نوع مقاله : مقاله پژوهشی

نویسندگان

1 دانشجوی کارشناسی ارشد بیوتکنولوژی دانشگاه زابل

2 استادیار گروه اصلاح نباتات و بیوتکنولوژی دانشگاه زابل

3 استادیار گروه باغبانی دانشگاه هرمزگان

4 استادیار مرکز تحقیقات کشاورزی و منابع طبیعی استان هرمزگان، (بندرعباس)

چکیده

با توجه به اهمیت اقتصادی خرما، در این پژوهش تنوع ژنتیکی 14 رقم نر و 26 رقم ماده نخل خرما با استفاده از آغازگر SSR مورد ارزیابی قرار گرفت. استخراج DNA به روش CTAB انجام شد و با استفاده از 10 جفت آغازگر SSR تکثیر گردید. محصولات تکثیر شده با استفاده از ژل اکریل آمید 8% و رنگ‌آمیزی با نیترات نقره مشاهده شدند. با استفاده از نرم افزار Gene Alex6.3 نتایج مربوط به تعداد آلل مشاهده شده، هتروزیگوسیتی مشاهده شده و محتوای اطلاعات چند شکلی محاسبه شد. از روش تجزیه خوشه‌ای Nearest joining برای گروه‌بندی استفاده شد و فاصله ژنتیکی بین ارقام از طریق ضریب تشابه نی محاسبه گردید. نتایج نشان داد که محتوای اطلاعات چند شکلی از 63% برای آغازگر HQ542225‌ تا 85% برای آغازگر HQ542208 و با متوسط 77% متغیر بود. تعداد آلل در هر جایگاه از 6 تا 9 متغیر و با میانگین 6/7 بدست آمد. از 10 جفت آغازگر مورد استفاده در مجموع 76 آلل شناسایی شد که آغازگرهای HQ542208 و HQ542224 با 9 آلل بیشترین و آغازگرهای DP169 و HQ542225 با 6 آلل کمترین تعداد آلل‌ را نشان دادند. بیشترین تشابه ژنتیکی بین ارقام آلمهتری و خنیزی و کمترین میزان تشابه بین رقم ابونارنجا و سایر ارقام بود. با توجه به یافته‌های حاصل از این پژوهش، تصویر جامع‌تری از ساختار ژنتیکی ارقام نر و ماده نخل خرما بدست آمده است که استفاده از آن‌ها را برحسب مورد در برنامه بهنژادی ارقام نخل خرما ممکن می‌سازد.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Genetic diversity of date palm cultivars in Sistan and Baluchestan and Hormozgan provinces using microsatellite

نویسندگان [English]

  • Hesam Taghinejad 1
  • leila fahmideh 2
  • Davood Samsampoor 3
  • Majeed Askaryesyahooi 4

1 M.Sc. Department of Plant Breeding and Biotechnology, University of Zabol,

2 Assistant Professor of Department of Plant Breeding and Biotechnology, University of Zabol,

3 Assistant Professor, Department of Horticulture, University of Hormozgan,

4 Assistant Professor, Institute Agricultural and Natural Resources of Hormozgan

چکیده [English]

Considering the Economic importance of date palm, in this study, 14 varieties of male and 26 female cultivars of date palm were evaluated using SSR primer. DNA of young leaves of date palm was extracted by CTAB method and it was propagated by 10 pairs of SSR primers. The propagated products were observed by 8% acrylamide gel and coloring with AgNO3. Using the software Gene Alex6.3 results of alleles and observed heterozygosity and polymorphism information content were calculated. Genetic relationships among cultivars were represented by a dendrogram based on the Nei’s Genetic similarity coefficient and Nearest joining method which was considered for cluster analysis. The results showed that polymorphism information content was calculated for all pairs of primers which varied from 63% for HQ542225 to 85% for HQ542208 (mean = 77%). The number of alleles in each individual locus varied in the range of 6-9 with the mean of 7.6. The 10 primers used a total of 76 alleles were detected primers and primers HQ542208 and HQ542224 with 9 alleles most HQ542225 6 DP169 and allele showed the lowest number of alleles. The highest genetic similarity was found between Almehtary and Khanizi and the lowest one between Abonarenja and other cultivars. According to the results of this study, a more comprehensive picture of the genetic structure of male and female date palm varieties has been obtained, which makes it possible to use them according to the case study of palm date cultivars.

کلیدواژه‌ها [English]

  • Male and female cultivars
  • Genetic diversity
  • Cluster analysis
  • Date palm
  • SSR primer

تنوع ژنتیکی ارقام نخل خرما در استان­های­ سیستان و بلوچستان و هرمزگان با ریزماهواره 

حسام الدین تقی­نژاد1، لیلا فهمیده1*، داوود صمصام پور2 و مجید عسکری سیاهویی3 

1 زابل، دانشگاه زابل، دانشکده کشاورزی، گروه اصلاح نباتات و بیوتکنولوژی  

3 بندرعباس، دانشگاه هرمزگان، گروه باغبانی  

4 بندر عباس، مرکز تحقیقات کشاورزی و منابع طبیعی استان هرمزگان  

تاریخ دریافت: 2/9/96                   تاریخ پذیرش: 10/4/97 

 چکیده 

با توجه به اهمیت اقتصادی خرما، در این پژوهش تنوع ژنتیکی 14 رقم نر و 26 رقم ماده نخل خرما با استفاده از آغازگر SSR مورد ارزیابی قرار گرفت. استخراج DNA به روش CTAB انجام شد و با استفاده از 10 جفت آغازگر SSR تکثیر گردید. محصولات تکثیر شده با استفاده از ژل اکریل آمید 8% و رنگ­آمیزی با نیترات نقره مشاهده شدند. با استفاده از نرم افزار Gene Alex6.3 نتایج مربوط به تعداد آلل مشاهده شده، هتروزیگوسیتی مشاهده شده و محتوای اطلاعات چند شکلی محاسبه شد. از روش تجزیه خوشه­ای Nearest joining برای گروه­بندی استفاده شد و فاصله ژنتیکی بین ارقام از طریق ضریب تشابه نی محاسبه گردید. نتایج نشان داد که محتوای اطلاعات چند شکلی از 63% برای آغازگر HQ542225­ تا 85% برای آغازگر HQ542208 و با متوسط 77% متغیر بود. تعداد آلل در هر جایگاه از 6 تا 9 متغیر و با میانگین 6/7 بدست آمد. از 10 جفت آغازگر مورد استفاده در مجموع 76 آلل شناسایی شد که آغازگرهای HQ542208 و HQ542224 با 9 آلل بیشترین و آغازگرهای DP169 و HQ542225 با 6 آلل کمترین تعداد آلل­ را نشان دادند. بیشترین تشابه ژنتیکی بین ارقام آلمهتری و خنیزی و کمترین میزان تشابه بین رقم ابونارنجا و سایر ارقام بود. با توجه به یافته­های حاصل از این پژوهش، تصویر جامع­تری از ساختار ژنتیکی ارقام نر و ماده نخل خرما بدست آمده است که استفاده از آن­ها را برحسب مورد در برنامه بهنژادی ارقام نخل خرما ممکن می­سازد.

واژه­های کلیدی: ارقام نر و ماده، تنوع ژنتیکی، تجزیه خوشه­ای، نخل خرما، آغازگر SSR.

 * نویسنده مسئول، تلفن:  05431232124 ، پست الکترونیکی:  [email protected] 

مقدمه 

 

نخل خرما با نام علمی Phoenix dactyliferal گیاهی چند ساله و دو پایه است که در طول ادوار مختلف تاریخ بعنوان یک گیاه ارزشمند مطرح بوده و میوه آن بعنوان یک غذای مفید همواره مورد توجه انسان قرار گرفته است. در حال حاضر نیزنخل خرما یکی از محصولات باغی مهم و پر سود کشور ایران بشمار می­آید. توزیع نخل خرما تابع فاکتورهای محیطی و اکوسیستم‌های متنوع موجود در اقلیم‌های کم آب در بسیاری از کشورهای جهان می‌باشد (12). اولین قدم در اصلاح این گیاه شناسایی ارقام و دسته­بندی آن­ها است که روش­های مولکولی امکان تفکیک ارقام را فراهم آورده­اند. آغازگرهای مولکولی می­توانند بعنوان ابزاری قوی برای تشخیص افراد از منابع اصلاحی مختلف که از نظر ژنتیکی با هم شباهت دارند، مورد استفاده قرار گیرند (16). تنوع ژنتیکی با افزایش هتروزیگوسیتی باعث افزایش مقاومت گیاه به آفات و بیماری­ها می­شود و از فرسایش ژن­های مفید جلوگیری می­کند. آغازگرهای SSR ویژگی‌هایی مانند همبارزی را نشان داده‌اند. با این وجود این آغازگرها در نخل خرما کمتر مورد استفاده قرار گرفته‌اند.

خالد المیر و همکاران (2011) از 30 مارکر جدید ریز ماهواره جهت ارزیابی و تشخیص تنوع ژنتیکی 11 ژنوتیب مختلف نخل خرما از نقاط مختلف قطر استفاده کردند. نتایج بدست آمده از 30 آغازگرنشان داد که 7 آغازگر هیچ تکثیری را در PCR نداشتند و 13 آغازگر الگوی باندی تک شکلی را نشان داده و 10 آغازگر چند شکلی بالایی را نشان دادند. در مجموع 77 آلل مشاهده شدند که بطور متوسط در هر لوکوس 7/7 آلل وجود داشت (9). در پژوهشی، بررسی تنوع ژنتیکی23 رقم نر و 23 رقم ماده نخل خرما با استفاده از 11 آغازگرهای ریزماهواره SSR در دانشگاه منابع طبیعی رامین خوزستان صورت گرفت. نتایج مشخص نمود که بیشترین تشابه ژنتیکی بین ارقام سعمران، برحی و کلون‌های حاصله از کشت بافت آنها و کمترین میزان تشابه بین ارقام دگل- نور و آلمهتری بدست آمد (10).

احمد و همکاران (2009) از 61 آغازگر ریزماهواره جهت بررسی تنوع ژنتیکی و نسبت­های خویشاوندی 15 رقم نخل خرمای قطر استفاده کردند و ارقامی را که از نظر ژنتیکی شبیه هم و آن­هایی را که با هم فاصله زیادی داشتند، مشخص کردند (3).

عرب نژاد و همکاران (2009) با استفاده از آغازگرهای جدید SSR غنی از تکرارهایAG  و AGG بر اساس توالی DNA کلون شده از نخل خرما، 25 جفت آغازگر طراحی کردند و تنوع ژنتیکی بین ژنوتیپ­هایی که از مناطق مختلف جغرافیایی جمع­آوری شده بودند را بررسی کردند که فقط 22 آغازگر توانستند چند شکلی را در 16 رقم نخل خرما نشان دهند (5).

اصلاح نخل خرما بسیار مشکل است چرا که دارای چرخه زندگی طولانی بوده و میزان هتروزیگوسیتی آن در طبیعت بالاست. روش­های اصلاح نخل خرما شامل وارد کردن ارقام جدید، انتخاب، تلاقی برگشتی و کشت بافت می­باشند. بعد از عملیات قرنطینه، می­توان در صورت سازگاری با محیط، آنها را بطور مستقیم در محل اصلی کاشت و یا در برنامه­های دورگ گیری مورد استفاده قرار داد. باید توجه داشت چون والد نر نیز در کمیت و کیفیت خرما موثر است، باید به وارد کردن والد نر مناسب هر رقم نیز اقدام شود.جهت معرفی و اصلاح گیاهان غیر مشهور ولی دارای توان ژنتیکی بالا، شرط اصلی وجود تنوع ژنتیکی در جمعیت پایه می باشد تا شانس انتخاب افزایش یافته و امکان پیدا کردن صفات مطلوب بیشتر گردد. با توجه به کشت ارقام محدود و تجاری خرما بصورت گسترده توسط کشاورزان در سال­های اخیر سایر ارقام با وجود داشتن صفات خوب که می­توانند در اصلاح نباتات از آنها استفاده شوند به فراموشی سپرده شده­اند و از طرفی با توجه به اینکه تکثیر درخت خرما بصورت غیر جنسی و از طریق پاجوش انجام می­گیرد و این امر خود خطر از بین رفتن ارقام فراموش شده را افزایش می­دهد. لذا لزوم بررسی ژنتیکی ارقام مختلف خرمای  کشور و استفاده از صفات خوب آنها ضروری بنظر می­رسد.

تنوع و انتخاب دو رکن اصلی هر برنامه اصلاحی بوده و انجام انتخاب منوط به وجود تنوع مطلوب است. براساس پژوهش‌‌های گذشته گزارش شد که آغازگرهای ریزماهواره قادر هستند چند شکل بالایی را بین ارقام خرما نشان دهند و از این رو ابزار مفید برای انگشت نگاری ارقام و دسته‌بندی آنها در گروه مختلف به‌شمار می‌روند، همچنین می‌توانند برای مدیریت ذخایر توارثی از طریق شناسایی نمونه‌های تکرار و هم‌نام هم مورد استفاده قرار بگیرند. لذا هدف از انجام این تحقیق، بررسی تنوع موجود در ارقام نر و ماده نخل خرمای استان­های سیستان و بلوچستان و هرمزگان با استفاده از آغازگر SSR بود تا بتوان از طریق تعیین فاصله ژنتیکی ارقام، والدین مناسب را جهت انجام تلاقی‌های آتی انتخاب و به اصلاح این گیاه ارزشمند و مهم کمک نمود.

مواد و روشها

تهیه مواد گیاهی:  مواد گیاهی مورد استفاده شامل برگ­های جوان 14 رقم نخل خرمای نر و 26 رقم نخل خرمای ماده بود که نام و مشخصات آن در جدول های 1 و 2 آورده شده است.

 

جدول 1-  نام ارقام نر نخل خرما 

نام ارقام 

 (Cultivars name)        

محل انتخاب

 (Location name) 

نام ارقام  

(Cultivars name)        

محل انتخاب

 (Location name)  

1. جرویس

 Jervis

میناب (هرمزگان)

 Minab(Hormozgan)

8. محلی

Mahalli

حاجی­آباد (هرمزگان)

Hajiabad  (Hormozgan)

2. نردوم

 Naredowom

فین (هرمزگان)

  Fin(Hormozgan)

9. 2006

میناب(هرمزگان)

 Minab(Hormozgan)

2005 .­3

میناب(هرمزگان)

  Minab (Hormozgan)

10. 2008

میناب(هرمزگان)

 Minab(Hormozgan)

.4 2003

میناب(هرمزگان)

 Minab(Hormozgan)

2009 .11

میناب (هرمزگان)

 Minab(Hormozgan)

5. فرد

Fard

میناب(هرمزگان)

 Minab(Hormozgan)

.12 2007

میناب(هرمزگان)

 Minab(Hormozgan)

6.  2002

میناب(هرمزگان)

 Minab(Hormozgan)

.13 فنوج

Fanooj

ایرانشهر(سیتان و بلو چستان)

Iranshahr (Sistan and Baluchistan)

7. 2004

میناب(هرمزگان)

 Minab(Hormozgan)

.14 مسکوتان

Maskootan

ایرانشهر (سیتان و بلو چستان)

Iranshahr (Sistan and Baluchistan)

 

 

استخراج DNA : استخراجDNA از برگ‌های جوان نخل خرما به روش CTAB سمبروک (1998) با اندکی تغییرات انجام شد (20) و DNA حاصل با استفاده از 11 جفت آغازگر SSR تکثیر گردید. نمونه­های برگی (از هر درخت به­طور تصادفی 3 نمونه برگ تازه و جوان توسط تیغ استریل بریده شد و سپس نمونه­ها در کیسه نایلونی بسته­بندی و بر روی یخ خشک نگهداری شدند و به آزمایشگاه مولکولی مرکز تحقیقات کشاورزی و منابع طبیعی بندرعباس منتقل شد) ارقام انتخابی نخل خرما از ایستگاه تحقیقات­ کشاورزی و منابع طبیعی شهرستان میناب و حاجی آباد و روستای فین از توابع شهرستان بندرعباس در استان هرمزگان و مرکز تحقیقات کشاورزی و منابع طبیعی شهرستان ایرانشهر واقع در استان سیستان و بلوچستان تهیه شدند. سپس نمونه­ها در کیسه نایلونی بسته­بندی و بر روی یخ خشک نگهداری شدند و به آزمایشگاه مولکولی مرکز تحقیقات کشاورزی و منابع طبیعی بندرعباس منتقل شد. برگ­ها با استفاده از ازت مایع پودر شدند و حدود 3/0 گرم از برگ­های پودر شده به میکروتیوپ 2 میلی­لیتری منتقل شدند.

PCR  و الکتروفورز محصولات PCR : واکنش زنجیره­ای پلیمراز در دستگاه ترموسایکلر توسط 10 آغازگر SSR (جدول3) انجام شد. چرخه دمایی مورد نیاز جهت انجام واکنش زنجیره­ای پلیمراز نیز در جدول 4 آورده شده است. محصول واکنش زنجیره­ای پلیمراز توسط دستگاه الکتروفورز عمودی ساخت شرکتAPELEX  و با استفاده از ژل آکریل آمید 8% در مدت زمان 3 ساعت و توان 200 وات، بصورت باندهایی تفکیک شدند.

رنگ آمیزی باندها: رنگ آمیزی باندها توسط نیترات نقره به روش باسام و همکاران (1993) انجام شد. پس از رنگ آمیزی، اندازه­گیری طول باندها بر اساس خط­کش مولکولی روی ژل آکریل آمید 8%، انجام شد (6).

تجزیه و تحلیل­های آماری: برای تجزیه داده­ها بایستی ماتریس تشابه بین ارقام را تشکیل داد. با استفاده از نرم افزار Gene Alex6.3 نتایج مربوط به تعداد آلل مشاهده شده و هتروزیگوسیتی مشاهده شده و محتوای اطلاعات چند شکلی محاسبه شد.

 

جدول2- نام ارقام ماده نخل خرما

Table 2- Name of  female cultivars date palm 

نام ارقام

(Cultivars name)

محل انتخاب

(Location name)

نام ارقام

(Cultivars name)

محل انتخاب

(Location collection)

 

.1کبکاب

Kabkab

 

.2خاصویی

Khasooi

 

.3برهی

Berhi

 

.4هلیلی

Halili

 

.5مجول

Majool

 

.6توری

Toori

 

.7پیارم

Pyarom

 

.8خنیزی

Khanizi

 

.9آلمهتری

Almehtari

 

.10زاهدی

Zahedi

 

.11دیری

Deyri

 

.12شاهانی

Shahani

 

.13کلگلی

Kalgeli

 

حاجی­آباد (هرمزگان)

Hajiabad (Hormozgan)

 

حاجی­آباد (هرمزگان)

Hajiabad (Hormozgan)

 

میناب (هرمزگان)

Minab (Hormozgan)

 

فین (هرمزگان)

Fin (Hormozgan)

 

میناب (هرمزگان)

Minab (Hormozgan)

 

حاجی­آباد (هرمزگان)

Hajiabad (Hormozgan)

 

حاجی­آباد (هرمزگان)

Hajiabad (Hormozgan)

 

میناب (هرمزگان)

Minab (Hormozgan)

 

میناب (هرمزگان)

Minab (Hormozgan)

 

فین (هرمزگان)

Fin (Hormozgan)

 

حاجی­آباد (هرمزگان)

Hajiabad (Hormozgan)

 

حاجی­آباد (هرمزگان)

Hajiabad (Hormozgan)

 

ایرانشهر (سیتان و بلو چستان)

Iranshahr (Sistan and Baluchistan)

 

.14نلسون

Nalason

 

.15بگشی

Bagashi

 

.16ابومعان

Aboomaan

 

 

.17­­کوش­زباد

­­Koshzebad

 

 

.18گرم­بیت

Gerambit

 

 

.19نباتسیف

Nabatsif

 

.20خلوزرد

Yellow Kholoo

 

.21ابونارنجا

Abonarenja

 

.22گچخواه

GachKhah

 

.23مرداسنگ

Mordaseng

 

.24ربی

Rabbi

 

.25فرد

Fard

 

.26رعناطلا

Ranatala

 

فین (هرمزگان)

Fin (Hormozgan)

 

               فین (هرمزگان)               Fin(Hormozgan)

 

ایرانشهر (سیتان و بلو چستان)

Iranshahr (Sistan and Baluchistan)

 

ایرانشهر (سیتان و بلو چستان)

Iranshahr (Sistan and Baluchistan)

 

ایرانشهر (سیتان و بلو چستان)

Iranshahr (Sistan and Baluchistan)

 

ایرانشهر (سیتان و بلو چستان)

Iranshahr (Sistan and Baluchistan)

 

فین (هرمزگان)

Fin (Hormozgan)

 

ایرانشهر (سیتان و بلو چستان)

Iranshahr (Sistan and Baluchistan)

 

ایرانشهر (سیتان و بلو چستان)

Iranshahr (Sistan and Baluchistan)

 

میناب (هرمزگان)

Minab (Hormozgan)

 

ایرانشهر (سیتان و بلو چستان)

Iranshahr (Sistan and Baluchistan)

 

ایرانشهر (سیتان و بلو چستان)

Iranshahr (Sistan and Baluchistan)

 

ایرانشهر (سیتان و بلو چستان)

Iranshahr (Sistan and Baluchistan)

 

برای تعیین کارآیی و مقایسه نشانگرها در تفکیک ژنوتیپ­های مورد مطالعه، از معیار میزان اطلاعات چند شکلی (PIC) استفاده شد (8). میزان اطلاعات چند شکلی از رابطه pj2pi22Σin-1ΣjnPIC= 1 −Σpin pi2 − بدست می­آید (i=1 و j=1+1 ) و pi فراوانی الل i ام و pj فراوانی الل i+1 است. احتمال شناسایی ازرابطه 2 Σ𝑝𝑖4−ΣΣ(2𝑝𝑖𝑝𝑗)­بدست آمد (i=1 و j=1+1 ) و pi فراوانی الل i ام و pj فراوانی الل i+1 است (8، 14). در نهایت با استفاده از نرم افزار DARVIN5.0 و به روش  Neighbor joining تجزیه خوشه­ای ارقام انجام شد.

 

جدول 3- مشخصات آغازگرهای مورد استفاده در تحقیق  

منبع آغازگر

 

  دمای اتصال ˚C

 

توالی آغازگرها

 

توالی تکراری

 

کد بانک ژن

 

نام  آغازگر

 

Arabnezhadet al.2011

51

F: GCCACAGGAAGCACATTTAG

R:CCACACCTTAATCACAAACTCC

(CT)22

PDAG1006

HQ542208

Arabnezhadet al.2011

54

F: GGACATAGTTTTGGCTGGCTAC

R: ACCAGTTTACCACTTGCTCCA

(AGGG)4

PDAG1002

HQ542205

Arabnezhadet al.2011

51

F: GTATGTTCCATGCCGTTCTAC

R: AGCCACATCACTTGGTTCA

(AG)10

PDAG1005

HQ542207

Arabnezhadet al.2011

54

F: AGACGCTCACCTTGGAACTT

R: ACCCCGCTCATGAATTAGG

(AAG)10

PDAAG1023

HQ542224

Arabnezhad etal.2011

53

F: CTTCTCCACTGGCATCTTCC

R: CACCCGTTGGGCATCTTA

(AAG)15-A6-(AAG)3

PDAAG1025

HQ542225

Elmeeret al.2011

54

F:GCATGGACTTAATGCTGGGTA

R: GGTTTTCCTGCCAACAACAT

(AAT)12

-

DP169

Elmeeret al.2011

56

F: GGTGTTTGGGCCTATTTCCT

R: GTCCTCCTCCTCCTCTGTCC

(AGG)11

-

DP172

Akkak et al. 2009

58

F: GCTTAAGTGGTTAGTTGCCAA

R: GTTTGGCAGAAGTATTGAAA

AGTTGA

(TC)16

EF015866

PDCAT8

Akkaket al. 2009

57

F:TGCTGCAAATCTAGGTCACGA

R: TTTACCCCTCGGCCAAATGTAA

(TC)19(  TC)16

EF015872

PDCAT14

BiIlotteet al.2004

47

F: ATGCGGACTACACTATTCTAC

R: GGTGATTGACTTTCTTTGAG

(GA)19

AJ571679

mPdCIR044

 

 

 

 

 

 

 

جدول 4- چرخه­های دمایی واکنش زنجیره ای پلیمراز (PCR)

Table 4- temperature cycles polymerase chain reaction 

تعداد دور

(The number of rounds)

مراحل

(Steps)

زمان

(Time)

دما

(Temperature)

1

واسرشت اولیه

 

4 دقیقه

 

95

35

واسرشت سازی

 

30 ثانیه

 

95

اتصال

 

30 ثانیه

 

دمای هر آغازگر

 

بسط

 

30 ثانیه

 

72

1

بسط نهایی

 

 10دقیقه

 

72

1

نگهداری در ترموسایکلر

 

10 دقیقه

 

4


نتایج و بحث

پس از نمره­دهی باندها بر اساس طول باندها روی ژل آکریل آمید 8%، وجود چند شکلی و تشابه ژنتیکی در تمامی ارقام مورد اندازه­گیری و بررسی قرار گرفت و از 10 جفت آغازگر مورد استفاده در مجموع 76 آلل شناسایی شد که آغازگرهای HQ542208 و HQ542224 با 9 آلل بیشترین (شکل ­1) و آغازگرهای DP169 و HQ542225 با 6 آلل کمترین تعداد آلل­ را نشان دادند (شکل ­2). میانگین تعداد آلل در کل جایگاه­ها برابر 6/7 بود که از تعداد آلل مورد مطالعه توسط اکاک و همکاران (2009) با متوسط 412/6 بیشتر بود (4) ولی از تعداد آلل مشاهده شده در مطالعه بایلوت و همکاران­ با متوسط 025/11 آلل کمتر بود (7).

 

 

شکل 1- الگوی باندی تولید شده توسط آغازگر HQ542208

 

شکل 2- الگوی باندی تولید شده توسط آغازگر DP169

 

محتوای اطلاعات چند شکلی با متوسط 77%، از 63% برای آغازگر HQ542225 تا 85% برای HQ542208 در نوسان بود (جدول 5). در مورد محتوای اطلاعات چند شکلی، نتایج این تحقیق بطور متوسط از دامنه محتوای اطلاعات چند شکلی 15% تا 83% تحقیق اکاک و همکاران (2009) برتر بود (4). این برتری را شاید بتوان مربوط به وجود ارقام نر در این تحقیق دانست زیرا در تحقیقات قبل فقط ارقام ماده وجود داشته است و یا اینکه تعداد ارقام نر خیلی کمتر از ارقام ماده مورد مطالعه در این تحقیق، بوده است. از نتایج بالا می­توان استنباط نمود که محتوای اطلاعات چند شکلی نمی­تواند عدد ثابتی باشد و به عواملی مثل تعداد آغازگرها، تعداد آلل تولیدی توسط هر جایگاه، تعداد و نوع ارقام مورد استفاده در تحقیق بستگی دارد. میزان هتروزیگوسیتی ارقام ماده از 40% در رقم پیارم تا 90% در رقم ربی متغیر بوده است (جدول ­6) و میزان هتروزیگوسیتی ارقام نر از 40% در رقم 2008 تا 100% در رقم جرویس متغیر بوده است (جدول 7).

جهت انجام تجزیه خوشه­ای ارقام نر و ماده نخل خرما از روش Neighbor joining و برای تشکیل ماتریس تشابه، از ضریب تشابه نی (1973) استفاده شد (13، 17). مقدار تشابه ژنتیکی ارقام ماده بین صفر تا 85% متغیر بود که بیشترین تشابه ژنتیکی ارقام ماده بین دو رقم خنیزی و آلمهتری استان هرمزگان (­85%­) و کمترین تشابه ژنتیکی بین رقم ابونارنجای استان سیستان و بلوچستان و سایر ارقام صفر بود. تشابه ژنتیکی ارقام نر بین صفر تا 47% برآورد شد که حداکثر تشابه ژنتیکی ارقام نر بین دو رقم 2009 و 2007 استان هرمزگان (47%­) و کمترین تشابه ژنتیکی ارقام نر بین دو رقم جرویس و نر دوم استان هرمزگان (­25%­) بود.

 

جدول 5- شاخص آغازگرهای مورد مطالعه در تحقیق 

آغازگر

( primer )

تعداد آلل

(The number of alleles)

هتروزیگوسیتی

(Heterozygosity)

اطلاعات چندشکلی

(Polymorphism information)

DP172

8

629%

781%

HQ542205

8

759%

829%

PDCAT14

7

933%

756%

PDCAT8

7

933%

824%

HQ542225

6

838%

633%

DP169

6

838%

738%

HQ542208

9

890%

854%

HQ542207

8

672%

834%

HQ542224

9

975%

828%

mPdCIR044

7

411%

753%

میانگین

7/6

774%

787%

 

جدول 6- میزان هتروزیگوسیتی ارقام ماده 

هتروزیگوسیتی

(Heterozygosity)

نام ارقام

(Cultivars name)

هتروزیگوسیتی

(Heterozygosity)

نام ارقام

(Cultivars name)

90%

ربی(Rabbi)

60%

توری  (Toori)

80%

برحی  (Berhi)

60%

هلیلی (Halili)

80%

کبکاب (Kabkab)

60%

خنیزی (Khanizi)

80%

خاصویی (Khasooi)

60%

دیری (Deyri)

80%

مجول (Majool)

60%

شاهانی (Shahani)

80%

بگشی (Bagashi)

60%

کلگلی (Kalgely)

80%

خلوزرد (Yellow kholoo)

60%

ابومعان (Aboomaan)

80%

مرداسنگ (Mordaseng)

50%

آلمهتری (Almehtary)

70%

نباتسیف (Nabatsif)

50%

زاهدی (Zahedi)

70%

ابونارنجا (Abonarenja)

50%

نلسون (Nalason)

70%

گچخواه (Gachkhah)

50%

گرم­بیت (Gerambit)

70%

فرد (Fard)

50%

کوش­زباد (Kooshzebad)

70%

رعناطلا  (Ranatala)

40%

پیارم  (Pyarom)

 

جدول 7- میزان هتروزیگوسیتی ارقام نر

Table 7- The male cultivars of heterozygosity    

 هتروزیگوسیتی

(Heterozygosity)

نام ارقام

(Cultivars name)

 هتروزیگوسیتی

(Heterozygosity)

نام ارقام

(Cultivars name)

100%

جرویس

60%

2006

90%

مسکوتان

60%

2007

70%

نر دوم

50%

2002

70%

2003

50%

محلی

70%

فرد

80%

فنوج

70%

2004

40%

2005

70%

2009

40%

2008

 

 

 

 

 

بر اساس تجزیه خوشه­ای ارقام ماده (محل برش در فاصله 0 تا 1/0) در 3 گروه قرار گرفتند. خوشه گروه اول ارقام ماده از بالا به پایین شامل ارقام آلمهتری، خنیزی، پیارم، خلوزرد، مجول، ابونارنجا، شاهانی، دیری، رعنا طلا، بگشی، کلگلی و نلسون می­باشد که ارقام ابونارنجا، رعناطلا و کلگلی مربوط به استان سیستان و بلوچستان می­باشند. گروه دوم از ارقام ماده شامل گچخواه، کبکاب، برحی، خاصویی، ربی، مرداسنگ، قصب (زاهدی) و هلیلی می­باشد که دو رقم گچخواه و ربی مربوط به استان سیستان و بلوچستان می­باشند. گروه سوم از ارقام ماده شامل ارقام گرم­بیت، ابومعان، کوش زباد، فرد ماده، نباتسیف و توری می­باشد که رقم توری مربوط به استان هرمزگان می­باشد (شکل 3).

ارقام نر نیز بر اساس دندوگرام حاصل از تجزیه خوشه­ای، در 3 گروه قرار گرفتند. گروه اول ارقام نر از بالا به پایین شامل ارقام نر دوم، جرویس، مسکوتان، فنوج، نر 2002 و نر 2005 می­باشد. دو رقم مسکوتان و فنوج از گروه اول ارقام نر، مربوط به استان سیستان و بلوچستان می­باشند (ارقام دارای هتروزیگوسیتی بالا شامل جرویس، مسکوتان و فنوج در گروه اول قرار گرفته­اند). گروه دوم ارقام نر از بالا به پایین شامل ارقام نر محلی، نر 2004، نر 2006، نر فرد و نر 2003 می­باشد گروه سوم از بالا به پایین به دو زیر گروه تقسیم شده است که در زیر گروه یک دو رقم 2007 و 2009 قراردارند و در زیر گروه دوم از گروه سوم رقم  2008 قرار دارد که تمامی ارقام این گروه مربوط به استان هرمزگان می­باشند (شکل 4).

برای داشتن دیدگاه بهتر راجع به تشابه ژنتیکی ارقام، تجزیه به مختصات اصلی نیز مکمل روش تجزیه خوشه­ای انجام شد که گروه­بندی حاصل از تجزیه خوشه­ای را در بر گرفت که این مساله نشان دهنده قطع نمودار تجزیه خوشه­ای از محل مناسب می­باشد (شکل 5).

نتایج حاصل از تجزیه خوشه­ای ارقام نر و ماده را از راست به چپ به 3 گروه تقسیم کرد. گروه اول شامل دو رقم (شماره 11 و 12) نر 2002 و توری می­باشد که هر دو رقم مربوط به استان هرمزگان می­باشند. گروه دوم به دو زیر گروه و هر زیر گروه به دو شاخه و هر شاخه به دو زیر شاخه تقسیم شده است که در شاخه یک ارقام (شماره 8، 10، 9، 24، 38، 22، 21، 23، 18، 16 و 17) مجول، فردنر، نر2003، نر 2006، فردماده، نلسون، کلگلی، بگشی، نر محلی، نر 2004، قصب (زاهدی) و در شاخه دوم ارقام (شماره 32، 6، 7، 3، 2، 36، 1، 25، 35، 37، 4 و 5) نبات­سیف، هلیلی، نر 2005، نر دوم، نر جرویس، مرداسنگ، کبکاب، نر 2008، گچخواه، ربی، خاصویی و برحی قرار دارند. گروه سوم شامل دو زیر گروه است که در زیر گروه یک فقط رقم ابونارنجای سیستان و بلوچستان به تنهایی قرار دارد و زیر گروه دوم به دو شاخه و هر شاخه به دو زیر شاخه تقسیم شده است که در زیر شاخه یک ارقام (شماره 19، 20، 39، 40، 33، 13، 14 و 15) دیری، شاهانی، نرمسکوتان، رعناطلا، خلوزرد، پیارم، خنیزی و آلمهتری ­ و در زیر شاخه دوم ارقام (شماره 31، 26، 30، 29، 27 و 28) نر فنوج، نر 2009، گرم­بیت، کوش­زباد، نر 2007 و ابومعان قرار گرفته­اند (شکل 6). گروه­بندی حاصل از تجزیه خوشه­ای این تحقیق تا حد زیادی با شرایط اقلیمی محل کشت ارقام نر و ماده دو استان سیستان و بلوچستان و هرمزگان مطابقت دارد و بخوبی نشان می­دهد که نشانگرهای SSR حتی اگر تعدادشان هم کم باشند مشابهت و اختلاف­های ارقام نخل خرما را نشان دادند. در مجموع با توجه به یافته­های حاصل از این تحقیق تصویر جامع­تری از ساختار ژنتیکی ارقام نر و ماده نخل خرما بدست آمده است که استفاده از آن­ها را برحسب مورد در برنامه بهنژادی ارقام نخل خرما ممکن می­سازد.

آغازگرهای SSR قابلیت بیان چند شکلی بین ارقام مختلف نخل خرما را دارند. میانگین تعداد آلل در کل جایگاه­ها برابر 6/7 بود که از تعداد آلل مورد مطالعه توسط اکاک و همکاران (2009) با متوسط 412/6 بیشتر بود (4) ولی از تعداد آلل مشاهده شده در مطالعه بایلوت و همکاران­ (2004) با متوسط 025/11 آلل کمتر بود (7). نتایج پژوهش بررسی تنوع ژنتیکی ارقام نخل خرمای کشور عربستان با استفاده ضریب تشابه نی مشخص نمود که بیشترین تشابه بین دو رقم شکری و خنیزی و کمترین تشابه بین ارقام برحی با هر یک از ارقام خصاب، شاهیل، خنیزی و شکری بود (9). نژاد حبیب (2013) با استفاده از 11 آغازگرهای ریزماهواره 46 رقم نر و ماده نخل خرما را در دانشگاه منابع طبیعی رامین خوزستان مورد ارزیابی قرار دادند. براساس دندروگرام، 46 رقم مورد مطالعه در 4 گروه قرار گرفتند که بررسی آنها نشان‌دهنده وجود تنوع زیاد بین ارقام مورد آزمایش بود. به طوری که ارقام بر اساس یک پراکنش جغرافیایی و بازار پسندی در گروه مختلف قرار گرفتند. که تأییدکننده کارایی بالایی این نشانگر در دسته‌بندی گونه‌های مختلف می­باشد (10).

در تحقیقی با طراحی 16 پرایمر چندشکلی در سراسر ژنوم مختلف نخل خرما از کشورهای (آمریکا، عراق، عمان، الجزایر، تونس، سودان، عربستان سعودی و مراکش) نشان داده شد و میزان چند شکلی در حدود 76 درصد و تعداد آلل در هر لوکوس حدود 14 برآورد گردید. تاکور و همکارن (2016) تنوع ژنتیکی را در 40 رقم نخل خرما بررسی کرده و قرابت آنها را با 14 گونه دیگر نخل تعیین کردند و مشاهده کردند که در برخی از این گونه­ها، دارای خویشاوندی نزدیک و در برخی از آنها دارای خویشاوندی­های دور می­باشند (7 ، 22).

 

 

شکل 3- تجزیه خوشه­ای ارقام ماده رسم شده براساس روش Neighbor joining و ضریب تشابه نی

 

 

شکل4- تجزیه خوشه­ای ارقام نر رسم شده بر اساس روش Neighbor joining و ضریب تشابه نی

 

شکل 5- نمودار تجزیه به مختصات اصلی ارقام نر (سمت راست) و ماده (سمت چپ) نخل خرما

 

جانی‌پور و همکاران (2018) با استفاده از نشانگرهای مولکولی ISSR جمعیت‌های مختلف گیاه دارویی زیره سبز را مورد ارزیابی قرار دادند. نتایج مشخص نمود که زیره سبز سبزوار بعنوان مرکز تنوع این گیاه بر اساس جمعیت­های مورد بررسی پیشنهاد و دورترین جمعیت­ها جهت تلاقی های احتمالی و ایجاد تنوع جدید و مفیدتر زیره سبز سبزوار و زیره سبز کاشان معرفی می­شوند (2).

در پژوهشی بررسی تنوع ژنتیکی 15 رقم از ارقام نخل خرمای کشور قطر با استفاده از ضریب تشابه جاکارد مورد مطالعه قرار گردید نتایج مشخص نمود که میزان تشابه بین صفر تا 1% بود و بیشترین تشابه بین ارقام شیشه­ای و قصب (زاهدی)، حتمی و ابومعان، هلیلی و شیشه­ای مشاهده شده است (3). همچنین گزارش شده است که از آغازگرهای ریزماهواره جهت تجزیه تنوع ژنتیکی و نسبت­های خویشاوندی در میان 15 رقم نخل خرمای قطر استفاده شد، ضریب خویشاوندی در میان 15 رقم نخل خرما محاسبه و بر اساس آنها دندروگرام ترسیم گردید که نتایج نشان داد که این مار کر توانست ارقامی را که از نظر ژنتیکی شبیه هم و آنهایی را که با هم فاصله زیادی دارند را مشخص کند (3 و 19). در پژوهشی، نتایج نشان داد که با استفاده از آغازگرهای جدید SSR غنی از تکرارهایAG  و AGG بر اساس توالی DNA کلون شده از نخل خرما 25 جفت پرایمر طراحی کردند و تنوع ژنتیکی بین ژنوتیپ­هایی که از مناطق مختلف جغرافیایی (­ایران، عراق و آفریقا) جمع­آوری شده بودند را بررسی کردند که فقط 22 پرایمر توانستند چند شکلی را در 16 رقم نخل خرما نشان دهند. آغازگرهای SSR انتخاب شده بطور کلی 16 آلل، با میانگین 8/4 آلل در هر لوکوس را نشان دادند (5، 11).

 

 

شکل 6. تجزیه خوشه­ای ارقام نر و ماده رسم شده بر اساس روش Neighbor joining و ضریب تشابه نی

 

در پژوهشی از آغازگرهای SSR با استفاده از روش Fiasco با کمی تغییر شروع به طراحی پرایمرهای جدید در نخل خرما کردند و توانستند 9 پرایمر جدید که تعداد آلل‌های آن در هر لوکوس 2 تا 4 و بطور میانگین 5/2 آلل در هر لوکوس می­ باشد را طراحی کنند که قادر بود تا حدود 69 درصد چند شکلی را در نخل خرما نشان دهد. میانگین هتروزیگوستی مشاهده شده بین 1 تا 11 درصد و مورد انتظار 10 تا 74 درصد بود (15، 23). در پژوهشی 41 توالی تکراری از دو ریزماهواره در کتابخانه ژنی نخل خرما مورد مطالعه قرار گرفتند که به این نتیجه دست یافتند که در مجموع 31 رقم نخل خرما که از الجزایر و کالیفرنیا جمع‌آوری شده‌ بود که همگی سطح بالایی از چند شکلی را نشان دادند (4 ، 18).

در پژوهشی از نشانگر مولکولی ISSR برای بررسی تنوع ژنتیکی اکوتیپ‌های علف باغ Dactylis glumerata استفاده نمودند. آغازگرهای ISSR در مجموع توانستند 90 مکان را تکثیر کنند که از این تعداد 67 باند چند شکل مشاهده شد. آغازگر IS5 بیشترین تعداد باند (12) و آغازگرهایIS7، IS12، IS10 و IS15 کمترین تعداد باند (5) را داشتند. میانگین درصد چند شکلی و محتوای اطلاعات چند شکلی (PIC) بترتیب برابر 45/75% و 33/0 بود. آغازگرهای IS10 و IS9 بیشترین میزان محتوای اطلاعات چند شکلی (PIC) را داشتند. تجزیه خوشه‌ای برای اکوتیپ‌‌ها بر اساس ضریب تشابه دایس صورت گرفت که اکوتیپ‌های مورد بررسی در 4 گروه قرار گرفتند که تنوع ژنتیکی با تنوع جغرافیایی تطابق نداشت. همچنین این نتایج تا حدودی با تجزیه به مختصات اصلی (PCo) مطابقت داشت (1).

در مطالعه­ی از آغازگرهای ریزماهواره جهت غربالگری و تجزیه تنوع ژنتیکی موجود در ژنوتیپ‌های محلی نخل خرما حاصل شده از جنین‌های سوماتیک در عمان استفاده نمودند و با 10 آغازگر ریزماهواره مورد ارزیابی قرار گرفتند که این پرایمرها اندازه باندهای مورد نظر را ظاهر کردند و همچنین سطح بالایی از چند شکلی را نشان دادند (21). مارصفری و مهرابی (2010) تنوع و ارتباط ژنتیکی 75 نمونه از 15 جمعیت درخت خرمای ایران با استفاده از آغازگر ISSR ارزیابی کرد. در مجموع 162 باند با استفاده از 14 آغازگر 17 و 18 نوکلئوتیدی ISSR تولید شد که از این میان 155 باند چندشکل بودند. بیشترین تعداد الل­های تکثیر شده و تعداد الل­های چندشکل مربوط به آغازگر 886 UBC، بیشترین شاخص محتوای اطلاعات چندشکلی (PIC) مربوط به 884 UBC و بیشترین شاخص آغازگر (MI) مربوط به 840 UBC است. تجزیه خوشه­ای با استفاده از روش NJ و ماتریس عدم تشابه دایس انجام گرفت و 15 جمعیت را به دو گروه اصلی تفکیک نمود. جمعیت­های فرسی، عویدی، گنتار، کبکاب و دگلتنور در یک دسته و سایر جمعیت­ها در دسته دیگر قرار گرفتند. جمعیت­های عویدی و گنتار بترتیب با بیشترین (62/35) و کمترین (23/46) درصد مکان­های ژنی چندشکل بترتیب بیشترین و کمترین تنوع ژنتیکی را نشان دادند. بیشترین و کمترین تشابه ژنتیکی نیز بترتیب بین ارقام دیری و گنتار (0/994) و کبکاب با هر یک از ارقام دیری و گنتار (0/941) مشاهده شد. آغازگر ISSR به دلیل سادگی، سرعت، هزینه پایین و نیز نشان دادن چندشکلی بالا و پوشش دادن تمام ژنوم خرما تکنیکی قدرتمند در تعیین تنوع و ارتباط ژنتیکی جمعیت­های خرما است (13).

نتیجه­گیری کلی

در هیچ یک از جایگاه مورد بررسی در ارقام نخل خرما در محدوده باندی مورد نظر بیش از دو آلل دیده نشده است. با توجه به میزان هتروزیگوسیتی، ارقامی که هتروزیگوسیتی بالاتری دارند در دامنه وسیع­تری کشت شده­اند همچنین با توجه به همبارزی و قدرت تفکیک بالای آغازگرهایSSR  می­توان نتیجه گرفت که این دسته از آغازگرهای مولکولی بدلیل قابلیت بیان چند شکلی بین ارقام مختلف نخل خرما جهت بررسی تنوع ژنتیکی مفید هستند. در پروژه های اصلاحی هر چه فاصله ژنتیکی والدین بیشتر باشد، در نسل­های تفکیک بعد از دورگ­گیری نیز تنوع بیشتری ایجاد می­شود. همچنین تلاقی بین ارقام یا ژنوتیپ­های دور نتایج مطلوب تری را در برخواهد داشت و نتاج حاصل دارای هتروزیس بیشتری نسبت به دو ژنوتیپی هستند که در یک خوشه قرار دارند. بدین ترتیب امکان جمع آوری ژنهای مطلوب­تر در نتاج فراهم می شود (12). بطور کلی، بررسی تنوع ژنتیکی 14 رقم نر و 26 رقم ماده نخل خرما با استفاده از آغازگرهای SSR نشان دادند که بر اساس تجزیه خوشه­ای ارقام نر و ماده در 3 گروه قرار گرفتند. از میان تمام ارقام مورد مطالعه، بیشترین تشابه ژنتیکی بین ارقام آلمهتری و خنیزی و کمترین میزان تشابه بین رقم ابونارنجا و سایر ارقام بدست آمد. با توجه به یافته­های حاصل از این پژوهش، تصویر جامع­تری از ساختار ژنتیکی ارقام نر و ماده نخل خرما بدست آمده است که استفاده از آن­ها را برحسب مورد در برنامه بهنژادی ارقام نخل خرما ممکن می­سازد.

  1. 1. رحمتی ه. و شیروانی ه. 1397. بررسی تنوع ژنتیکی اکوتیپ‌های Dactylis glumerata با استفاده از نشانگر مولکولی .ISSR مجله پژوهش­های سلولی و مولکولی (مجله زیست شناسی ایران(، جلد 31. شماره 1. ص 67-78.

    2. جانی­پور ل.، فهمیده ل.، فاضلی نسب ب. 1397. ارزیابی ژنتیکی جمعیت‌های مختلف گیاه دارویی زیره سبز با استفاده از نشانگرهای مولکولی .DNA مجله پژوهش­های سلولی و مولکولی (مجله زیست شناسی ایران(، جلد 31. شماره 1. ص 16-32.

     

    1. Ahmed A.,  Asmaa, A., and Al-Qaradwi, V. 2009. Molecular phylogeny of Qatari date palm genotypes using simple sequence repeats marker. Biotechnology, 8­:­ 1. 126-131.

    4. Akkak, A., Scariot, V., TorelloMarinoni, D., Boccacci, P., Beltramo, C., and Botta, R. 2009. Development and evaluation of microsatellite markers in Phoenix dactyl feral and their transferability to other Phoenix species. Biologia Plant arum, 53­: 1. 164–166.

    5. Arabnezhada, H., Bahara, M., Mohammadia, H., Horticulturae, R., and Latifian, M. 2009. Development, characterization and use of microsatellite markers for germplasm analysis in date palm (Phoenix dactyl feral L). Sciatica Horticulture, 134:­ 150–156.( In Persian).

    6. Bassam, B­J., and Caetano-Anollés, G. 1993. Silver staining of DNA in polyacrylamide gels. Applied biochemistry and biotechnology, 42: 181-188.

    7. Billotte, N., Marseillac, N., Brottier, P., Noyer, J.L., Jacquemoud-Collet, J.P., Moreau, C., Couvreur, T., Chevallier, M.H., Pintaud, J.C., and Risterucci, A.M. 2004. Nuclear microsatellite markers for the date palm (Phoenix dactyl feral L): characterization and utility across the genus Phoenix and in other palm genera. Molecular Ecology Notes, 4: 256-258.

    8. Botstein, D., White, RL., Skolmick, M. and Davis, R.W. 1980. Construction of a genetic linkage map in man using restriction fragment length polymorphism. Am. J. Hum. Genet, 32: 314 - 32.

    9. Elmeer, K.H., Sarwath, J., Malek, J., Baum, M., and Hamwieh, A. 2011. New microsatellite markers for assessment of genetic diversity in date palm (Phoenix dactyl feral L). Biotechnology, 1: 91–97.

    10. Habib Nejad, R. 2013. Evaluation of Genetic Diversity Within and Between Male and Female Date Palms Using Microsatellite Markers. Master's thesis on biotechnology in agriculture. Faculty of Agriculture, University of Zabol. ( In Persian).

    11. Garris, A.J., Tai, T.H., Coburn, J., Kresovich, S., and Mccouch, S. 2005. Genetic structure and diversity in Oryza sativa L.Genetics, 24: 6. 163: 169.

    12. Hamwieh, A., Farah, J., Moussally, S., Al-Sham, K., Almer, K., Khierallah, H., Udupa, S., Lababidi, S., Malek, J.A., Aaouine, M., and Baum, M. 2010. Development of 1000 microsatellite markers across the date palm (Phoenix dactyl feral L) genome. Acta Horticulturae, 882: 43. 269-277.

    13. Marsefri, M. And Mehrabi, A. 2010. Evaluation of Genetic Diversity of Some Iranian Date Populations Using Fingerprint Identification (ISSR), National Conference and Iranian Scientific Date Festival, Kerman, Shahid Bahonar University of Kerman. ( In Persian).

    14. Mohammadi, SA. and Prasanna, BM. 2003. Analysis of genetic diversity in crop plants: Salient statistical tools and considerations. Crop Sci, 43: 1235 - 48.

    15. Mirbabaee, S.A., Mardi, M., Mahmoodi, P., Pirseyedi, S.M., Abbasi, A., Farsi, M., Soleimani, H., Bakhshikhaniki, X., Mohajeri-Naraghi, S., Zeinolabedini, M., and KHayam-Nekouei, S.M. 2011. Development of now microsaellit marker from an enriched genomic library of date palm (Phoenix dactyliferaL).Horticultural Science and Biotechnology, 86(5): 539.

    16. Naqavi, M.R., ­Qarehyazi, B., ­ and ­Salkadeh, Q.H. 2007.­ Molecular Markers. University of Tehran press., Iran. 300p. (In Persian).

    17. Nei, M. 1973. Analysis of gene diversity in subdivided populations. Proceedings of the National Academy of Sciences,70: 4. 3301-3321.

    18. Khanam, S., Sham, A., Bennetzen,  J.L.,  and Aly –Mohammed, A.­M. 2012. Analysis of molecular marker-based characterization and genetic variation in date palm (Phoenix dactylifera L.). AJCS, 6: 8.1236-1244.

    19. Salamini, F., Ozkan, H., Brandolini, A., Schafer-Pregl, R., and Martin, W. 2002. Genetics and geography of wild cereal domestication in the Near East. Nature Reviews Genetics, 3: 429-441.

    20. Sambrook, J., Fritsch, E. F., and Maniatis, T. 1989. Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Laboratory, Cold Spring Harbor, NY.

    21. Tar'an, B., Zhang, C., Warkentin, T., Tullu, A., and Vandenberg, A. 2005. Genetic diversity among varieties and wild species accessions of pea (Pisum sativum L.) based on molecular markers, and morphological and physiological characters. Genome, 48: 4. 257-272.

    22. Thakur, v, v., Tiwari, Sh., Tripathi, N., Tiwari, G. and Sapre, S. 2016. DNA barcoding and phylogenetic analyses of mentha species using rbcL sequences. Biotechnology Centre, Jawaharlal Nehru Agriculture University, Jabalpur-482004, Madhya Pradesh, India Annals of Phytomedicine, 5: 1. 59-62.

    23. Vettori, C., Vendramin, G. G., Anzidei, M., Pastorelli, R., paffetti, D. and Giannini, R. 2004. Geographic distribution of chloroplast variation in Italian populations of beech (Fagus sylvatica I) Theuretical and Applied Genetics, 109: 1-9.