نوع مقاله : مقاله پژوهشی

نویسندگان

1 گروه زیست شناسی گیاهی، دانشکده علوم طبیعی، دانشگاه تبریز، تبریز، ایران

2 گروه علوم گیاهی، دانشکده علوم طبیعی، دانشگاه تبریز، تبریز، ایران

3 گروه بیوتکنولوژی، دانشکده کشاورزی، دانشگاه شهید مدنی آذربایجان، تبریز، ایران

4 گروه زیست شناسی سلولی و تکوینی گیاهی، دانشگاه بیله فلد،بیله فلد، آلمان

5 مرکز تحقیقات علوم دارویی، دانشگاه علوم پزشکی تبریز، تبریز، ایران

چکیده

در اکثر موجودات، گیرنده های نوری پیام رسانی به منظور درک و تفسیر علائم محیطی به‌وجود آمده‌اند. این مولکول‌ها قادرند، نور را توسط کروموفورهای خود جذب کرده، مسیرهای پیام رسانی خاصی را در سلو‌ل‌ها به راه انداخته و سبب بروز پاسخ مناسب در سلول شوند. شاخه جدیدی از علم به‌ نام اپتوژنتیک تلاش می‌کند تا از گیرنده های نوری به عنوان ابزارهای مولکولی جهت کنترل دقیق وقایع سلولی استفاده کند. یکی از راه‌های توسعه اپتوژنتیک، شناسایی ابزارهای مولکولی جدید دارای خصوصیات ویژه می باشد. بدین منظور تعیین خصوصیات ژن‌های پیش گویی شده‌ای که اورتولوگ گیرنده های نوری شناسایی شده می باشند، بسیار مفید خواهد بود. در پروژه تعیین توالی ژنوم Volvox carteri دو ژن پیش‌گویی‌شده متعلق به خانواده‌ی Cryptochrome/Photolyase شناسایی شد. هدف از این مطالعه، جداسازی توالی‌های کدکننده‌ی این دو ژن، همسانه‌سازی دو ژن مذکور در داخل وکتور بیانی و تعیین موقعیت قالب خواندن باز آن‌ها در خانواده کریپتوکروم/فتولیاز می‌باشد. بدین منظور، جلبک V.carteri تحت شرایط بهینه رشد داده شد. سپس با استفاده از تکنیک RT-PCR توالی‌های کدکننده‌‌‌‌‌‌‌‌‌‌‌‌‌‌‌‌‌‌ی این دو ژن تکثیر شد. با استفاده از تکنیک مهندسی ‌ژنتیک قطعات تکثیر شده وارد وکتور بیانی pGEX2TK گردید. به منظور همسانه‌سازی وکتور نوترکیب، پلاسمیدها وارد باکتری Escherichia coli گردیدند و سپس تعیین توالی شدند. نتیجه پژوهش نشان داد که توالی‌های ثبت‌شده در پایگاه داده‌ای NCBI به عنوان توالی mRNA برای دو ژن کریپتوکروم DASH، با توالی آن‌ها در ولوکس تفاوت هایی را نشان می دهد.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Cloning and phylogenetic study of two genes belonging to DASH Cryptochrome subfamily in Volvox carteri

نویسندگان [English]

  • Saeid Mahdavi 1
  • Jafar Razeghi 2
  • Maghsoud Pazhouhandeh 3
  • Arash Kianianmomeni 4
  • Ali Movafeghi 1
  • Morteza Kosari nasab 5

1 Plant Bilology, Natural Sciences faculty, University of Tabriz, Tabriz, Iran

2 Plant biology, Natural sciences Faculty, University of Tabriz, Tabriz, Iran

3 Department of Biotechnology, Faculty of Agriculture, Azarbijan Shahid Madani University, Tabriz, Iran

4 Department of Cellular and Developmental Biology of Plants, University of Bielefeld, Bielefeld, Germany

5 Drug Applied Research Center, Tabriz University of Medical Sciences, Tabriz, Iran

چکیده [English]

In the most organisms, signaling photoreceptors have been made to percept and interpret of environmental signals. They can absorb light through their chromophores, trigger different signaling pathways and result in appropriate responses in the cells. Optogenetics, a new field of science, try to use the photoreceptors as molecular instruments in order to exact control of the cellular events. Determination of the new molecular instruments with special characteristics is one of the ways to develop the optogenetics. For this goal, investigation on the predicted genes ortologous with determined photoreceptors is very useful. Two Cryptochrome/ Photolyase family genes were predicted based on the results of Volvox carteri (the model algae) genome sequencing. The goals of this investigation are as follow: the exact determination and isolation of coding sequences related with these two predicted genes, insertion into the expression vector (pGEX2TK) and determination of the subclude of their open reading frames in the Cryptochrome/Photolyase family. Volvox carteri has been grown up in optimum condition. Then this two coding sequences were amplified by using RT-PCR technique. These coding sequences were inserted in the pGEX2TK by genetic engineering techniques. Produced recombinant vectors were transferred to the Escherichia coli strain Top10 and sequenced after plasmid extraction. In current study, it was found that documented mRNA sequences for these two genes in NCBI are different with our mRNA sequences.

کلیدواژه‌ها [English]

  • cloning
  • Expression vector
  • Photoreceptors
  • Optogenetics

همسانه‌سازی و بررسی فیلوژنتیکی توالی‌های دو ژن ‌ متعلق به زیر خانواده کریپتوکروم DASH جلبک Volvox carteri

سعید مهدوی1، جعفر رازقی1*، مقصود پژوهنده2،آرش کیانیان مومنی3، علی موافقی1، مرتضی کوثری نسب4

1ایران، تبریز، دانشگاه تبریز، دانشکده علوم طبیعی، گروه زیست شناسی گیاهی

2 ایران، کیلومتر 35 جاده تبریز- آذر شهر، دانشگاه شهید مدنی آذربایجان، دانشکده کشاورزی، گروه بیوتکنولوژی

3 آلمان، بیله فلد، دانشگاه بیله فلد، گروه زیست شناسی سلولی و تکوینی گیاهی

4 ایران، تبریز، دانشگاه علوم پزشکی تبریز، مرکز تحقیقات علوم دارویی

تاریخ دریافت: 4/10/96                تاریخ پذیرش: 10/4/97

چکیده

در اکثر موجودات، گیرنده های نوری پیام رسانی به منظور درک و تفسیر علائم محیطی به‌وجود آمده‌اند. این مولکول‌ها قادرند، نور را توسط کروموفورهای خود جذب کرده، مسیرهای پیام رسانی خاصی را در سلو‌ل‌ها به راه انداخته و سبب بروز پاسخ مناسب در سلول شوند. شاخه جدیدی از علم به‌ نام اپتوژنتیک تلاش می‌کند تا از گیرنده های نوری به عنوان ابزارهای مولکولی جهت کنترل دقیق وقایع سلولی استفاده کند. یکی از راه‌های توسعه اپتوژنتیک، شناسایی ابزارهای مولکولی جدید دارای خصوصیات ویژه می باشد. بدین منظور تعیین خصوصیات ژن‌های پیش گویی شده‌ای که اورتولوگ گیرنده های نوری شناسایی شده می باشند، بسیار مفید خواهد بود. در پروژه تعیین توالی ژنوم Volvox carteri دو ژن پیش‌گویی‌شده متعلق به خانواده‌ی Cryptochrome/Photolyase شناسایی شد. هدف از این مطالعه، جداسازی توالی‌های کدکننده‌ی این دو ژن، همسانه‌سازی دو ژن مذکور در داخل وکتور بیانی و تعیین موقعیت قالب خواندن باز آن‌ها در خانواده کریپتوکروم/فتولیاز می‌باشد. بدین منظور، جلبک V.carteri تحت شرایط بهینه رشد داده شد. سپس با استفاده از تکنیک RT-PCR توالی‌های کدکننده‌‌‌‌‌‌‌‌‌‌‌‌‌‌‌‌‌‌ی این دو ژن تکثیر شد. با استفاده از تکنیک مهندسی ‌ژنتیک قطعات تکثیر شده وارد وکتور بیانی pGEX2TK گردید. به منظور همسانه‌سازی وکتور نوترکیب، پلاسمیدها وارد باکتریEscherichia coliگردیدند و سپس تعیین توالی شدند. نتیجه پژوهش نشان داد که توالی‌های ثبت‌شده در پایگاه داده‌ای NCBI به عنوان توالی mRNA برای دو ژن کریپتوکروم DASH، با توالی آن‌ها در ولوکس تفاوت هایی را نشان می دهد.

واژه های کلیدی: همسانه‌سازی، وکتوربیانی، گیرنده های نوری، اپتوژنتیک

* نویسنده مسئول، تلفن: 33392706-041 و 09144033450، پست الکترونیکی: [email protected]

مقدمه

 

موجودات فتوسنتزکننده از نور، انرژی و اطلاعات موجود در محیط پیرامون خود را کسب می‌کنند. در این موجودات سیستم‌های نوری فتوسنتز برای کسب انرژی تکامل پیدا کرده‌اند. درک اطلاعات محیط با استفاده از نور توسط سیستم‌های پیام‌رسانی ویژه‌ای که در این موجودات تکامل یافته‌اند، انجام می‌شود. اولین بخش از این سیستم‌ها، سنسورهای پروتئینی گیرنده‌ی نور می‌باشد. این مولکول‌ها قادرند، نور را توسط کروموفورهای خود جذب کنند و مسیرهای سیگنالینگ خاصی را براه اندازند که باعث بروز پاسخ مناسب در سلول‌ها می‌شود. گیرنده‌های نوری را می توان از جنبه‌های مختلفی مانند نوع عملکرد، طیف جذبی، نوع کروموفور، محل استقرار درون سلولی، ساختار دمین آپوپروتئینی، ساختار سوم و چهارم و سیگنال خروجی آن‌ها طبقه‌بندی نمود. برخلاف تنوع عملکردی و ساختاری فراوان، گیرنده‌های نوری اغلب از دو بخش اصلی تشکیل شده‌اند که شامل  بخش درک‌کننده نور و بخش انتقال‌دهنده‌ سیگنال می‌باشد. در بین موجودات، ریزجلبک‌های متحرک، سیستم‌های حسگر خود را بمنظور ردیابی مستمر نور، بطور ماهرانه‌ای توسعه داده‌اند و از این طریق قادرند اطلاعات مورد نیاز را از محیط پیرامون کسب کرده و فعالیت‌های فیزیولوژیکی خود را، با تغییرات محیطی هماهنگ کنند (6،7،8،9). کیانیان مومنی (2014)، گیرنده های نوری جلبکی را بدین طریق دسته بندی نمود:

1. LOV‑containing algal photoreceptors

              1.1 Phototropins

              1.2 Aureochromes

              1.3 Neochromes

2. Cryptochromes

              2.1 Plant-like Cryptochromes

              2.2 Animal-like Cryptochromes

              2.3 DASH- Cryptochromes

3. Phytochromes

4. Rhodopsin‑like photoreceptors

            4.1 Channelrhodopsins

            4.2 Histidine kinase rhodopsins

 بجزء رودوپسین‌ها که گیرندهای نوری غشاءگذر هستند، بقیه گیرنده‌های نوری بدلیل شفاف بودن غشاهای سلولی در برابر نور، سیتوپلاسمی و محلول در آب می‌باشند. برخلاف این موارد، کمپلکس‌های‌جمع‌کننده ‌نور و مراکز واکنش فتوسنتزی بدلیل آنکه باید انرژی نور را به صورت شیبی از انرژی الکتروشیمیایی در دو سمت غشاء تبدیل کنند، کمپلکس‌های درون غشایی می‌باشند. ویژگی‌های جذبی گیرنده‌های نوری، با طیف نوری رسیده به زمین، همبستگی دارد، بطوریکه این گیرنده‌های نوری بنحوی تکامل یافته‌اند که محدوده‌ی نور نزدیک به UV (∼350 nm)، آبی و تا قرمز/قرمز دور (∼750 nm) را جذب می‌کنند (شکل 1) (6،7).

 

شکل 1- طیف نور جذب شونده توسط برخی از گیرنده‌های نوری و ساختار شماتیک نمونه‌ای از هر گروه گیرنده نوری (پایین). تصاویر پروتئین‌ها از سایت PDBe گرفته‌شده‌است. عدد دسترسی نمونه‌ی پروتئینی فیتوکروم: 4OUR؛ کریپتوکروم: 2J4D؛ UV-B: 4DNU؛ رودوپسین: 3UG9؛ و LOV: 2Z6C است (7).

از آنجایکه زنجیره‌ی پلی‌پپتیدی سازنده‌ی پروتئین‌ها و زنجیره‌های جانبی آمینواسیدها، توان جذب محدوده‌ی نور مرئی را ندارند، بناچار در گیرنده‌های نوری، اجزای غیرپروتئینی تحت عنوان کروموفور تعبیه شده‌اند. کروموفور به صورت کووالانسی و یا غیرکووالانسی به بخش آپوپروتئینی گیرنده نوری متصل می‌شود (11). طی چند سال گذشته، تعدادی از گیرنده‌های نوری جلبکی شناسایی و بطور مختصر توصیف شده‌اند. برخی از این گیرنده‌های نوری، نسبت به گیرنده‌های نوری کلاسیک، ویژگی‌های جدیدی را نشان می‌دهند، بطوریکه درک ما را از مکانیسم‌های مولکولی سیستم‌های حسگر نور و فرآیندهای سلولی تنظیم‌شده توسط نور، بهبود می‌بخشند. با افزایش اطلاعات درباره‌ی نحوه‌ی عملکرد گیرنده‌های نوری و مسیرهای سیگنالینگ مرتبط با آن‌ها، محققان توانسته‌اند، از این Photo-sensitive modules مربوط به گیاهان و جلبک‌ها، ابزارهای مولکولی جهت کنترل دقیق وقایع سلولی ایجاد نمایند. به این زمینه جدید که تحقیقات پایه‌ای مربوط به مسیرهای سیگنالینگ کنترل شونده توسط نور را به تحقیقات کاربردی ارتباط می‌دهد، اپتوژنتیک گفته می‌شود. گیرند‌های نوری و اجزای موجود در مسیر سیگنالینگ نور، بعنوان ابزارهای بالقوه‌ی این زمینه علمی، مطرح می‌باشند. بدین ترتیب با افزایش تعداد گیرنده‌های نوری شناخته‌شده و تعیین ویژگی‌های آن‌ها، محدودیت‌های پیش روی این زمینه‌ی علمی نوظهور بیش از پیش برداشته می‌شود (10). در بین گروه‌های گیرنده نوری فوق، شاخه کریپتوکروم‌های DASH از لحاظ مکانیسم عمل و اثرات فیزیولوژیک، کمتر شناخته شده‌اند. همچنین از آنجایی که این پروتئین‌ها از نظر ساختاری حدواسط DNA فتولیازها و کریپتوکروم‌ها هستند، تعیین خصوصیات آن‌ها در موجودات مختلف می‌تواند راه‎گشای مسیر تکامل در درون خانواده‌ی Cryptochrome/Photolyase باشد. بدلیل اهمیت جلبک‌ها به عنوان مدل در بیوتکنولوژی صنعتی و تحقیقات پایه‌ای و همچنین ظهور تکنیک‌های تعیین‌توالی ژنوم باتوان عملیاتی بالا، ژنوم مربوط به تعدادی از جلبک‌ها، مانند Volvox carteri و Chlamydomonase reinhrdtii تعیین توالی شده‌اند. Prochnik و همکاران (2010) ژنوم 138 مگابازی Volvox carteri را تعیین توالی و پروتئین‌های کدشونده توسط این ژنوم را پیش‌گویی کردند که در پایگاه داده‌ای NCBI قرار داده شده است (12). مطالعه آن‌ها نشان داد که در این جلبک دو ژن DASH-کریپتوکروم متعلق به خانواده‌ی Cryptochrome/Photolyase کد می‌شود. با توصیف پروتئین‌های این دو جایگاه، شاید تا حدودی ابهام‌های مربوط به چگونگی عملکرد این گروه از پروتئین‌ها، نقش آن‌ها در جلبک فوق و توانایی بالقوه‌ی آن‌ها به عنوان ابزارهای اپتوژنتیک مشخص شود. به منظور استحصال مقدار مناسب پروتئین برای پژوهش‌های ساختاری و عملکردی آینده نیاز به تهیه سازه بیانی بمنظور تولید آن‎ها در سیستم‌های تولید پروتئین است (1،2). در پژوهش حاضر توالی کدکننده‌ی این دو ژن درون وکتوربیانی pGEX2TK کلون شد و توالی دقیق نوکلئوتیدی آن‌ها مشخص گردید.

مواد و روشها

تهیه جلبک، کشت و نمونه برداری: جلبک Volvox carteri f. nagariensis strains Eve10 (female)  توسط دکتر آرش کیانیان اهدا گردید. جلبک در محیط کشت SVM (13) در دمای 28 درجه سانتیگراد و تحت چرخه نوری 8 ساعت تاریکی و 16 ساعت روشنایی مربوط به نور سفید حاصل از لامپ LED با شدت نور تقریبی به طور میانگین 1700 لوکس رشد داده شد. پس از رسیدن کشت‌ها به بیوماس مناسب، نمونه برداری به منظور استخراج RNA انجام شد.

استخراجRNA ‌: با استفاده از TRI Reagent (Sigma-Aldrich, St. Louis, MO) مطابق دستورالعمل شرکت سازنده، استخراج RNA انجام شد. بترتیب، کمیت و کیفیت RNA استخراج‌شده توسط بیوفتومتر (Eppendorf, Germany)، تعیین نسبت جذب 260/280 و الکتروفورز برپایه ژل آگارز مشخص شد. در نهایت RNA در 70- درجه سانتیگراد نگهداری شد.

سنتز cDNA: ابتدا 1 میکروگرم RNA استخراج شده با استفاده از کیت DNaseI (Thermo Scientific, USA) تحت واکنش هضم DNA ژنومی قرارگرفت. سپس RNA پاکسازی شده، توسط کیت RevertAid First Strand cDNA Synthesis (Thermo Scientific, USA)، با استفاده از آغازگر Oligo dT و براساس پروتکل شرکت سازنده، برای سنتز cDNA مورد استفاده قرارگرفت.

طراحی آغازگرها: بدین منظور ابتدا توالی نوکلئوتیدی مربوط به دو ژن VcCryDASH1 و VcCryDASH2 با استفاده از سرور تحت‌وب BLASTp با به کاربردن توالی پروتئینی AtCry3 (با شماره دسترسی Q84KJ5 در Uniprot) و SynDASH (با شماره دسترسی P77967 در Uniprot) بعنوان مبنا و جستجو در پروتئومیکس ثبت شده از Volvox carteri در پایگاه داده‌ای NCBI شناسایی شدند. سپس با بررسی EST مربوط به این توالی‌ها، توالی دقیق کدکننده‌ی این ژن‌ها بازیابی شد. آغازگرها طوری طراحی شدند که دارای جایگاه برشی مربوط به آنزیم‌های برشی Bam HI، Eco RI و Bgl II باشند.

انجام PCR برای تکثیر قطعه‌ی کدکننده‌ی دو ژن VcCryDASH1 و VcCryDASH2 و تخلیص آن‌ها: بمنظور تکثیر قطعه کدکننده‌ی VcCryDASH1 (طول محصول پیش بینی شده برابر 1663 جفت باز)  و VcCryDASH2 (طول محصول پیش بینی شده برابر 2233 جفت باز) از آغازگرهای جدول 1 استفاده شد. واکنش PCR با استفاده از آنزیم Pfu-DNA polymerase (Vivantis) مطابق دستورالعمل شرکت سازنده‌ی آنزیم انجام شد. سپس الکتروفورز روی ژل آگارز انجام گردید و قطعات دارای اندازه‌ی مورد نظر توسط کیت PureLinkTM Quick  (Thermo Scientific) مطابق دستورالعمل شرکت سازنده، از ژل استخراج شدند.


جدول 1- توالی آغازگرهای استفاده‌ شده برای تکثیر قالب باز خواندن دو ژن VcCryDASH1 و VcCryDASH2

توالی آغازگر

نام ژن

AAGGATCCATGGCCGCCGCCGGCTG  (آغازگر رفت)

VcCryDASH1

AAGAATTCCTACGCATACCCACCCGAGC (آغازگر برگشت)

 

AAAGATCTATGGCGATGCCTGGTACGG (آغازگر رفت)

VcCryDASH2

AAGAATTCTTACGTCTGTGCCTTGGCCT (آغازگر برگشت)

 

 


انجام واکنش تجزیه آنزیمی روی قطعات تکثیرشده و پلاسمید pGEX2TK: واکنش تجزیه آنزیمی با استفاده از آنزیم‌های Eco RI، Bam HI و Bgl II (Thermo) مطابق دستورالعمل شرکت سازنده برروی قطعات کدکننده‌ی ژن‌های VcCryDASH1 و VcCryDASH2 و همچنین برروی پلاسمید pGEX2TK (GE Healthcare Life Sciences) انجام شد. برروی محصولات واکنش برشی الکتروفورز در ژل آگارز انجام و قطعات مربوط به توالی‌های کد کننده‌ و پلاسمید برش خورده، توسط کیت PureLinkTM Quick از ژل استخراج شد. 

ایجاد سازه نوترکیب با استفاده از CDSهای تکثیرشده‌ی مربوط به دو ژن  VcCryDASH1 و VcCryDASH2: پلاسمیدهای نوترکیب pGEX2TK-VcCryDASH1 و pGEX2TK-VcCryDASH2 توسط وارد کردن قطعات حاصل از برش به درون وکتور pGEX2TK برش‌یافته با استفاده از T4-DNA ligase (Thermo Scientific) مطابق دستورالعمل شرکت سازنده انجام شد.

کشت باکتریE.coli سویه Top10 (Invitrogen) و انتقال ژن به آن: محیط کشت LB مایع دارای آنتی‌بیوتیک استرپتومایسین (100 میکروگرم بر میلی لیتر) برای کشت باکتری مورد استفاده قرارگرفت. باکتری‌ها توسط محلول TSS مستعدسازی شدند. سپس 5 مایکرولیتر از محصول واکنش اتصال، برای تراریختی باکتری با بکارگیری روش شوک حرارتی TSS، استفاده شد (4). بمنظور انتخاب باکتری‌های تراریخت‌شده‌ی دارای وکتور نوترکیب، از محیط کشت LB جامد حاوی آنتی‌بیوتیک آمپیسیلین (50 میکروگرم بر میلی لیتر) و انجام PCR-Colony استفاده شد.

استخراج پلاسمید از باکتری‌های دارای قطعه‌ی کدکننده‌ی ژن‌ها، انجام هضم آنزیمی روی پلاسمیدهای نوترکیب و تعیین‌توالی: باکتری‌های دارای پلاسمید نوترکیب در LB مایع دارای آنتی‌بیوتیک انتخابگر، کشت داده شدند. استخراج پلاسمید با استفاده از کیت استخراجAccuPrep® Plasmid Mini Extraction Kit (BIONEER, Korea) مطابق دستورالعمل شرکت سازنده انجام شد. بمنظور تایید بیشتر بر روند مهندسی‌سازه، پلاسمیدهای استخراج‌شده تحت واکنش هضم آنزیمی قرار گرفتند. پس از تایید حضور قطعات در وکتور، نمونه‌ها برای تعیین‌توالی به شرکت توپازژن (ایران) ارسال شد.

بازیابی توالی‌های پروتئینی مربوط به خانواده‌ی ژنی Cryptochrome/DNA photolyase و ترسیم درخت تکاملی: با استفاده از سرور BLASTp (3) توالی‌های دو ژن VcCryDASH1 و VcCryDASH2 در مقابل پایگاه‌های داده‌ای Uniprot (www.uniprot.org) و PDB (www.rcsb.org) مورد جستجو قرار گرفت. توالی‌های پروتئینی توصیف شده‌ی مربوط به خانواده‌ی Cryptochrome/DNA photolyase در موجودات مختلف بازیابی شدند و توسط نرم‌افزار تحت‌وب Clustal Omega (15) همردیف‌سازی توالی‌ها انجام شد. همردیف‌سازی با استفاده از نرم افزار BioEdit V7.0.9 (5) بهینه شد. در نهایت با استفاده از نرم افزار MEGA5 (16) توسط روش‌های Maximum likelihood و Neighbor-Joining (14) درخت فیلوژنیک ترسیم شد.

نتایج و بحث

با توجه به بررسی‌های in silico انجام شده، برای CDS  ژن‌های VcCryDASH1 و VcCryDASH2 بترتیب دو توالی (توالی 3078bp ثبت‌شده در NCBI با شماره دسترسی XM_002953647 و توالی 1710bp حاصل از بررسی‌ EST) و یک توالی نوکلئوتیدی (توالی 2217bp ثبت‌شده در NCBI با شماره دسترسی XM_002955358) وجود دارد. دو توالی مربوط به ژن VcCryDASH1 در بخش بزرگی در ناحیه‌ی 5' یکسان هستند و تفاوت در توالی نوکلئوتیدی3' است (نتایج حاصل از این بررسی نشان داده نشده است). بدین ترتیب برای ژن فوق یک آغازگر رفت و دو آغازگر برگشت طراحی شد. توسط آنزیم پلی‌مراز دارای قابلیت تصحیح‌کنندگی، PCR انجام شد. برای ژن VcCryDASH1 و VcCryDASH2 از دمای اتصال 58 °C  استفاده شد. شکل 2 تصویر ژل الکتروفورز محصولات PCR برای تکثیر قطعات کدکننده‌ی دو ژن فوق می باشد. همانطور که مشخص است در مورد ژن VcCryDASH1 طول قطعه‌ی ایجادشده با طول قطعه‌ی حاصل از بررسی EST همخوانی بیشتری دارد.


 

 

1

2

M

 

 

 


شکل 2- الکتروفورز ژل آگارز قطعات تکثیر شده با PCR. ستون 1: حاوی باند مربوط به VcCryd1؛ ستون 2: حاوی باند مربوط به VcCryd2.

 

پس از تکثیر قطعات کدکننده و تخلیص از ژل، واکنش هضم آنزیمی بر روی آن‌ها و همچنین وکتور بیانی pGEX2TK انجام شد. پس از تخلیص قطعات و وکتور برش‌یافته از ژل، واکنش اتصال اجرا گردید. تراریختی باکتریE.coli سویه‌ی Top10 با استفاده از روش شوک حرارتی TSS انجام شد. همسانه‌های مشاهده‌شده در سطح محیط انتخابی توسط روش کلنیPCR (شکل‌ 3)، استخراج پلاسمید و همچنین هضم آنزیمی پلاسمید استخراج‌شده مورد بررسی قرار گرفتند (شکل 4 و 5). سپس تعیین توالی قطعات مذکور انجام شد. انجام BLAST (BLASTn و BLASTp) نشان داد که این دو توالی نوکلئوتیدی متعلق به جلبکVolvox carteriهستند (جدول 2).

نتایج حاصل از تعیین‌توالی با استفاده از نرم‌افزارهای تحت‌وب به توالی آمینواسیدی متناظر با آن تبدیل شدند (شکل6 و 7).

M

P

P

P

N

N

N

N

N

الف

 

 

P

P

P

P

M

P

P

N

N

N

N

N

N

ب

 

شکل 3- ژل الکتروفورز محصولات واکنش کلنی PCR برای ژن VcCryDASH1 (الف) و VcCryDASH2 (ب). M : مارکر P: مشخص کننده‌ی همسانه‌های مثبت؛ N: مشخص‌کننده‌ی همسانه‌های منفی.

pGEX2TK::Vcryd1

pGEX2TK

VcCryd1

pGEX2TK

1

M

3

2

2

1

 

 

 

 

 

 

 

 


شکل 4- ژل الکتروفورز استخراج پلاسمید نوترکیب pGEX2TK::Vcryd1 و برش آنزیمی آن. ستون 1: پلاسمید نوترکیب pGEX2TK::Vcryd1 که توسط یک آنزیم برشی هضم شده است؛ ستون 2: پلاسمید pGEX2TK که توسط یک آنزیم برشی هضم شده است؛ ستون 3: پلاسمید نوترکیب pGEX2TK::Vcryd1 که توسط دو آنزیم برشی هضم شده و قطعه‌ی وارد شده از آن خارج شده است؛ M: مارکر.

1

2

3

4

5

6

M

شکل 5- ژل الکتروفورز استخراج پلاسمید نوترکیب pGEX2TK::Vcryd2 و برش آنزیمی آن. ستون‌های 1، 2 و 4: برش pGEX::VcCryd2با استفاده از آنزیم EcoRI؛ ستون 3: برش pGEX2TK با استفاده از آنزیم EcoRI؛ ستون‌های 5 و 6: به ترتیب مربوط به استخراج پلاسمید از کلون های حاوی pGEX::VcCryd2 و pGEX2TK.

 

 

شکل 6- توالی نوکلئوتیدی استنباط شده از تعیین توالی VcCryDASH1 و توالی آمینواسیدی متناظر با آن‌ها.

 

 

 

 

شکل 7- توالی نوکلئوتیدی استنباط شده از تعیین توالی VcCryDASH2 و توالی آمینواسیدی متناظر با آن‌ها.

 

 

جدول 2- نتیجه حاصل از BLASTn برای VcCryDASH1(بالا) و VcCryDASH2 (پایین).

Accesion

Ident

E value

Query cover

Total score

Max score

Organism name

 

99%

0.0

99%

5256

2571

Volvox carteri f. nagariensis

XM_002959699.1

98%

0.0

39%

1137

876

Volvox carteri f. nagariensis

XM_001701819.1

82%

0.0

48%

676

676

Chlamydomonas reinhardtii

 

Accesion

Ident

E value

Query cover

Total score

Max score

Organism name

XM_002955358.1

99%

0.0

88%

3853

2778

Volvox carteri f. nagariensis

 

 

از تعیین ساختمان اولیه‌ی این دو پروتئین، دمین‌های عملکردی این دو قالب باز خواندن با استفاده از سرورهای Pfam، CD-NCBI، Motif Scan، InterPro Scan و ProDom تعیین شدند، که تصویر شماتیک مربوط به آن‌ها در شکل 8 آورده شده است.

 

B

A

شکل 8- دمین‌های پیش‌گویی شده در پروتئین‌های VcCryDASH1 (A) و VcCryDASH2 (B). دمین قرمز رنگ: DNA Photolyase Domain؛ دمین آبی رنگ: FAD Binding Domain.

 

همانطور که انتظار می‌رفت، این دو پروتئین دارای دمین‌هایی هستند که در تمام اعضاء خانواده‌ی پروتئینی Cryptochrome/Photolyase وجود دارند. بدین ترتیب مشخص‌شد که این دو پروتئین در این خانواده قرار می‌گیرند. بمنظور تعیین موقعیت این دو پروتئین در این خانواده، با استفاده از توالی آمینواسیدی آن‌ها و توالی‌های آمینواسیدی مربوط به اعضاء خانواده‌ی Cryptochrome/Photolyase در موجودات مختلف، که از پایگاه‌های‌ داده‌ای Uniprot و NCBI بدست آمده بودند، توسط نرم‌افزار‌ Mega 5 درخت فیلوژنتیک رسم شد (شکل 9). همانطور که در درخت مذکور مشخص است این دو پروتئین در شاخه مربوط به کریپتوکروم‌های DASH قرار می‌گیرند و قالب باز خواندن آن‌ها هم همان‌طور که انتظار می‌رفت در گروه کریپتوکروم‌های DASH قرار می‌گیرند.

با مقایسه‌ی توالی نوکلئوتیدی کدکننده‌ی بدست آمده از توالی‌یابی و توالی ژنی موجود در NCBI، محل دقیق اگزون‌ها برای هر دو ژن VcCryDASH1 و VcCryDASH2 مشخص شد. مقایسه بین اگزون‌های پیش‌گویی شده (ثبت‌شده در NCBI) و تعیین‌شده در این پژوهش نشان داد که در ژن VcCryDASH1 به جای 20 اگزون (که در NCBI ثبت شده است)، فقط 11 اگزون وجود دارد. اگزون‌های 1 تا 8 آن‌ها دارای موقعیت یکسان می‌باشند اما موقعیت اگزون‌های 9، 10 و 11 در آن‌ها تفاوت دارد.

 

شکل 9- درخت تکاملی ترسیم شده  توسط توالی‌های پروتئینی اعضاء خانواده‌ی Cryptochrome/Photolyase توسط روش Maximum liklehood.  مربع سبز رنگ موقعیت کلاد Animal-like Cryptochromes، مربع قرمز رنگ کلاد DASH Cryptochromes  و  مربع آبی رنگ موقعیت کلاد Plant-like Cryptochromes را نشان می‌دهند. پیکان‌ها محل دو ژن مورد مطالعه را نشان می‌دهند.

همچنین بقیه‌ی اگزون‌های موجود در ژن ثبت‌شده در NCBI تکرار مربوط به اگزون‌های 4 تا 11 آن می‌باشند. اگزون شماره‌ی 20 در ژن ثبت‌شده در NCBI منحصربفرد است و هیچ همتایی در توالی‌کدکننده‌ی VcCryDASH1 حاصل از توالی‌یابی انجام‌شده در این پژوهش ندارد. توالی VcCryDASH2 ثبت‌شده در NCBI دارای 13 اگزون می باشد در حالی ‌که توالی حاصل از این پژوهش فقط 12 اگزون دارد. مقایسه بین موقعیت اگزون‌ها VcCryDASH2 مربوط به توالی‌کدکننده‌ی حاصل از این پژوهش با توالی ژن ثبت‌شده در NCBI نشان داد که اگزون 1 تا 7 کاملا مشابه است و فقط در اگزون 6 حاصل از توالی‌یابی، کدون GAA (مربوط به اسیدآمینه‌ی گلوتامات) در 5' اگزون وارد نمی‌شود. تفاوت اصلی در این دو توالی بین اگزون‌های 8 تا 11 می‌باشد (شکل 10). با توجه به بررسی‌های بیوانفورماتیکی انجام شده مشخص شد که اگزون‌‌های 1 تا 3 در توالی ژن مربوط به VcCryDASH1 منحصربفرد بوده در حالی که اگزون‌های 4 تا 11 دارای دو نسخه‌ی تقریبا مشابه (در برخی از اگزون‌ها دو نسخه‌ از اگزون کاملا یکسان بوده اما در برخی دیگر از آن‌ها حذف‌شدگی یا اضافه‌شدگی و یا تغییر، مشاهده می‌شود) می‌باشد. به عنوان مثال اگزون شماره‌ی 4 با اگزون شماره‌ی 12 و یا اگزون 5 با اگزون  13 مشابه می باشد. با بررسی بیوانفورماتیکی بر روی اورتولوگ این ژن در کلامیدوموناس مشاهده شد که این ارگانیسم دارای یک ژن 11 اگزونی می‌باشد (این بررسی‌ها در مقاله نشان‌داده نشده است). از آنجائیکه ولوکس و کلامیدوموناس دارای مسیر تکاملی یکسانی بوده‌اند وبنظر می‌رسد که کلامیدوموناس نیای ولوکس باشد، می‌توان این احتمال را مطرح کرد که وجود اگزون‌های 12 تا 19 ناشی از وقوع دوبرابر‌شدگی اگزونی در ولوکس می‌باشد. همچنین وقوع جهش‌های مختلف را می‌توان دلیل عدم تشابه کامل بین اگزون‌های مشابه در نظر گرفت. شاید وقوع این رخداد درمسیر تکامل آینده و قدرت بقاء ولوکس تاثیر گذار باشد، به‌ گونه‌ای که در طول تکامل اگزون‌های حاصل از دوبرابرشدگی عملگر شده و باعث ایجاد پروتئین جدید با قابلیت اصلاح‌شده و یا حتی کاملا متفاوت از پروتئین اولیه گردد.

تشکر و قدردانی

این پروژه با حمایت مالی مرکز مطالعات و همکاری های علمی بین المللی انجام شده است و از این طریق از مسوولین مربوطه تشکر و قدردانی می شود.

 

 

 

اگزون 9

اگزون 8

اگزون 8

NCBId2 1141 CGAAGAGCGCTACAGCGCCTTCAGGAGCTGGTCGGGTTGGACTACAGCCAGCTACTGCCG
Vcd2   1141 CGAAGAGCGCTACAGCGCCTTCAGGAGCTGGTCGGGTTGGACTACAGCCAGCTACTGCCG


NCBId2 1201 CCAGTAGAGCCCGAAGGGCCACCGGCGCCACACGACCCGCGTACGGCATTTCCCTTCCAC
Vcd2   1201 CCAGTAGAGCCC---GGGCCACCGGCGCCACACGACCCGCGTACGGCATTTCCCTTCCAC


NCBId2 1261 GCCGGCTACAGCAGCGCCGTACGCCGCCTGCGGTACTACGTTTGGGGCCACCCGGAAGGG
Vcd2   1258 GCCGGCTACAGCAGCGCCGTACGCCGCCTGCGGTACTACGTTTGGGGCCACCCGGAAGGG


NCBId2 1321 GCTCCCCCGGAGCTGCCAAGCGACCCACGGGACGGCGCCGGATCCAGCTCCCAGCCGCAT
Vcd2   1318 GCTCCCCCGGAGCTGCCAAGCGACCCACGGGACGGCGCCGGATCCAGCTCCCAGCCGCAT


NCBId2 1381 GGGGCCCCCGTGAGCTCTCCACCCTCGTTGCTGTATTTCACCAACACCCGGGCGCAGGCG
Vcd2   1378 GGGGCCCCCGTGAGCTCTCCACCCTCGTTGCTGTATTTCACCAACACCCGGGCGCAGGCG


NCBId2 1441 GTTGGTGTGGACAGCAGCACTAAGTTGTCGCCCTTCGTGGCGCTGGGCTGCATCACGTCG
Vcd2   1438 GTTGGTGTGGACAGCAGCACTAAGTTGTCGCCCTTCGTGGCGCTGGGCTGCATCACGTCG


NCBId2 1501 CGCCAAATACATGAGGAGCTGTCGACCACACCA----CCGCTTCC-CGGGTCCTGTTTTG
Vcd2   1498 CGCCAAATACATGAGGAGGTGGAGCAGGTACGAGCAGCTGCTACTGCGGCTGCTGCT---


NCBId2 1556 GAACCCTTGTAAGCTCCCCCTTCGCCCTGGCGGGGGTCAACCCTGCATGGGTC-------
Vcd2   1555 --ACTGCTGCATGCAGAGC---CACACTGGCAGATACTGCAGCAGCAGGAGCAGGAGCAG


NCBId2 1609 -------------TGTATCCGCGCGCGGTG---CACGTGCAGGTGG--------------
Vcd2   1610 GAGAAATAGCCCGTGCAGCGGCGGGTGGTGGGCAGCGTGGGGCCGGCGCTACTGCCAACC


NCBId2 1639 --------------------------AGCAGTAGCTCAGTACCAGCCCCCGCCGAGTGTG
Vcd2   1670 CCGGCCCGGCCTCCCCTCCCCCCGGCGGCAGTAGCTCAGTACCAGCCCCCGCCGAGTGTG

اگزون 10



NCBId2 1673 ATTGGCTGGCCATGCACCTGTGCATCCGGGACTTCTTCATCTTCACGACGCTCAAGGAGG

اگزون 9

Vcd2   1730 ATTGGCTGGCCATGCACCTGTGCATCCGGGACTTCTTCATCTTCACGACGCTCAAGGAGG


NCBId2 1733 GTGATGCCGTACTGGACGAACGGGGCATTATGGGTCTCCCCGTCAGCTGGCGGAACGACA
Vcd2   1790 GTGATGCCGTACTGGACGAACGGGGCATTATGGGTCTCCCCGTCAGCTGGCGGAACGACA


NCBId2 1793 TGGAGACATTCACTCGGTGGGCCCAGGGCCGCACGGGTCTCCCCTTCGTGGACGCCAACA
Vcd2   1850 TGGAGACATTCACTCGGTGGGCCCAGGGCCGCACGGGTCTCCCCTTCGTGGACGCCAACA


NCBId2 1853 TGCGGGAGCTGGCGGTCACCGGCTGGATGAGCAACCGGGGCCGACAGAACGTGGCTAGCT
Vcd2   1910 TGCGGGAGCTGGCGGTCACCGGCTGGATGAGCAACCGGGGCCGACAGAACGTGGCTAGCT


NCBId2 1913 TGCTGACCAAGGACCTGGGGGTAGACTGGAGATGGGGTGCGGAGCTGTTTGAGAGCTTGT
Vcd2   1970 TGCTGACCAAGGACCTGGGGGTAGACTGGAGATGGGGTGCGGAGCTGTTTGAGAGCTTGT


NCBId2 1973 TGGTGGATTGCGATGTGGCGGTTAACTATTGCAACTGGAATTACTTTGCTGGTATCGGGA
Vcd2   2030 TGGTGGATTGCGATGTGGCGGTTAACTATTGCAACTGGAATTACTTTGCTGGTATCGGGA

NCBId2 2033 ACGACCCACGCAATCGCCATTTCAAGACCGTGACT-------------------------
Vcd2   2090 ACGACCCACGCAATCGCCATTTCAAGACCGTGACTCAGGGCATGAAGTACGACGAGGATG

اگزون 13

اگزون 12



NCBId2 2068 -----------------------------------------------------------C
Vcd2   2150 CCGCGCTCGCCGCTACATGGCTGCCCGAGCTGGCCGCTCTACCGCCCGCTCCCCGCCACC

اگزون 11

اگزون 11

اگزون 10

اگزون 12

 

 

NCBId2 2069    AGCCCTGGGCCATGACGGCGGAGGAAGCTGAGCAGTACAGCTTTGTACTGGGCCGCGATT
Vcd2   2210    AGCCCTGGGCCATGACGGCGGAGGAAGCTGAGCAGTACAGCTTTGTACTGGGCCGCGATT


NCBId2 2129    ACCCTTTTCCTTTGGTCGACCCGGCTAACCATGTCGGCCAGCTGACGGGCACGGGGAAGC
Vcd2   2270    ACCCTTTTCCTTTGGTCGACCCGGCTAACCATGTCGGCCAGCTGACGGGCACGGGGAAGC


NCBId2 2189    GCAGGAACAAGGCCAAGGCACAGACGTAA
Vcd2   2330    GCAGGAACAAGGCCAAGGCACAGACGTAA

شکل 10- مقایسه‌ی توالی کدکننده‌ی VcCryDASH2 ثبت‌شده در NCBI (NCBId2) و تعیین‌شده در این پژوهش (Vcd2). فلش‌های نمایش داده‌شده در بالای همردیفی مربوط به موقعیت اگزون در توالی NCBId2 و در پایین آن مربوط به توالی Vcd2 می‌باشد.

1- شجاع ز، رجبی معماری ح، رعایایی اردکانی م. 1394. جداسازی، همسانهسازی و بیان ژن زیرواحد آلفا فیکوسیانین در سیستم بیانی اشرشیاکلی. مجله پژوهشهای سلولی و مولکولی (مجله زیست شناسی ایران). 28 (3). 352-359.
2- یزدان پناه سامانی م، زمانی م. ر، مطلبی م، مقدسی جهرمی ز. 1394. بیان هترولوگ آنزیم کیتیناز 36 کیلو دالتونی از قارچ  Trichoderma atrovirideدر میزبان پروکاریوتی. مجله پژوهشهای سلولی و مولکولی  (مجله زیست شناسی ایران). 28 (3). 448-457.
 
3-Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990. Basic local alignment search tool. Journal of Molecular Biology, 215:403-410.
4-Chung CT, Niemela SL, Miller R H. 1989. One-step preparation of competent Escherichia coli: Transformation and storage of bacterial cells in the same solution. Proceedings of the National Academy of Sciences of the United States of America, 86: 2172-2175.
5-Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series, 41: 95–98.
6-Hegemann P, Fuhrmann M, Kateriya S. 2001. Algal sensory photoreceptors. Journal of Phycology, 37: 668–676.
7-Heintzen C. 2012. Plant and fungal photopigments. WIREs Membrane Transport and Signaling, 1:411–432.
8-Kianianmomeni A, Hallmann A. 2014. Algal photoreceptors: in vivo functions and potential applications. Planta , 239:1–26.
9-Masuda S. 2013. Light detection and signal transduction in the BLUF photoreceptors. Plant & Cell Physiology, 54(2): 171–179.
10-Mathes T.  2016. Natural resources for optogenetic tools. In: Kianianmomeni A(Ed.) Methods in Molecular Biology: Optogenetics Methods and Protocol. Humana Press, 19-36.
11-Moglich A, Yang X, Ayers RA, Moffat K. 2010. Structure and function of plant photoreceptors. Annual Review of Plant Biology, 61:21-47.
12-Prochnik SE, Umen J, Nedelcu AM, Hallmann A, Miller SM, Nishii I, Ferris P, Kuo A, Mitros T, Fritz-Laylin LK, Hellsten U, Chapman J, Simakov O, Rensing SA, Terry A, Pangilinan J, Kapitonov V, Jurka J, Salamov A, Shapiro H, Schmutz J, Grimwood J, Lindquist E, Lucas S, Grigoriev IV, Schmitt R, Kirk D, Rokhsar DS. 2010. Genomic analysis of organismal complexity in the multicellular green alga Volvox carteri. Science, 329(5988):223-226.
13-Provasoli L, Pintner IJ. 1959. Artificial media for freshwater algae: problems and suggestions. In: Tyron CA, Hartman RT (Eds.) The Ecology of Alga. Pymatuning Laboratory of Field Biology, University of Pittsburgh, Pittsburgh, 84–96.
14-Saitou N, Nei M . 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution, 4: 406–425.
15-Sievers F, Higgins DG. 2014. Clustal Omega, Accurate Alignment of Very Large Numbers of Sequences. In: Russell D. (eds) Multiple Sequence Alignment Methods. Methods in Molecular Biology (Methods and Protocols), vol 1079. Humana Press, Totowa, NJ.(book)
16-Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011. MEGA5: Molecular Evolutionary Genetics Analysis Using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Molecular Biology and Evolution, 28(10):2731-2739.