک باکتریولوژی بِرگی (Bergey's Manual of Systematic Bacteriology)، بررسی شد. تمام آزمایشات با 3 بار تکرار انجام شد. جدایه‌ها تا انجام مراحل بعدی آزمایش در گلیسرول 15 درصد در دمای 85- درجه سانتی گراد نگهداری شد.

استخراج نوکلئیک اسید، واکنش زنجیره‌ای پلیمراز ژن 16S rRNA و رسم درخت فیلوژنی: برای تعیین توالی و شناسایی مولکولی باکتری جداشده، نوکلئیک اسید ژنومی با استفاده ار روش استاندارد بید بیتر استخراج شد (23). در این روش با استفاده از دترجنت هگزادسیل‌تری‌متیل‌آمونیوم بروماید(CTAB) دیواره سلولی باکتریها متلاشی شد. سپس از محلول فنل:کلروفرم:ایزوآمیل‌الکل (به نسبت 1:24:25) برای حذف پروتئینها و قندها استفاده شد. همچنین از محلول نمکی پلی‌اتیلن‌گلیکول به منظور رسوب نوکلئیک اسید استفاده گردید. در نهایت برای حذف سایر ناخالصیها از اتانول خالص و سرد استفاده شد. کیفیت DNA استخراج شده، با استفاده از الکتروفورز ژل آگاروز 8/0درصد رنگ‌آمیزی شده با اتیدیوم‌ بروماید مورد بررسی قرار گرفت.

برای تکثیر ژن 16S rRNAاز واکنش زنجیره‌ای پلیمراز (PCR) با استفاده از پرایمرهای عمومی PA و PH (جدول 1) استفاده گردید. واکنش زنجیره‌ای پلیمراز برای‌ تکثیر ژن 16S rRNA مطابق برنامه زیر انجام شد. دمای واسرشت اولیه 95 درجه سانتی گراد و به مدت 5 دقیقه بود. سپس 35 چرخه شامل یک دقیقه دمای 95 درجه سانتی گراد، یک دقیقه دمای 50 درجه سانتی گراد و یک و نیم دقیقه دمای 72 درجه سانتی گراد انجام شد. در نهایت برای تکمیل سنتز DNA، دمای واکنش به مدت 5 دقیقه در 72 درجه سانتی گراد نگه داشته شد. درستی انجام واکنش زنجیره‌ای پلیمراز ژن‌ 16S rDNA، با الکتروفورز ژل آگاروز 8/0 درصد رنگ آمیزی شده با اتیدیوم برماید تأیید شد.

برای تعیین توالی ژن‌ 16S rDNA، محصول واکنش زنجیره‌ای پلیمراز به کمک کیت تخلیص GeneJetPCR (Thermo Scientific, Lithuania) خالص‌سازی گردید. سپس توالی ژن توسط شرکت ماکروژن (Macrogen)کره جنوبی تعیین شد. نتایج توالی نوکلئوتیدها مجدداً به کمک نرم‌افزار Chromas Lite (2.01) بررسی شد. میزان تشابه توالی نوکلئوتیدهای ژن 16S rRNAجدایه به کمک BLAST با توالیهای ثبت شده در پایگاه اطلاعاتی ژنومی GenBank و EzTaxon-e مورد مقایسه قرار گرفت. تحلیل فیلوژنی جدایهME1  با باکتریهای نزدیک به آن به کمک نرم‌افزار ClustalX (نسخه 2) صورت پذیرفت. درخت فیلوژنی توالی ژن 16S rRNAجدایه با توالی حاصل از جستجو در پایگاه اطلاعاتی GenBank و EzTaxon-e به کمک نرم‌افزار MEGA5 و با الگوریتمMaximum likelihood و Neighbour joining، رسم گردید. بررسی اعتبار شاخه با الگوریتم bootstrap analysis و با 1000 بار نمونه‌گیری انجام شد.

 

 

جدول1- مشخصات پرایمرهای عمومی ژن 16S rRNAاستفاده شده در واکنش زنجیره‌ای پلیمراز (F، پرایمر رفت؛ R، پرایمر برگشت).

پرایمر

توالی (5′→3′)

درصد

GC

دمای اتصال پرایمر (درجه سانتی گراد)

محصول PCR (جفت نوکلئوتید)

PA-F

AGAGTTTGATCCTGGCTCAG

50

56

1500

PH-R

AAGGAGGTGATCCAGCCGCA

60

 


شماره دستیابی ژنی توالی 16S rRNA جدایه ME1 در بانک اطلاعاتی: توالی ژن 16S rRNA باکتری ME1 جداشده در این پژوهش به بانک ژنی NCBI ارسال شد و به شماره دستیابی ژنی KX751939 ثبت شد.

طراحی سیستم پیل سوختی میکروبی دومحفظه‌ای: در این مطالعه از راکتور پیل سوختی میکروبی دومحفظه‌ای شامل بخش آند بی‌هوازی و کاتد هوازی (هر یک به حجم 150 میلی‌لیتر)استفاده شد. جنس محفظهها از پلکسی‌گلاس بود و محفظه آند و کاتد توسط غشای تبادل پروتون نَفیون 117 (Nafion 117, DuPont Co, USA)، از یکدیگر جدا شده بودند. برای انتقال الکترونهای تولید شده از الکترودهای گرافیت لوله‌ای استفاده شد و جریان حاصل توسط سیمهای مسی به مدار بیرونی منتقل ‌شد. به منظور حذف ناخالصیها و همین‌طور افزایش تخلخل غشای تبادل پروتون جهت بهبود عملکرد، پیش‌تصفیه‌ غشاء انجام شد. بدین منظور غشاء به مدت یک ساعت در آب اکسیژنه 30 درصد قرار گرفت. سپس به ترتیب به مدت یک ساعت در آب مقطر، محلول اسید سولفوریک 5/0 مولار و در نهایت برای حذف اسید اضافی مجدداً داخل آب مقطر قرار گرفت. تمامی این مراحل در حمام آب گرم 80 درجه سانتی گراد انجام شد (6).

سنجش تولید الکتریسیته توسط جدایه ME1 در پیل سوختی میکروبی: برای سنجش توانایی تولید الکتریسیته توسط جدایه ME1، محیط کشت شامل تریپتون 10 گرم، عصاره مخمر 5 گرم، سدیم کلرید 5 گرم، گلوکز 1 گرم، دی‌پتاسیم‌فسفات 87/0 گرم، مونوپتاسیم‌فسفات 68/0 گرم، نوترال‌ رِد 033/0 گرم در یک لیتر آب دیونیزه تهیه شد (7=pH). همه مواد شیمیایی مورد استفاده از شرکت مِرک آلمان تهیه شد. پس از استریل کردن توسط اتوکلاو (121 درجه سانتی گراد به مدت 15 دقیقه) به محفظه آند منتقل شد. برای تأمین شرایط بی‌هوازی، گاز نیتروژن به محفظه آند تزریق شد. سپس حجم یک درصد از کشت تازه جدایه ME1 به محفطه آند تلقیح گردید. محفظه کاتد نیز با بافر (87/0 گرم بر لیتر دی‌پتاسیم‌فسفات و 68/0 گرم بر لیتر مونوپتاسیم‌فسفات) و پذیرنده الکترون (100 میلی‌مولار فری‌سیانید‌پتاسیم) پر شد و اکسیژن مورد نیاز از طریق روزنه‌های موجود در بالای محفظه تأمین گردید. در طول آزمایش پیل دومحفظه‌ای در دمای ثابت 30 درجه‌سانتی گراد نگهداری شد. ولتاژ تولید شده از پیل سوختی میکروبی از طریق مدار بیرونی متصل به مولتی‌متر قابل اتصال به رایانه (Goodwill GDM-461)، در هر بارگذاری تا رسیدن به ولتاژ ثابت قرائت ‌شد (شکل 1).

 

شکل 1-پیل سوختی میکروبی دومحفظه طراحی شده برای سنجش تولید الکتریسیته. (1) محفظه آند شامل محیط کشت، باکتری، بافر و نوترال رِد؛ (2) محفظه کاتد شامل بافر و پذیرنده الکترون؛ (3) حمام آب گرم برای تأمین درجه حرارت مناسب رشد باکتری؛ (4) مولتی‌متر دیجیتال برای سنجش ولتاژ. 

برای ثبت عملکرد پیل، مقاومتهای متغیر 20,000 اهم تا 300 اهم در مدار قرار گرفت و پس از پایدار شدن پیل، ولتاژ تولید شده ثبت شد. سپس جریان الکتریسیته پیل به کمک رابطه I=V×R-1 محاسبه شد. در این رابطه، I جریان الکتریسیته بر حسب آمپر، V ولتاژ بر حسب ولت و R مقاومت بر حسب اهم می‌باشد. برای محاسبه توان نیز از رابطه P=V×I استفاده شد. در این رابطه P، توان برحسب وات می‌باشد. مقادیر به دست آمده از رابطه‌های بالا شامل توان و جریان الکتریسیته به مساحت سطح الکترود تقسیم شد و چگالی توان (میلی‌وات بر متر مربع) و چگالی جریان (میلی‌آمپر بر متر مربع)، محاسبه شد. سپس بر اساس نتایج چگالی توان، چگالی جریان و ولتاژ، منحنی قطبیت رسم شد.

نتایج

برای جداسازی باکتریهای احیاء کننده سولفات، نمونه‌های جمع آوری شده از رسوبات بستر دریای مازندران در محیط کشت کلیگلر آگار رشد داده شد. کلنیهای سیاه رشد کرده در سطح آگار انتخاب شدند و به محیط کشت تازه کلیگلر آگار منتقل شدند. از میان کلنیهای رشد کرده، یک جدایه با کلنیهای سیاه رنگ، با حاشیه صاف و نرم و براق به عنوان باکتریهای احیاء کننده سولفات انتخاب شد و ME1 نام گذاری شد (شکل2- الف). برای شناسایی جدایه ME1، ویژگیهای مورفولوژی سلولی و واکنش گرم و نیز مشخصات فیزیولوژیکی شامل آزمونهای بیوشیمیایی بررسی شد. نتایج مشاهدات میکروسکوپی نشان داد که جدایه ME1 به صورت سلولهای میله‌ای شکل، کوتاه، منفرد و گرم منفی بود (شکل2-ب). نتایج بررسی‌ آزمونهای بیوشیمیایی جدایه ME1 در جدول 2 نشان داد که این جدایه توانایی تولید ‌هیدروژن سولفید در محیط TSI را دارد. همچنین اکسیداز و کاتالاز مثبت بود در حالی که تولید اندول، مصرف سیترات و متیل‌رِد منفی بود. نتایج مشخصات مورفولوژی و آزمونهای بیوشیمیایی بر اساس جداول شناسایی کتاب سیستماتیک باکتریولوژی برگی نشان داد که جدایه ME1 متعلق به جنس شِوانلا می‌باشد.

شناسایی مولکولی جدایه ME1 با استفاده از توالی ژن 16S rRNA صورت گرفت. پس از انجام واکنش زنجیره‌ای پلیمراز و تعیین توالی، هومولوژی ژن 16S rRNA باکتری جدا شده با سایر توالیهای ثبت شده در بانک اطلاعاتی NCBI و EzTaxon-e، بررسی شد.

 

 

ب 

 

الف 

شکل2- کلنیهای سیاه رنگ رشد کرده در سطح محیط کشت کلیگلر آگار (الف) و تصویر میکروسکوپی سلولهای میله‌ای شکل و گرم منفی رنگ‌آمیزی شده به روش گرم (ب) جدایه ME1 (بزرگنمایی 1000 برابر).

 

جدول 2- مشخصات کلنی در سطح محیط کشت کلیگلر آگار، مورفولوژی سلولی، واکنش گرم و آزمونهای بیوشیمیایی جدایه ME1.

جدایه

ریخت‌شناسی کلنی

واکنش گرم

آزمونهای بیوشیمیایی

کاتالاز

اکسیداز

VP

MR

H2S

اندول

سیترات

حرکت

تحمل نمک

5/6 درصد

ME1

سیاه رنگ، با حاشیه صاف و نرم و براق

میله‌ای کوتاه، گرم منفی

+

+

-

-

+

-

-

+

+

 

نتایج BLAST نشان داد که جدایه ME1 دارای 87/98 درصد هومولوژی با شِوانلا سوهائنسیس
(Shewanella seohaensis) بود. توالی ژن 16S rRNA باکتریهای مشابه و جدایه ME1 به کمک نرم‌افزار ClustalX، همردیف‌سازی شد و درخت فیلوژنی آن به روش Neighbor joining و به کمک نرم‌افزار Mega5 رسم شد. موقعیت فیلوژنی جدایه با سایر باکتریها در شکل 3 نشان داده شده است.

سنجش توانایی تولید الکتریسیته در پیل سوختی میکروبی دومحفظه‌ای باواسطه: پس از تلقیح جدایه ME1 به عنوان بیوکاتالیست فعال به محفظه آند، جریان الکتریکی مورد ارزیابی قرارگرفت. با تلقیح باکتری، ولتاژ اولیه به سرعت تغییر کرد. با توجه به فراهم بودن شرایط مناسب رشد باکتری، ولتاژ پیل پس از حدود 15 ساعت از حدود 200 میلی‌ولت به 598 میلی‌ولت افزایش یافت. سپس روند صعودی ولتاژ پیل ادامه یافت تا پس از 70 ساعت رشد باکتری در دمای 30 درجه سانتی گراد در 765 میلی‌ولت ثابت شد (شکل 4).

محاسبه چگالی توان و جریان و رسم منحنی قطبیت: پس از پایداری ولتاژ مدار باز سیستم، چگالی جریان و چگالی توان محاسبه شد و منحنی قطبیت رسم شد. به این منظور مقاومتهایی در محدوده 20,000 اهم تا 300 اهم (هر مقاومت 15- 10 دقیقه) به طور موازی در مدار قرار داده شد. ولتاژهای معادل هر مقاومت به کمک مولتی‌متر ثبت گردید و چگالی جریان و چگالی توان محاسبه شد. به کمک داده‌های محاسبه شده، منحنی قطبیت رسم شد (شکل 5).

 

 

Shewanella profunda (FR733713)

 

Shewanellaputrefaciens (X81623) 

 

Shewanella hafniensis (AB205566)

 

Shewanellaxiamenensis (FJ589031)

 

ME1 (KX751939)

 

 

Shewanella seohaensis (GU944672) 

 

Shewanella baltica (AJ000214)

 

Shewanella glacialipiscicola (AB205571)

 

Shewanellamorhuae (AB205576)

 

Shewanella basaltis (EU143361)

 

Shewanella frigidimarina (U85903)

 

Shewanellaarctica (GU564402) 

 

Shewanellalivingstonis (AJ300834) 

 

Shewanella vesiculosa (AM980877)

 

Shewanella gaetbuli (AY190533)

 

Shewanella schlegeliana (AB081760)

 

Shewanella marinintestina (AB081757)

 

Shewanella sairae (AB081762)

 

Pseudoalteromonas tetraodonis (AF214730)

 

99

 

100

 

100

 

94

 

100

 

99

 

58

 

99

 

74

 

91

 

80

 

95

 

75

 

61

 

56

 

56

 

0.01

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

شکل 3- دندروگرام توالی ژن 16S rRNAباکتری تولید کننده سولفات ME1 که به جنس شوانلا قرابت نشان داد. اعداد ذکر شده در محل انشعاب نشانگر درصد نمونه‌گیری bootstrap از 1000 نمونه است. باکتری Pseudoalteromonas tetraodonis بعنوان out group قرار داده شد.

 

 

شکل 4- منحنی ولتاژ مدار باز جدایه ME1 در پیل سوختی میکروبی در دمای 30 درجه سانتی گراد.


منحنی قطبیت نشان می‌دهد که چگونه چگالی توان و ولتاژ با تغییر چگالی جریان تغییر می‌یابد. این نتایج نشان می‌دهد که با افزایش چگالی جریان، چگالی توان افزایش یافته و در نقطه‌ای به بیشینه خود می‌رسد. بیشینه چگالی توان و جریان به ترتیب 817/140 میلی‌وات بر مترمربع و 5/395 میلی‌آمپر بر متر‌مربع سنجیده شد (شکل 5). در سیستمهای پیل سوختی میکروبی بیشینه چگالی توان زمانی حاصل می‌گردد که مقاومت درونی و بیرونی با هم برابر باشد. همان طوری که در شکل 5 مشاهده می‌شود با افزایش مقاومت اهمی و پتانسیل بیش از اندازه الکترودها، چگالی توان کاهش می‌یابد. بالا بودن مقاومت درونی سیستم، موجب کاهش توان تولیدی می‌شود.

در حقیقت برای مشخص کردن ماکزیمم چگالی توان بایستی مقاومتهای مدار را تغییر داد. با توجه به رابطه V=I×R، ولتاژ و مقاومت رابطه مستقیمی با یکدیگر دارند و با افزایش مقاومت، ولتاژ افزایش می‌یابد (شکل 6-الف). همچنین افزایش مقاومت موجب کاهش جریان می‌شود (شکل 6-ب).

 

 

شکل5- منحنی قطبیت و چگالی توان برحسب چگالی جریان.(♦)  ولتاژ (میلی‌ولت) ،(●) توان (میلی‌وات).

 

اگرچه تجزیه بیشتر مواد آلی موجود در سوبسترا توسط میکروارگانیسم‌ها در مقاومتهای کمتر صورت می‌گیرد لذا چگالی توان و جریان افزایش می‌یابد. این مسئله موجب بازدهی بیشتر پیل سوختی میکروبی می‌شود. 

بحث و نتیجه‌گیری

افزایش روزافزون نیاز بشر به انرژی، محدودیت در منابع انرژی و از طرفی آلودگیهای زیست ‌محیطی ناشی ازسوختهای فسیلی باعث شده است تا محققان به فکر استفاده از فناوری جدید و منابع نوین تجدیدپذیر انرژی به عنوان جایگزین مناسب باشند. یکی از فناوریهای نوین، پیل سوختی میکروبی است. در این سیستم از میکروارگانیسم‌ها به عنوان کاتالیزور زیستی برای مصرف سوبسترای آلی در شرایط بی‌هوازی استفاده می‌شود. استفاده از میکروارگانیسم‌هایی که در پی انجام واکنشهای متابولیکی خود الکترون آزاد می‌کنند باعث توسعه و پیشرفت فناوری پیل سوختی میکروبی شده است (11 و 32). از مهم ترین باکتریهای فعال از نظر الکتروشیمیایی جنسهای شوانلا، ژئوباکتر و رودوفراکس می‌باشد (12). جنس شوانلا با استفاده از سیتوکرومهای غشایی و نیز پیلی خود به عنوان نانوسیم، توانایی اتصال به سطح الکترود و سپس انتقال الکترون را دارد. همچنین ترشح ریبوفلاوین در برخی سویه‌های شوانلا می‌تواند به عنوان مولکولهای واسط انتقال الکترون عمل نماید (5).

باکتری شوانلا از محیطهای طبیعی مختلف نظیر آبهای شور و شیرین، رسوبات دریایی و همین‌طور از سطح پوست ماهیان دریا جدا شده است. این باکتری از مهم ترین میکروارگانیسم‌های عامل فساد ماهی و دیگر فرآورده‌های گوشتی می‌باشد. به خصوص از مهم ترین عوامل فساد در ماهیان دریایی ذخیره شده در دمای صفر درجه سانتی گراد می‌باشد (14 و 20).


  

الف 

 

ب 

شکل 6- ارتباط بین مقاومت با ولتاژ (الف) و مقاومت با چگالی جریان (ب).


در پژوهش حاضر برای اولین بار جدایه باکتریایی با توانایی تولید الکتریسیته از رسوبات بستر دریای مازندران مورد مطالعه قرار گرفت. در این تحقیق جدایه ME1 با مشخصات کلنی سیاه رنگ در محیط کشت کلیگلر آگار، از رسوبات بستر دریای مازندران جداسازی شد. نتایج بررسی مطالعات مورفولوژی و فیزیولوژی نشان داد جدایه ME1 متعلق به جنس شوانلا بود. در مطالعه مشابه شوانلا زیامننسیس سویه  S4Tدر سال 2010توسط هانگ و همکاران از رسوبات ساحلی زیامن چین جدا شد (8). در سال 2005 وُگِل و همکاران شوانلا بالتیکا را به عنوان مهم ترین گونه باکتریایی تولید کننده هیدروژن سولفید از ماهیان دریایی منجمد شده شناسایی کردند (34). در مطالعه حاضر نتایج بررسی تعیین توالی ژن 16S rRNA جدایه ME1 و مقایسه توالی جدایه با توالی سایر باکتریها در بانکهای اطلاعاتی NCBI و EzTaxon، نشان داد که جدایه ME1 دارای 87/98 درصد هومولوژی با شِوانلا سئوهائنسیس بود. در مطالعه مشابه یوُن و همکاران در سال 2012 شوانلا سئوهائنسیس را به عنوان یک گونه جدید از رسوبات دریایی سواحل غربی کره جنوبی جداسازی کردند (38).

برای مطالعه توانایی تولید الکتریسیته جدایه ME1، پیل سوختی میکروبی دومحفظه‌ای طراحی و ساخته شد. نتایج مطالعه حاضر نشان داد که جدایه ME1 با تولید 765 میلی‌ولت، توانایی نسبتاً بالایی در تولید الکتریسیته داشت. در مطالعه حاضر، از بافر فسفات مناسب با غلظتهای برابر برای نگهداری و تثبیت اسیدیته محفظه آند و کاتد استفاده شد. استفاده از بافر مناسب موجب پایداری pH در هر دو محفظه می‌گردد و از اسیدی شدن آنها ممانعت به عمل می‌آید. با رشد باکتری و تخمیر قند گلوکز، pH محیط رشد در محفظه آند به شدت کاهش می‌یابد. اسیدی شدن محیط رشد، مانع از رشد بهینه باکتریها در محفظه آند می‌گردد. بنابراین استفاده از بافر pH مناسب در محیط رشد باکتری ضروری به نظر می‌رسد (1). پیل سوختی میکروبی به صورت تک‌محفظه‌ای و یا دومحفظه‌ای طراحی می‌شود. البته برای بررسی عملکرد باکتری برای تولید الکتریسیته در شرایط آزمایشگاهی، استفاده از پیل سوختی میکروبی دومحفظه‌ای مناسب است (24).

در سال 2002 پارک و همکارانش تولید الکتریسته به وسیله شوانلا پوتری‌فشینس را در غیاب پذیرنده الکترون خارج سلولی و در پیل سوختی میکروبی تک‌محفظه‌ای بررسی کردند. نتایج این پژوهش نشان داد که تولید الکتریسیته به فاکتورهای مختلفی از جمله محتویات بخش آند، نوع الکترون دهنده و تراکم سلولی بستگی دارد. ماکزیمم جریان و چگالی توان در این تحقیق به ترتیب 5/2 میلی‌آمپر و 2/10 میلی‌وات ‌بر مترمربع گزارش شد. این نتایج نشان داد زمانی که از یک واسطه الکترون در محفظه آند استفاده شود تولید جریان الکتریسیته به وسیله شوانلا پوتری‌فشینس تا 10 برابر افزایش می‌یابد (25). در پژوهش حاضر با استفاده از پیل سوختی میکروبی دومحفظه‌ای حاوی جدایه شوانلا ME1 و نوترال رِد به عنوان ماده واسطه برای افزایش سرعت انتقال الکترون به محیط کشت سنتزی اضافه شد. چگالی جریان و چگالی توان سنجیده شد. در تحقیق حاضر ماکزیمم چگالی جریان و چگالی توان به ترتیب 5/395 میلی‌آمپر بر مترمربع و 817/140 میلی‌وات ‌بر مترمربع در  پیل  سوختی  میکروبی  به  دست

آمد.

نتایج مقایسه توانایی تولید الکتریسیته به کمک سوبستراهای مختلف توسط برخی از میکروارگانیسم‌ها و نیز جدایه ME1، با محاسبه چگالی توان در جدول 4 خلاصه شده است. چادهاری و همکاران در سال 2003 با استفاده از رودوفراکس فری‌ردوسنس به عنوان بیوکاتالیست و گلوکز به عنوان سوبسترا، ماکزیمم چگالی توان 33 میلی‌وات بر مترمربع را ثبت نمودند (2). در مطالعه دیگری که در سال 2005 توسط لوگان و همکارانش (15) صورت گرفت از پیل میکروبی دومحفظه‌ای و رسوبات دریایی بی‌هوازی به عنوان بیوکاتالیست استفاده شد. آنها از سیستئین به عنوان سوبسترا استفاده کردند. در این تحقیق با افزایش غلظت سیستئین از 385 میلی‌گرم در لیتر به 770 میلی‌گرم در لیتر، چگالی توان از 19 میلی‌وات بر مترمربع به 39 میلی‌وات بر مترمربع افزایش یافت. در سال 2011 رحیم‌نژاد و همکارانش (28) پیل میکروبی دومحفظه‌ای طراحی کردند و از ساکارومایسس سرویزیه به عنوان بیوکاتالیست، نوترال‌ رِد به عنوان ماده واسطه الکترون استفاده کردند و توانستند چگالی توان 60 میلی‌وات بر مترمربع را ثبت کنند. آنها برای بهبود عملکرد پیل از غلظتهای متفاوت پتاسیم پرمنگنات به عنوان پذیرنده الکترون در محفظه کاتد استفاده کردند. نتایج این تحقیق نشان داد بهترین بازده الکتریکی پیل با چگالی توان 133 میلی‌وات بر مترمربع در غلظت 400 میکرومول بر لیتر پتاسیم پرمنگنات به دست آمد. نتایج بازده الکتریکی پیلهای سوختی میکروبی در جدول 4 نشان می‌دهد کمترین و بیشترین چگالی توان به ترتیب 33 و 133 میلی‌وات بر مترمربع بود. در حالی که بیشترین چگالی توان در مطالعه حاضر 817/140 میلی‌وات بر مترمربع سنجیده شد.

در مطالعه حاضر برای اولین بار در کشور توانایی تولید الکتریسیته توسط جدایه شوانلا ME1 در پیل سوختی میکروبی دومحفظه‌ای با استفاده از محیط  کشت  ساختگی

به عنوان سوبسترا، مورد سنجش قرار گرفت.

 

 

جدول 4- بازده الکتریکی پیل سوختی میکروبی به کمک برخی میکروارگانیسم‌ها و مقایسه آن با نتایج شوانلا ME1.

میکروارگانیسم

سوبسترا

چگالی توان (mW/m2)

مرجع

رودوفراکس فری‌ردوسنس

گلوکز

33

(2)

رسوبات دریایی بی‌هوازی

سیستئین

39

(15)

ساکارومایسس سرویزیه

گلوکز

133

(28)

پروتئوس وُلگاریس

گلوکز

85

(3)

سودوموناس آئروژینوزا

گلوکز

88

(27)

اشریشیا کلای

لاکتات

91

(26)

شوانلا ME1

گلوکز

817/140

مطالعه حاضر

 

نتایج مطالعه حاضر نشان داد با توجه به رشد سریع جدایه، قدرت بالای انتقال الکترون و نیز عدم نیاز به شرایط دمایی ویژه، جدایه ME1 گزینه مناسبی برای تولید الکتریسیته در پیل سوختی میکروبی است. این نتایج نشان می‌دهد توان الکتریکی تولید شده توسطشوانلا ME1 جدا شده از رسوبات بستر دریای مازندران در مقایسه با نتایج پژوهشهای مشابه، قابل ملاحظه بود. نتایج این تحقیق نشان می‌دهد جدایه شوانلا ME1 می‌تواند به عنوان بیوکاتالیست تلقیحی مناسب در پیل سوختی میکروبی برای تولید الکتریسیته با توانایی بالا، مورد مطالعه بیشتر قرار گیرد.

1- Biffinger, J. C., Byrd, J. N., Dudley, B. L., & Ringeisen, B. R. (2008). Oxygen exposure promotes fuel diversity for Shewanella oneidensis microbial fuel cells. Biosensors and Bioelectronics, 23, 820-826.

2- Chaudhuri, S. K., & Lovley, D. R. (2003). Electricity generation by direct oxidation of glucose in mediatorless microbial fuel cells. Nature Biotechnology, 21(10), 1229-1232.‏

3- Choi, Y., Kim, N., Kim, S., & Jung, S. (2003). Dynamic behaviors of redox mediators within the hydrophobic layers as an important factor for effective microbial fuel cell operation. Bulletin-Korean Chemical Society, 24(4), 437-440.‏

4- Du, Z., Li, H., & Gu, T. (2007). A state of the art review on microbial fuel cells: A promising technology for wastewater treatment and bioenergy. Biotechnology Advances, 25(5), 464–482.

5- El-Naggar, M. Y., Wanger, G., Leung, K. M., Yuzvinsky, T. D., Southam, G., Yang, J., Gorby, Y. A. (2010). Electrical transport along bacterial nanowires from Shewanella oneidensis MR-1. Proceedings of the National Academy of Sciences, 107(42), 18127–18131.

6- Fatemi S., Ghoreyshi A.A., Najafpour Gh., Rahimnejad M.(2015). Investigation of bioelectricity production in dual chamber microbial fuel cell by mixed culture as active biocatalyst. Journal of Cellular and Molecular Researches, 27(4), 546-554 [Persian].

7- Hau, H. H., & Gralnick, J. A. (2007). Ecology and Biotechnology of the Genus Shewanella. Annual Review of Microbiology, 61(1), 237–258.

8- Huang, J., Sun, B., & Zhang, X. (2010). Shewanella xiamenensis sp. nov., isolated from coastal sea sediment. International Journal of Systematic and Evolutionary Microbiology, 60(7), 1585-1589.‏

9- Kim, B. H., Kim, H. J., Hyun, M. S., & Park, D. H. (1999). Direct electrode reaction of Fe (III)-reducing bacterium, Shewanella putrefaciens. Journal of Microbiology and Biotechnology, 9(2), 127-131.‏

10- Kim, H. J., Park, H. S., Hyun, M. S., Chang, I. S., Kim, M., & Kim, B. H. (2002). A mediator-less microbial fuel cell using a metal reducing bacterium, Shewanella putrefaciens. Enzyme and Microbial Technology, 30(2), 145-152.‏

11- Kim, I. S., Chae, K. J., Choi, M. J., & Verstraete, W. (2008). Microbial Fuel Cells: Recent Advances, Bacterial Communities and Application Beyond Electricity Generation. Environmental Engineering Research, 13(2), 51–65.

12- Kim, M. S., & Lee, Y. J. (2010). Optimization of culture conditions and electricity generation using Geobacter sulfurreducens in a dual-chambered microbial fuel-cell. International Journal of Hydrogen Energy, 35(23), 13028-13034.‏

13- Köroğlu, E. O., Özkaya, B., & Çetinkaya, A. Y. (2014). Microbial fuel cells for energy recovery from waste. International Journal of Energy Science, 4(1).‏

14- Kozińska, A., & Pękala, A. (2004). First isolation of Shewanella putrefaciens from freshwater fish–a potential new pathogen of fish. Bull. Eur. Ass. Fish Pathol, 24(4), 189.‏

15- Logan, B. E., Murano, C., Scott, K., Gray, N. D., & Head, I. M. (2005). Electricity generation from cysteine in a microbial fuel cell. Water Research, 39, 942-952.

16- Logan, B. E., Hamelers, B., Rozendal, R., Schröder, U., Keller, J., Freguia, S., & Rabaey, K. (2006). Microbial fuel cells: methodology and technology. Environmental Science & Technology, 40(17), 5181-5192.‏

17- Logan, B. E., Regan, J. M., 2006. Microbial fuel cells‐challenges and applications. Environmental Science & Technology, 40(17), pp. 5172‐80.

18- Logan, B. E. (2008). Microbial fuel cells. John Wiley & Sons.

19- MacDonell, M. T., & Colwell, R. R. (1985). Phylogeny of the Vibrionaceae, and Recommendation for Two New Genera, Listonella and Shewanella. Systematic and Applied Microbiology, 6(2), 171–182.

20- McMeekin, T. A., & Patterson, J. T. (1975). Characterization of hydrogen sulfide-producing bacteria isolated from meat and poultry plants. Applied Microbiology, 29(2), 165-169.‏

21- Mehta, T., Coppi, M. V., Childers, S. E., Lovley, D. R., 2005. Outer membrane c‐type cytochromes required for Fe (III) and Mn (IV) oxide reduction in Geobacter sulfurreducens. Applied and Environmental Microbiology, 71(12), pp. 8634‐41.

22- Min, M., Xu, H., Chen, J., & Fayek, M. (2005). Evidence of uranium biomineralization in sandstone-hosted roll-front uranium deposits, northwestern China. Ore Geology Reviews, 26(3), 198-206.‏

23- Mohseni, M., Firuzyar, S., & Nazari, O. (2015). Isolation and characterization of cyanide degrading Bacillus sp. MF3 under alkaline condition. Journal of Cellular and Molecular Researches, 28 (3), 384-394 [Persian].

24- Oh, S. T., Kim, J. R., Premier, G. C., Lee, T. H., Kim, C., & Sloan, W. T. (2010). Sustainable wastewater treatment: How might microbial fuel cells contribute. Biotechnology Advances, 28(6), 871–881.

25- Park, D. & Zeikus, J. (2002). Impact of electrode composition on electricity generation in a single-compartment fuel cell using Shewanella putrefaciens. Applied Microbiology and Biotechnology, 59, 58-61.

26- Park, D. H., & Zeikus, J. G. (2003). Improved fuel cell and electrode designs for producing electricity from microbial degradation. Biotechnology and Bioengineering, 81(3), 348-355.‏

27- Rabaey, K., Boon, N., Höfte, M., & Verstraete, W. (2005). Microbial phenazine production enhances electron transfer in biofuel cells. Environmental Science & Technology, 39(9), 3401-3408.‏

28- Rahimnejad, M., A. Ghoreyshi, G. Najafpour, T.Jafary (2011) Power generation from organic substrate in batch and continuous flow microbial fuel cell operations. Applied Energy, 88, 3999-4004.

29- Rahimnejad, M., Adhami, A., Darvari, S., Zirepour, A., & Oh, S. E. (2015). Microbial fuel cell as new technology for bioelectricity generation: a review. Alexandria Engineering Journal, 54(3), 745-756.

30- Ter Heijne, A., Hamelers, H. V. M., & Buisman, C. J. N. (2007). Microbial fuel cell operation with continuous biological ferrous iron oxidation of the catholyte. Environmental Science & Technology, 41(11), 4130–4134.

31- Torres, C. I., Marcus, A. K., Lee, H. S., Parameswaran, P., Krajmalnik-Brown, R., & Rittmann, B. E. (2010). A kinetic perspective on extracellular electron transfer by anode-respiring bacteria. FEMS Microbiology Reviews, 34(1), 3–17.

32- Venkata Mohan, S., Mohanakrishna, G., Reddy, B. P., Saravanan, R., & Sarma, P. N. (2008). Bioelectricity generation from chemical wastewater treatment in mediatorless (anode) microbial fuel cell (MFC) using selectively enriched hydrogen producing mixed culture under acidophilic microenvironment. Biochemical Engineering Journal, 39(1), 121–130.

33- Venkateswaran, K., Moser, D. P., Dollhopf, M. E., Lies, D. P., Saffarini, D. A., MacGregor, B. J., Nealson, K. H. (1999). Polyphasic taxonomy of the genus Shewanella and description of Shewanella oneidensis sp. nov. International Journal of Systematic Bacteriology, 49(2), 705–724.

34- Vogel, B. F., Venkateswaran, K., Satomi, M., & Gram, L. (2005). Identification of Shewanella baltica as the most important H2S-producing species during iced storage of Danish marine fish. Applied and Environmental Microbiology, 71(11), 6689-6697.‏

35- Wen, Q., Wu, Y., Cao, D., Zhao, L., & Sun, Q. (2009). Electricity generation and modeling of microbial fuel cell from continuous beer brewery wastewater. Bioresource Technology, 100, 4171-4175.

36- Wiatrowski, H. A., Ward, P. M., & Barkay, T. (2006). Novel reduction of mercury (II) by mercury-sensitive dissimilatory metal reducing bacteria. Environmental Science & Technology, 40(21), 6690-6696.‏

37- Wu, D., Xing, D., Mei, X., Liu, B., Guo, C., & Ren, N. (2013). Electricity generation by Shewanella sp. HN-41 in microbial fuel cells. International Journal of Hydrogen Energy, 38, 15568-15573.

38- Yoon, J. H., Park, S., Jung, Y. T., & Lee, J. S. (2012). Shewanella seohaensis sp. nov., isolated from a tidal flat sediment. Antonie van Leeuwenhoek, 102(1), 149-156.‏

39- Zhang, Y. C., Jiang, Z. H., & Ying, L. I. U. (2015). Application of electrochemically active bacteria as anodic biocatalyst in microbial fuel cells. Chinese Journal of Analytical Chemistry, 43(1), 155–163.

40- Zhou, M., Wang, H., Hassett, D. J., & Gu, T. (2013). Recent advances in microbial fuel cells (MFCs) and microbial electrolysis cells (MECs) for wastewater treatment, bioenergy and bioproducts. Journal of Chemical Technology & Biotechnology, 88(4), 508–518.

41- Zuo, Y., Xing, D., Regan, J. M., & Logan, B. E. (2008). Isolation of the exoelectrogenic bacterium Ochrobactrum anthropi YZ-1 by using a U-tube microbial fuel cell. Applied and Environmental Microbiology, 74, 3130-3137.