طراحی و ساخت وکتور بیانی pET32b+Rh براساس سیستم pET جهت تسهیل پروسه تخلیص پروتئین نوترکیب

نوع مقاله : مقاله پژوهشی

نویسندگان

دانشگاه شهرکرد

چکیده

خالص سازی پروتئین‌ها یک مرحله ضروری برای بررسی عملکرد و ساختار آنها است. به منظور تسهیل تخلیص، پروتئین‌ها غالباً به برچسب تمایلی متصل می‌شوند. هدف از این تحقیق طراحی و ساخت وکتور pET32b(+)Rh بر اساس وکتور بیانی پرکاربرد pET-32b(+) در جهت تخلیص آسان‌تر پروتئین‌های نوترکیب و تنها با استفاده از ستون تمایلی نیکل می‌باشد. بعد از طراحی پرایمر، با استفاده از واکنش PCR قطعه مورد نظر تکثیر یافت و در وکتور pET-32bهمسانه سازی شد. وکتور نوترکیب در باکتری اشریشیا کلای ترانسفورم گشت. بعد از غربالگری با تست کلونی- PCR و آنالیز آنزیمی، تعیین توالی شد. مطالعه عملکرد وکتور با بررسی بیان و تخلیص یک پپتید کوچک سمی دارای پیوندهای دی‌سولفیدی در وکتور pET32b(+)Rh انجام شد. در وکتور جدید pET32b(+)Rh، محل برچسب هیستیدینی در ناحیه انتهای کربوکسیل تیوردوکسین حذف شده و همچنین ناحیه انتهای آمینی پپتید نوترکیب درصورت استفاده از آنزیم BamHI تغییر چندانی نخواهد کرد. برای بررسی عملکرد وکتور، بیان محلول یک پپتید سمی در آن با بررسی و تخلیص دومرحله‌ای با استفاده از روش IMAC، منجر به تخلیص پپتید نوترکیب شد. در این تحقیق از روش ساده و سریع کلونینگ برای دسترسی به یک وکتور تغییر یافته بیانی با استفاده از پلاسمید تجاری موجود، استفاده شد. از وکتور جدید pET32b(+)Rh می‌توان برای بیان پپتیدهایی با ساختار پیچیده که نیازمند به تغییر پس از ترجمه و فیوژن با تیوردوکسین هستند، بهره برد و سپس از تخلیص ساده‌تر بدون نیاز به ستون کروماتوگرافی دیگر یا روش‌های پر هزینه‌ای نظیر HPLC و FPLC برای تخلیص نهایی آن استفاده کرد.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Design and construction of pET32b(+)Rh expression vector based on pET system to facilitate purification.

نویسندگان [English]

  • Leila Rezaei
  • Hoda Ayat Ayat
  • Ali Mohammad Ahadi

Shahrekord university

چکیده [English]

Purification of proteins is an essential step to determining their function and structure. Proteins are often combined with a tag to facilitate purification prosses. The aim of this study was to design and construct pET32b(+)Rh vector based on pET-32b(+) expression vector to simplifiy purification of recombinant proteins only by Nicle column. The primer design was performed taking into account the targeted changes. Using PCR reaction, the desired fragment was amplified and cloned in pET-32b(+) vector. The recombinant vector was transformed into Escherichia coli. After screening by colony-PCR and restriction enzyme analysis, sequencing was performed. Vector function study, was performed by investigating the expression and purification of a toxic peptide IOD-NaTx with disulfide bonds in pET32b(+)Rh vector. In new pET32b(+)Rh vector, the histidine tag site at the C- terminal of thioredoxin was removed and the N-terminal of the recombinant peptide would not change much if BamHI is used for cloning . To evaluate the function of the vector, the soluble expression of a toxic peptide was successfully determined and two-step purification using IMAC method resulted into the pure recombinant peptide. In this study, the simple and fast method of cloning was used to construct a modified expression vector using a commercial plasmid. The new pET32b(+)Rh vector can be used to express complex peptides with disulfide bonds fused with thioredoxin. The recombinant protein could be purified simply without need to costly methods such as HPLC and FPLC or other chromatography columns.

کلیدواژه‌ها [English]

  • pET-32
  • pET32b(+) Rh
  • recombinant protein purification
  • thioredoxin
  • histidine tag

طراحی و ساخت وکتور بیانی pET32b(+)Rh براساس سیستم pET جهت تسهیل پروسه تخلیص پروتئین نوترکیب

لیلا رضایی یونکی، هدا آیت* و علی محمد احدی

ایران، شهرکرد،دانشگاه شهرکرد، دانشکده علوم، گروه ژنتیک

چکیده

خالص سازی پروتئین­ها یک مرحله ضروری برای بررسی عملکرد و ساختار آنها است. بمنظور تسهیل تخلیص، پروتئین­ها غالباً به برچسب تمایلی متصل می­شوند. هدف از این تحقیق طراحی و ساخت وکتور pET32b(+)Rh بر اساس وکتور بیانی پرکاربرد  pET-32b(+) در جهت تخلیص آسان­تر پروتئین­های نوترکیب و تنها با استفاده از ستون تمایلی نیکل می­باشد. بعد از طراحی پرایمر، با استفاده از واکنش PCR قطعه مورد نظر تکثیر یافت و در وکتور pET-32bهمسانه سازی شد. وکتور نوترکیب در باکتری اشریشیا کلای ترانسفورم گشت. بعد از غربالگری با تست کلونی- PCR و آنالیز آنزیمی، تعیین توالی شد. مطالعه عملکرد وکتور با بررسی بیان و تخلیص یک پپتید کوچک سمی دارای پیوندهای دی­سولفیدی در وکتور pET32b(+)Rh انجام شد. در وکتور جدید pET32b(+)Rh، محل برچسب هیستیدینی در ناحیه انتهای کربوکسیل تیوردوکسین حذف شده و همچنین ناحیه انتهای آمینی پپتید نوترکیب درصورت استفاده از آنزیم BamH I  تغییر چندانی نخواهد کرد. برای بررسی عملکرد وکتور، بیان محلول یک پپتید سمی در آن با بررسی و تخلیص دومرحله­ای با استفاده از روش IMAC، منجر به تخلیص پپتید نوترکیب شد. در این تحقیق از روش ساده و سریع کلونینگ برای دسترسی به یک وکتور تغییر یافته بیانی با استفاده از پلاسمید تجاری موجود، استفاده شد. از وکتور جدید pET32b(+)Rh می­توان برای بیان پپتیدهایی با ساختار پیچیده که نیازمند به تغییر پس از ترجمه و فیوژن با تیوردوکسین هستند، بهره برد و سپس از تخلیص ساده­تر بدون نیاز به ستون کروماتوگرافی دیگر یا روش­های پر هزینه­ای نظیر HPLC و FPLC برای تخلیص نهایی آن استفاده کرد.

واژه­های کلیدی: pET-32 ،pET32b(+)Rh ، تخلیص پروتئین نوترکیب، برچسب هیستیدین، تیوردوکسین

*نویسنده مسئول، تلفن: 03832324401، پست الکترونیکی: [email protected]

مقدمه

 

در طول سالهای گذشته، تولید پروتئین­های نوترکیب به یک فناوری مهم تبدیل شده که طیف وسیعی از کاربردها را در زمینه­های مختلف پزشکی و صنعتی شامل می شود (3). افزایش تعداد پپتیدهای درمانی، منجر به پویایی تجارت پپتیدهای نوترکیب شده است (15). تقاضا برای این پروتئین­ها را نمی­توان از منابع طبیعی تأمین کرد. اشریشیا کلای (Escherichia coli) اغلب بدلیل سهولت در کشت، رشد سریع و دانش گسترده از فرآیندهای ژنتیکی و فیزیولوژیکی آن، اولین انتخاب برای تولید پروتئین­های نوترکیب است (13). با این وجود مشکلات زیادی برای بیان پروتئین­های یوکاریوتی در سیستم پروکاریوتی، وجود دارد. عدم وجود چپرون­های یوکاریوتی، تغییرات تخصصی پس از ترجمه و وجود پیوندهای دی­سولفیدی می­تواند منجر به پیچش و تجمع اشتباه پروتئین شود. یکی از موفق­ترین راهکارها برای افزایش بیان پروتئین­های محلول، اتصال با برچسب­های تقویت کننده حلالیت یا پپتیدهای فیوژن، مانند پروتئین اتصال دهنده مالتوز (MBP) (Maltose-binding protein)، تیوردوکسین (Trx)( Thioredoxin) و گلوتاتیون-S-ترانسفراز(glutathione S-transferase) (GST) می­باشد (8). این پروتئین­های فیوژن در وکتورهای بیانی تعبیه می شوند و باید در مراحل بعدی کار حذف شوند (11).  پپتیدهای فیوژن می­تواند برای افزایش سطح بیان و حلالیت، برای ساده سازی ریفولدینگ و افزایش کارآیی آن و برای جلوگیری از تجزیه پروتئین نوترکیب نیز استفاده شود (7). یکی از برچسب­های بسیار مورد استفاده، تیوردوکسین با وزن تقریبا 12 کیلودالتون می­باشد که یک پروتئین کوچک، بسیار محلول و از نظر حرارتی پایدار با ویژگی­های فولدینگ قوی است (14). تیوردوکسین یک پروتئین کاتالیزوری برای تسهیل ایجاد پیوندهای دی­سولفیدی و  افزایش حلالیت پروتئین­ها است، بنابراین تشکیل اجسام انکلوژن را کاهش می­دهد و برنامه­های محلول­سازی با استفاده از اوره را کم می­کند (10). بغیر از این، در وکتورهای بیانی از برچسب­های تمایلی (affinity tag) نیز برای تسهیل پروسه­های مختلف تشخیص و تخلیص استفاده می­شود که حداقل تأثیر بر ساختار سوم و فعالیت زیستی پروتئین را دارند (23). امروزه برچسب­های تمایلی مختلفی استفاده می شود که شامل برچسب­های poly-Arg ، FLAG، poly-His، c-myc، S-tag می­باشند (11). از این میان برچسب­های پلی هیستیدین (Polyhistidine)، برای خالص­سازی پروتئین­های نوترکیب با روش کروماتوگرافی تمایلی (IMAC) (Immobilized Metal Ion Affinity Chromatography) که مبتنی بر تعاملات بین یک یون فلز Ni2+، تثبیت شده روی ماتریس و زنجیره­های جانبی اسید آمینه هیستیدین است، بیشتر مورد استفاده قرار می­گیرد (9).

 طیف گسترده­ای از وکتورهای کلونینگ تجاری برای تولید و بیان پروتئین­های نوترکیب دارای برچسب پلی هیستیدین در سیستم­های بیانی مختلف مانند اشریشیا کلای، وجود دارد (5). سیستم بیانی pET از قدرتمندترین سیستم­هایی است که  بمنظور کلون و بیان پروتئین­های نوترکیب در اشریشیا کلای استفاده می­شود. زمانیکه ژن هدف در داخل وکتور کلون می­شود، رونویسی تحت کنترل پروموتر قوی باکتریوفاژ T7 انجام می­گیرد. RNA پلی­مراز باکتریوفاژ T7 در ژنوم باکتری قرار دارد و بصورت کاملا اختصاصی به پروموتر خود متصل و رونویسی انجام می­گیرد. پروموتر توسط  IPTG القا می­گردد و می­توان بیان بالایی از محصول را بدست آورد. این بیان بالای سیستم pET گاهی منجر به ایجاد اجسام انکلوژن بدلیل دارا بودن تغییرات پس از ترجمه در پپتید نوترکیب و یا پیوندهای دی­سولفیدی آن می­شود (16و19). وکتور بیانی قوی pET-32 که با اضافه کردن تیوردوکسین بصورت فیوژن به پروتئین نوترکیب میزان بیان را افزایش داده و حلالیت و ساختار پروتئین را تصحیح می­کند، بسیار پراستفاده است. همچنین این سیستم بیانی برای بیان پروتئین­های سمی در اشریشیا کلای نیز بسیار کارآمد است، زیرا اضافه شدن تیوردوکسین مانع اعمال اثر سمیت پپتید در باکتری و کاهش بیان پپتید یا مرگ باکتری می­شود. وکتور پرکاربرد pET-32b(+) دارای برچسب­های تخلیص و شناسایی S-tag و دو برچسبHis.tag   در بالادست و پایین دست پپتید نوترکیب می­باشد. تیوردوکسین جهت محلول سازی و افزایش بیان پروتئین نوترکیب در N ترمینال پپتید نوترکیب اضافه می­شود. دو جایگاه آنزیمی ترومبین و انتروکیناز در وکتور تعبیه شده که در نهایت بعد از بیان و تخلیص، از طریق پروتئاز مربوطه تیوردوکسین با S.tag و یکی از تگ های His جدا می­شود، در آخر برای تخلیص نهایی پپتید نوترکیب از روش HPLC یا FPLC و یا جداسازی تیوردوکسین متصل به S-tag استفاده می­شود و پروتئین خالص طی دو مرحله بدست می­آید. استفاده از S-tag برای جداسازی تیوردوکسین نیازمند به ستون کروماتوگرافی تمایلی با آنتی بادی اختصاصی دارد، همچنین می توان از روشهای پرهزینه HPLC یا FPLC برای تخلیص نهایی پپتید نوترکیب از تیوردوکسین، استفاده کرد. این پژوهش برای طراحی پلاسمیدی که با آن بتوان بهره­وری تخلیص را بالا برده و بصورت ساده تر و ارزان قیمت پروتئین نوترکیب را تخلیص کرد، طراحی شد. در پژوهش حاضر اولین توالی هیستیدینی در N ترمینال پروتئین نوترکیب بهمراه دو توالی برش آنزیمی Nco I   و EcoR V  حذف گردید. حذف اولین تگ هیستیدینی باعث می شود که در مرحله دوم  تخلیص با ستون کروماتوگرافی نیکل، تیوردوکسین تخلیص نشده و تنها پپتید نوترکیب جداسازی شود. پس از تخلیص پروتئین نوترکیب با دم پلی هیستیدینی و روش IMAC، با هضم آنزیمی پروتئین، دو پپتید نوترکیب و پپتید تیوردوکسین حاصل می­شود که در مرحله بعدی نیز می­توان از روش IMAC برای تخلیص پپتید نوترکیب استفاده کرد. بیان و تخلیص موفق یک پپتید کوچک با پیوندهای دی­سولفیدی در وکتور جدید pET32b(+)Rh نشاندهنده عملکرد صحیح وکتور بود.

مواد و روشها

مواد: سویه Top10F اشریشیا کلای بعنوان میزبان کلونینگ، سویه BL21 بعنوان میزبان بیانی و همچنین وکتور بیانی pET-32b(+) ساخت شرکت نواژن جهت انجام تحقیق، تامین گردید. محیط کشت Luria-Bertani))LB برای کشت باکتری استفاده شد، آنزیم­های  BamH I و Xho I  و (Msc I) Bal I و کیت استخراج DNA از ژل آگارز و کیت تخلیص محصول PCR و  T4 لیگاز از شرکت فرمنتاز، آنزیم Pfu از شرکت پیشگام و  Taq پلی­مراز از سیناژن خریداری گردید.

بررسی جایگاه­های برش آنزیمی  وکتور  pET-32b(+) و طراحی پرایمر: در ابتدا با استفاده از نرم افزار Gene Runner 3.05 توالی بین  T7 پروموتر و T7 ترمیناتور از لحاظ جایگاه­های برش آنزیمی و همچنین حفظ ترتیب نوکلئوتیدها در قالب خواندن مورد بررسی قرار گرفت. بمنظور حذف توالی هگزا هیستیدین سمت انتهای آمین پلاسمید، با نرم افزار Gene Runner 3.05 طراحی پرایمر انجام گرفت. با در نظر گرفتن جایگاه آنزیمی Msc I  پرایمر پیشرو For MscI  با جایگاه برش (Bal I) Msc I و پرایمر معکوس  Rev BamH I  با جایگاه برش BamH I   طراحی گردید مشخصات پرایمرهای در جدول 1 آمده است.

 

 

جدول 1- توالی پرایمری مربوط به طراحی وکتور در این پژوهش( جایگاه شناسایی آنزیم با خظ زیر آن مشخص شده است)

نام توالی

تعداد نوکلئوتید

توالی کد کننده(3     5)

پرایمر پیشرو  For Msc I

28

5TGCTTGGCCATTCTTCCGGTCTGGTGCC3

پرایمرمعکوس Rev BamH I

28

5TATCGGATCCGCCTTGTCGTCGTCGTCG3

پرایمر T7  ترمیناتور

19

5GCTAGTTATTGCTCAGCGG3

پرایمر T7  پروموتر

20

5TAATACGACTCACTATAGGG3

 

 

تکثیر توالی از جایگاه آنزیمی Msc I  تا BamH I : بعد از کشت 16 ساعته باکتری در محیط LB مایع در دمای C˚37 درجه، استخراج پلاسمید pET-32b(+)  از باکتری Top10 با روش قلیایی انجام شد و محصول بعنوان الگو در واکنش PCR استفاده شد؛ توالی بین T7 پروموتر و T7 ترمیناتور تکثیر شد و از روی محصول PCR آن، توالی بین جایگاه Msc I  تا BamH I  با پرایمرهای سنتز شده تکثیر گردید. واکنش PCR برای هر دو مورد در حجم نهایی 25 میکرولیتر با اضافه کردن 1 میکرولیتر از هر پرایمر، 5/2 میکرولیتر بافر PCR (10x) ، 5/ 0 میکرولیتر   dNTP 10 میلی مولار، 2/0 میکرولیتر  Taq پلی مراز  5 واحد بر میکرولیتر و 1 میکرولیتر DNA الگو انجام گرفت. تکثیر قطعه 123 جفت بازی بمنظور جلوگیری از جهش توسط Pfu پلیمراز انجام گرفت. چرخه­های PCR  برای توالی بین T7 پروموتر و T7 ترمیناتور شامل: یک مرحله واسرشت ابتدایی در دمای C˚94 به مدت 5 دقیقه، واسرشت شدگی در دمای  C˚94 به مدت 30  ثانیه، اتصال پرایمر به رشته الگو در دمای  C˚58 به مدت 45 ثانیه، تکثیر قطعه مورد نظر در دمای  C˚72 به مدت  1 دقیقه برای 35 سیکل و در پایان یک مرحله تکثیر نهایی در دمای C ˚72 درجه به مدت  5  دقیقه استفاده شد. برای قطعه 123 جفت بازی به همان ترتیب فقط با 30 سیکل متوالی  C˚72، 56، 94 هر کدام 40 ثانیه انجام پذیرفت. محصول PCR روی ژل آگارز برده شد و جهت خالص سازی توسط کیت، از روی ژل بریده شد (10).

هضم آنزیمی واکنش اتصال: پلاسمید pET-32b(+) و قطعه­ی تکثیر یافته تحت اثر آنزیم­های Msc I  و BamH I  به مدت 16 ساعت در دمای 37 هضم شدند. هر دو محصول هضم آنزیمی فوق روی ژل اگارز 1% الکتروفورز شدند. باند 123 جفت بازی و پلاسمید خطی شده از روی ژل با استفاده از کیت بیورد جدا شدند. مقدار 2/0 میکروگرم قطعه تخلیص شده از ژل با 1/0 میکروگرم پلاسمید در واکنش اتصال  حاوی 1 واحد لیگاز و حجم نهایی 25 میکرولیتر قرار گرفتند. تیوپ حاوی واکنش اتصال، بمدت یک ساعت ونیم در دمای 16 و یک ساعت در دمای محیط قرار گرفت.

تهیه­ی سلول­های مستعد و ترانسفورماسیون: باکتری Top10 در ml5 محیط آمپی­سیلین دار LB رشد داده شد تا OD به 4/0 رسید. با استفاده از CaCl2  1/0 مولار سلول­های مستعد تهیه شد. مخلوط واکنش اتصال در باکتری مستعد ترانسفورم شد و روی پلیت­های LB آگار آمپی­سیلین دار، کشت داده شد و بمدت 16 ساعت در انکوباتور  C˚37 قرار داده شدند.

غربالگری کلونی­های واجد پلاسمید جدید بروش کلونی-PCR: برای اینکه ورود قطعه ژنی به وکتور مورد تایید قرار گیرد، از روش کلونی-PCR  استفاده شد. در این روش از پلیتی که حاوی کلونی­های حاصل از ترانسفرم بود، چند کلونی بهمراه کلونی کنترل بطریق شطرنجی کشت داده شد. واکنش PCR، با  محلول باکتری قرار گرفته بمدت 10 دقیقه در دمای˚ C96 و شرایط قبلی، انجام گرفت و روی ژل 2% الکتروفورز شد. پرایمر T7 ترمیناتور و  T7پروموتر نیز بمنظور انجام کلونی-PCR و طراحی وکتور مورد استفاده قرار گرفتند. چند کلنی با نتیجه PCR مثبت در محیط LB مایع کشت داده شد و سپس استخراج پلاسمید از آن­ها انجام گرفت.

آنالیز آنزیمی پلاسمیدهای استخراج شده: از آنجایی که پلاسمید جدید فاقد جایگاه آنزیمی Nco I و EcoR V  می­باشد، بر روی پلاسمید استخراج شده و نیز پلاسمید pET-32b  بعنوان کنترل، آنالیز آنزیمی تحت اثر آنزیم های BamH I  و Nco I ، صورت گرفت. برش آنزیمی با آنزیم Nco I  روی پلاسمیدها بمدت 4 ساعت و در دمای C˚37 انجام گرفت. همچنین جهت تایید سالم بودن جایگاه برش BamH I ، پلاسمید بمدت 4 ساعت بهمراه کنترل تحت اثر این آنزیم قرار گرفت و بر روی ژل 1% الکتروفورز شد. در نهایت پلاسمید تایید شده با آنالیز آنزیمی، تعیین توالی شد.

بررسی بیان و تخلیص پپتید نوترکیب از وکتور جدید  pET32b(+)Rh: بمنظور بررسی صحت و تمامیت وکتور جدید، ژن کدکننده توکسین IOD-NaTx جدا شده از عقرب، در پلاسمید نوترکیب pET32b(+)Rh کلون شد (اطلاعات در دست چاپ) و به باکتری مستعد BL21 با روش شوک حرارتی ترانسفورم شد. تک کلونی از آن در محیط کشت LB کشت شبانه داده شد و بعد از تلقیح و رسیدن OD به 6/0 بیان آن در اثر القا با IPTG با مقدار 1 میلی مولار در مدت 8 ساعت و دمای  C˚28 انجام شد. باکتری­ها جمع­آوری شده، لیز شده و تخلیص پپتید نوترکیب فیوژن با تیوردوکسین با ستون IMAC انجام شد. بعد از هضم پپتید فیوژن با انتروکیناز، پپتید خالص IOD-NaTx با روش IMAC دوباره تخلیص شد و پپتید نوترکیب حاصل شد ( جزئیات روش­ها در مقاله در دست چاپ)

نتایج

طراحی وکتور: بمنظور تغییر وکتور pET-32b(+)  طراحی پرایمر انجام شد. جایگاه­های آنزیمی بررسی شد تا مشکل یا تداخل عمل آنزیمی یا تغییر قاب خوانش مشاهده نشود. برای عدم تغییر قاب خوانش، یک نوکلئوتید در انتهای ˊ5 پرایمر اضافه شد.

استخراج پلاسمید و تکثیر توالی: پلاسمید pET-32b(+)استخراج شده و سپس توالی بین T7 پروموتر تا T7 ترمیناتور با اندازه حدودا 650 جفت بازی تکثیر شد (شکل 1 الف) و بعنوان الگو برای تکثیر توالی 123 جفت بازی با پرایمرهای F و R که شامل جایگاه برش  Msc I  و BamH I  می­باشند، استفاده گردید (شکل 1 ب).

 

 

شکل 1- الکتروفورز محصول PCR : تصویر الف - باند مربوط به توالی بین T7 پروموتر و T7 ترمیناتور بر روی ژل آگارز 1 درصد. اصل از پرایمرهای For Msc I و Rev BamH I  مربوط به توالی 123جفت بازی بر روی ژل آگارز 1 درصد. (M: مارکر 100 جفت بازی)

 

 

کلون سازی وکتور جدید: پلاسمید و قطعه­ی 123 جفت بازی هر دو تحت تاثیر آنزیم های برشگر Msc I  و BamH I  قرار گرفتند. قطعه 123 جفت بازی توسط کیت تخلیص DNA، خالص سازی گشت. پلاسمید هضم شده نیز از روی ژل بریده و تخلیص گردید. پس از اتصال پلاسمید برش خورده و قطعه 123 جفت بازی و ترانسفورم به سلول­های مستعد، کلونی­هایی بر روی محیط کشت رشد یافت که شامل کلونی­های نوترکیب و غیرنوترکیب بودند.

غربالگری کلونی­های واجد پلاسمید جدید بروش کلونی-

PCR:از تعداد کلونی­هایی که ترانسفورم شده بودند 8 کلونی کشت شطرنجی شده بود که بر روی آن­ها کلونی-PCR با پرایمرهای T7 پروموتر و T7 ترمیناتور انجام گرفت. کلونی­های حاوی وکتور نوترکیب که pET32b(+)Rh (Rh حروف اول نام سازندگان وکتور) نام گرفت، با اندازه 30 جفت باز کمتر از وکتور کنترل در ژل مشخص می­باشند که در (شکل 2) مشخص می­باشد.

آنالیز آنزیمی: پلاسمید نوترکیب استخراج و مورد بررسی آنزیمی قرار گرفت. در این مرحله تعدادی از پلاسمیدها توسط آنزیم Nco I  خطی شدند که نشان دهنده وکتور اولیه می­باشد ولی تعدادی از آن­ها بدلیل عدم وجود این جایگاه در پلاسمید جدید، خطی نشدند و دارای هر 3 باند تخلیص پلاسمید می­باشد (شکل 3 الف)، برش با آنزیم BamH I  برای بررسی پلاسمید نیز انجام شد (شکل 3 ب).

بررسی نتایج حاصل از آنالیز آنزیمی تایید کننده جایگزینی توالی جدید در پلاسمید pET32b است. همچنین نتایج حاصل از تعیین توالی با استفاده از پرایمرهای عمومی   T7 پروموتر و T7 ترمیناتور تایید کننده نهایی پلاسمید جدید بود. شکل 5 نشاندهنده تغییر اعمال شده در وکتور جدید در مقایسه با pET32b می باشد.

بررسی بیان و تخلیص پروتئین نوترکیب: بمنظور بررسی بیان پروتئین نوترکیب در وکتور طراحی شده، پپتیدIOD-NaTx  که یک پپتید سمی با سه پیوند دی­سولفیدی در ساختار خود است، در این وکتور کلون­سازی و بیان شد و سپس مورد تخلیص با روش IMAC قرار گرفت.

 

شکل 2 - نتیجه­ی کلونی-PCR با پرایمرهای وکتور بر روی باکتری­ها بر روی ژل 2 درصد. ، C: کلونی کنترل و 1 تا 8 نمونه­های کلونی. نمونه­های 1 تا 4 باند مورد نظر را حدودا 30 نوکلئوتید کمتر از کنترل نشان می­دهند(M: مارکر 100 جفت بازی)

 

 

 

شکل 3- تایید تغییر پلاسمید نوترکیب با استفاده از الگوی هضم آنزیمی Nco I  و BamH I  : (الف) آنزیم­ Nco I  و (ب) آنزیم BamH I .  شکل الف ستون 1 مربوط به پلاسمید نوترکیب است که بدلیل فقدان جایگاه برش Nco I  ، خطی نشده است و ستون 2 مربوط به پلاسمید کنترل است که بصورت خطی دیده میشود و در شکل ب نیز ستون 1 مربوط به پلاسمید جدید و ستون 2 پلاسمید کنترل می­باشد که در هر دو بدلیل حضور جایگاه برش  BamH I   بصورت خطی دیده می­شود.

 

پپتید تخلیص شده مورد هضم آنزیمی با انتروکیناز قرار گرفت. برای جداسازی پپتید IOD-NaTx  از تیوردوکسین حاصل از هضم، تخلیص مجدد با ستون کروماتوگرافی IMAC انجام شد که در نتیجه پپتید نوترکیب خالص بر روی ژل SDS-PAGE مشخص شد (شکل 5).

بحث

سیستم بیانی پروکاریوتی برای تولید زیاد پروتئین­های نوترکیب اولین انتخاب است اما بدلیل عدم تغییرات پس از ترجمه و نیز تشکیل اجسام انکلوژن در بیان های بالا مشکل­ساز است. از آنجایی که دوباره تاخوردن و ریفولد پروتئین­های نامحلول در اجسام انکلوژن کار دشواری است، بنابراین تولید پروتئین نوترکیب محلول از اهمیت بسیار زیادی در بیوتکنولوژی برخوردار هست. برای برطرف کردن این چالش­های بهره­ وری، پپتیدهای فیوژن و برچسب­های مختلف برای افزایش بازده بیان و تأثیر در حلالیت و ساختار پروتئین نوترکیب در وکتورهای بیانی گنجانیده شده است (24).

 

شکل 4- شکل شماتیک وکتور pET32b(+) و توالی مربوط به کاست بیانی آن در مربع. توالی مربوط به کاست بیانی وکتور طراحی شده pET32b(+)Rh در مربع پایین آمده است. همانطور که در شکل مشخص می­باشد توالی His.tag اول و دو جایگاه برش Nco I   و EcoR V   حذف گردیده است.

 

یکی از بهترین برچسبهای محلول سازی تیوردوکسین می­باشد. این برچسب برای کاهش تولید پروتئین بصورت نامحلول و شکل­گیری باندهای دی­سولفیدی و تشکیل ساختار سوم صحیح استفاده می­شود (16و14). اکثر وکتورهای حاوی تیوردوکسین بصورت فیوژن با پپتید نوترکیب، یک تخلیص دومرحله­ای برای جدا سازی تیوردوکسین نیاز دارند.  مرحله اول معمولا تخلیص پروتئین نوترکیب فیوژن با برچسب هیستیدینی و یا برچسب­های دیگر با روش­های IMAC یا کروماتوگرافی تمایلی است و پس از این تخلیص، پپتیدهای فیوژن توسط پروتئازها بریده می­شود (12). در مرحله دوم تخلیص از روش­های تخلیص پیچیده­تر بر اساس اندازه و یا خواص دیگر پروتئین استفاده می­شود که معمولا هزینه­بر خواهد بود. معروف­ترین وکتور حاوی تیوردوکسین در وکتورهای بیانی pET-32 می­باشد که از همین روش تخلیص استفاده می­کند و بیان بهتری برای پروتئین نوترکیب موجب می‍شود (1).

 

 

شکل 5-  تصویر تخلیص پروتئین IOD-NaTx. ستون 2 مربوط به پروتئین فیوژن IOD-NaTx با تیوردوکسین و ستون 1 پس از جداسازی انتروکیناز و تخلیص مجدد پروتئین IOD-NaTx با ستون نیکل می باشد، M مارکر پروتئینی.

 

جداسازی پپتید تیوردوکسین از محلول حاوی پروتئین نوترکیب مرحله نهایی تخلیص در استفاده از این وکتور است که یا با S-tag تیوردوکسین جدا می شود و یا با روش­های کروماتوگرافی خاص مانند HPLC یا FPLC پروتئین نوترکیب تخلیص می­شود. مشکلات استفاده از این روش­ها بیشتر مربوط به گران­قیمت بودن دستگاه، هزینه بالای مواد لازم برای تخلیص و شرایط خاص آن­ها می­باشد. در نهایت ماهیت نمونه و تلاش برای حفظ عملکرد فعال آن­ها، به چالش منجر می­شود. بعنوان مثال در کروماتوگرافی FPLC از آنجایی که ساختار سوم پروتئین برای عملکردش بسیار مهم می­باشد، در طول تخلیص، پروتئین نباید تحت دما، فشار بالا، pH شدید یا حلال­ها قرار بگیرد. چالش دیگر FPLC مربوط به اجزای دستگاه می­باشد که در تماس با محلول­های بافری نمکی فاز متحرک می­باشد. دستگاه­های کروماتوگرافی عموما از فولاد ضد ­زنگ ساخته می­شوند. نمک موجود در بافرها می­تواند منجر به خوردگی فلز شود و از سوی دیگر، یون­های فلزی موجود در فولاد ضد ­زنگ می­توانند ساختار پروتئین را مختل سازند.  همچنین از FPLC برای جداسازی پپتیدهای کوچک نمی توان استفاده کرد و باید از تکنیک HPLC بدین منظور استفاده کرد که نیاز به دسترسی به دستگاه های مختلف برای پپتیدها با اندازه های مختلف را لازم می کند (21). سایر روش­های تخلیص تبادل یونی، تعامل آبگریزی و کروماتوگرافی مبتنی بر اندازه بعنوان گام­های کمکی برای تقویت بیشتر خلوص نمونه در صورت لزوم استفاده می­شوند که منجر به هزینه­های بیشتر می­شوند(20).  تغییر در وکتورهای بیانی بدلایل مختلف برای افزایش راندمان تولید پپتید نوترکیب انجام شده است (22). Liu و همکاران ساخت وکتورهای pET32α را برای اهداف مختلف بیانی مورد بررسی قرار دادند (17). در مطالعه دیگر برای تولید مداوم و زیاد پروتئین نوترکیب وکتورهای بیانی بر اساس پلاسمید pIGDM1 توسعه یافت (18). در این مطالعه نیز بهینه کردن پروسه تخلیص با تغییر وکتور مورد توجه قرار گرفت. بدلیل وجود دو توالی پلی هیستیدین در pET-32، بعد از بیان به هر دو انتهای کربوکسیل ژن مطلوب و تیوردوکسین دو توالی پلی هیستیدین می­تواند اضافه شود که بعد از بیان در تخلیص نهایی پروتئین بروش کروماتوگرافی تمایلی، ایجاد اختلال می­نماید. پس از برش پروتئین نوترکیب از تیوردوکسین در هر دو انتهای کربوکسیل پروتئین نوترکیب و تیوردوکسین جداشده، تگ هیستیدینی وجود خواهد داشت و امکان استفاده از ستون نیکل برای جدا کردن پروتئین نوترکیب وجود ندارد. بنابراین در این پژوهش، پلاسمید تغییر یافته pET32b(+)Rh بمنظور تسهیل فرایند خالص­سازی ساخته شد. در این وکتور توالی پلی هیستیدین انتهای کربوکسیل تیوردوکسین، حذف شده و در نتیجه پروتئین با یک توالی پلی هیستیدین منفرد در انتهای کربوکسیل، بیان می­شود که فرآیند تخلیص آن ساده می­باشد و با توجه به مطالعات زیاد انجام گرفته این توالی معمولا تداخلی در عملکرد پروتئین ایجاد نخواهد کرد (6). حضور یک توالی هیستیدین در وکتور pET32b(+)Rh امکان خالص­سازی کم هزینه تر محصول را در یک پروسه دو مرحله­ای با استفاده از ستون­های تمایلی نیکل فراهم کرد و نیاز به روش­های کروماتوگرافی­ دیگر را از بین برد. در اینجا برای بررسی عملکرد وکتور از پپتید سمی IOD-NaTx  با سه پیوند دی­سولفیدی در ساختار استفاده شد که در بیان بالا در باکتری فولدینگ نادرست داشته و تشکیل اجسام انکلوژن می­دهد. بیان IOD-NaTx  در وکتور pET32b(+)Rh بدلیل ترکیب فیوژن تیوردوکسین با آن، در فاز محلول دیده شد، همچنین اتصال تیوردوکسین به آن مانع از اثر سمی IOD-NaTx  بر میزبان شد. پس از تخلیص با توالی هیستیدینی در ستون نیکل در مرحله اول، هضم با انتروکیناز و جداسازی ناحیه تیوردوکسین از آن، انجام شد و سپس تخلیص مجدد با ستون نیکل برای جداسازی پپتید از تیوردوکسین صورت گرفت.

 تغییر دیگری که در وکتور جدید اعمال شد حذف دو جایگاه برش آنزیم های Nco I  و EcoR V  از سایت کلون سازی بود که بدین صورت آنزیم BamH I  بعنوان اولین آنزیم محل کلون سازی قرار می گرفت. با توجه به پرکاربرد بودن آنزیم BamH I  در پروسه­های کلون­سازی بدلایل مختلف نظیر دردسترس بودن، ارزان­تر بودن و سادگی کار در مقایسه با دیگر آنزیم­های برش­دهنده، نحوه تغییر وکتور بصورتی انجام شد که این آنزیم بعنوان اولین آنزیم در ناحیه آمینی پپتید نوترکیب قرار گرفته و اسید آمینه­های اضافی موجود در pET-32 اصلی در این ناحیه قرار نمی­گیرد. با حذف دو جایگاه برش آنزیم­های Nco I و EcoR V از وکتور، بعد از استفاده از آنزیم انتروکیناز، در ابتدای ژن مطلوب، تنها دو اسیدآمینه اضافه­ قرار می­گیرد که احتمال تغییر در ساختار پروتئینی آن را کم کرده و انتهای آمینی ساده ایجاد خواهد کرد.

نتیجه ­گیری

 در این تحقیق از روش ساده و سریع کلونینگ برای دسترسی به یک پلاسمید جدید pET32b(+)Rh با استفاده از پلاسمیدهای تجاری موجود، استفاده شد. این وکتور که دارای پپتید فیوژن تیوردوکسین می باشد باعث افزایش میزان حلالیت پروتئین نوترکیب می­شود. همچنین استفاده از pET32b(+)Rh از لحاظ اقتصادی مقرون به صرفه می­باشد چرا که نیاز بروش­های تخلیص پرهزینه در مرحله دوم تخلیص را از بین می­برد. وکتور جدید می­تواند در تولید کم هزینه­تر پروتئین­های نوترکیب که دارای باندهای دی­سولفیدی هستند نظیر اکثر پروتئین­های یوکاریوتی استفاده شود و پروسه تخلیص نهایی را با استفاده از ستون نیکل ساده­تر کند.

قدردانی و تشکر

 بدین وسیله نویسندگان مقاله از دانشگاه شهرکرد بدلیل حمایت مالی و معنوی برای انجام این پژوهش تشکر می‍کنند.

  • طاهرزاده، م، فولادوند، م، کاظمی، ب. 1399. مقایسه وکتورهای بیانی pET32a و pET25b در بیان توالی پلی اپیتوپی سنتز شده از آنتی ژن های انگل لیشمانیا اینفانتوم. دوماهنامه طب جنوب. 23 (2) : 152-143.
  • حسین زاده، ا، زمانی، م، مطلبی، م. 1383. مطالعه اثر مهارکنندگی پروتئین های ممانعت کننده فعالیت آنزیم پلی گالاکتوروناز در واریته درخشان گیاه لوبیا و تعیین توالی ژن کدکننده آن. زیست شناسی ایران. 17 (2) : 137-126
  • Baldi, L., Hacker, D. L., Adam, M., & Wurm, F. M. (2007). Recombinant protein production by large-scale transient gene expression in mammalian cells: state of the art and future perspectives. Biotechnology letters29(5), 677-684.
  • Bogomolovas, J., Simon, B., Sattler, M., & Stier, G. (2009). Screening of fusion partners for high yield expression and purification of bioactive viscotoxins. Protein expression and purification64(1), 16-23.
  • Bornhorst, J. A., & Falke, J. J. (2000). [16] Purification of proteins using polyhistidine affinity tags. In Methods in enzymology (Vol. 326, pp. 245-254). Academic Press.
  • Bucher, M. H., Evdokimov, A. G., & Waugh, D. S. (2002). Differential effects of short affinity tags on the crystallization of Pyrococcus furiosus maltodextrin-binding protein. Acta Crystallographica Section D: Biological Crystallography58(3), 392-397.
  • Butt, T. R., Edavettal, S. C., Hall, J. P., & Mattern, M. R. (2005). SUMO fusion technology for difficult-to-express proteins. Protein expression and purification43(1), 1-9.
  • Dyson, M. R., Shadbolt, S. P., Vincent, K. J., Perera, R. L., & McCafferty, J. (2004). Production of soluble mammalian proteins in Escherichia coli: identification of protein features that correlate with successful expression. BMC biotechnology4(1), 32.
  • Ford, C. F., Suominen, I., & Glatz, C. E. (1991). Fusion tails for the recovery and purification of recombinant proteins. Protein expression and purification, 2(2-3), 95-107. 
  • Hamedifar, H., Salamat, F., Saffarion, M., Ghiasi, M., Hosseini, A., Lahiji, H., ... & Mahboudi, F. (2013). A novel approach for high level expression of soluble recombinant human parathyroid hormone (rhPTH 1-34) in Escherichia coli. Avicenna journal of medical biotechnology5(3), 193.
  • Hedhammar, M., Gräslund, T., & Hober, S. (2005). Protein engineering strategies for selective protein purification. Chemical Engineering & Technology: Industrial ChemistryPlant EquipmentProcess EngineeringBiotechnology28(11), 1315-1325.
  • Kim, D. S., Kim, S. W., Song, J. M., Kim, S. Y., & Kwon, K. C. (2019). A new prokaryotic expression vector for the expression of antimicrobial peptide abaecin using SUMO fusion tag. BMC biotechnology19(1), 13.
  • Kyratsous, C. A., Silverstein, S. J., DeLong, C. R., & Panagiotidis, C. A. (2009). Chaperone-fusion expression plasmid vectors for improved solubility of recombinant proteins in Escherichia coli. Gene440(1-2), 9-15.
  • LaVallie, E. R., Lu, Z., Diblasio-Smith, E. A., Collins-Racie, L. A., & McCoy, J. M. (2000). Thioredoxin as a fusion partner for production of soluble recombinant proteins in Escherichia coli. Methods in enzymology326, 322-340.
  • Lax, R. (2010).The future of peptide development in the pharmaceutical industry. PharManufacturing: The international peptide review2, 10-15.
  • Liu, H., & Naismith, J. H. (2009). A simple and efficient expression and purification system using two newly constructed vectors. Protein expression and purification63(2), 102-111.
  • Liu, Z. Q., & Yang, P. C. (2012). Construction of pET-32 α (+) vector for protein expression and purification. North American journal of medical sciences, 4(12), 651.
  • Mikiewicz, D., Plucienniczak, A., Bierczynska-Krzysik, A., Skowronek, A., & Wegrzyn, G. (2019). Novel expression vectors based on the pIGDM1 plasmid. Molecular biotechnology61(10), 763-773.
  • Rai, M., & Padh, H. (2001). Expression systems for production of heterologous proteins. Current science, 1121-1128.
  • Raran-Kurussi, S., & Waugh, D. S. (2016). A dual protease approach for expression and affinity purification of recombinant proteins. Analytical biochemistry, 504, 30-37.
  • Runde S., (2016). FPLC versus Analytical HPLC: Two Methods, One Origin, Many Differences, The Column, 12(15): 12-16.
  • Soleyman M. R., Khalili M., Soleiman Meiguni A. R., Baazm M., (2019) Optimization of PET Expression Vector for Fusion of Recombinant Protein and Elastin-Like Polypeptide Biopolymer, Journal of Arak university of medical science, 22 (5): 44-55
  • Terpe, K., (2003). Overview of tag protein fusions: from molecular and biochemical fundamentals to commercial systems. Applied microbiology and biotechnology60(5), pp.523-533.
  • Young, C. L., Britton, Z. T., & Robinson, A. S. (2012). Recombinant protein expression and purification: a comprehensive review of affinity tags and microbial applications. Biotechnology journal7(5), 620-634.
دوره 34، شماره 2
تیر 1400
صفحه 169-181
  • تاریخ دریافت: 21 آذر 1399
  • تاریخ بازنگری: 05 بهمن 1399
  • تاریخ پذیرش: 17 اسفند 1399
  • تاریخ اولین انتشار: 15 اردیبهشت 1400