نوع مقاله : مقاله پژوهشی

نویسندگان

1 گروه زیست شناسی، دانشکده علوم پایه، دانشگاه شهید مدنی آذربایجان، تبریز، ایران

2 گروه زیست شناسی، دانشکده علوم پایه، دانشگاه شهید مدنی آذزبایجان، تبریز، ایران.

چکیده

-آسپاراژیناز آنزیمی است که اسید آمینه ی آسپاراژین را به آسپارتیک‌اسید و آمونیاک هیدرولیز می‌کند. L -آسپاراژیناز داروئی برای درمان لوکمیا و لنفوما به‌طور اساسی از باکتری‌هایی مانند Escherichia coli وErwina chrysanthemi تولید می‌شود و جستجو برای یافتن منابع جدید برای این آنزیم ادامه دارد. در این تحقیق جداسازی باکتری‌های تولید کننده آنزیم L-آسپاراژینازاز پساب حاصل از فرآوری سیب زمینی انجام شد. پساب حاصل از مرحله شستشو، حاوی تمام ترکیبات محلول در آب سیب‌زمینی نظیر مقادیر قابل توجهی از اسید آمینه ی آسپاراژین است. جداسازی و غربالگری باکتری‌ها بر روی محیط‌های نوترینت آگار و محیط M9 انجام شد. دو جدایه با نام‌های PW4 وPW5 قابلیت تولید آمونیوم در محیط M9 را دارا بودند. شناسایی مولکولی و آزمایشات بیوشیمیایی نشان داد که این جدایه‌ها به ترتیب متعلق به جنس Escherichia وEnterococcus هستند. سنجش کمی و کیفی میزان تولید آنزیم این جدایه‌ها در شرایط مختلف انجام شد. بیشترین میزان تولید را جدایه‌ی PW4 در صورت رشد در محیط حاوی گلوتامین با میزان
IUml-1 10 نشان داد. بیشینه‌ی میزان تولید آنزیم توسط جدایه‌ی PW5 نیز در نتیجه تغلیظ مایع رویی حاصل از کشت باکتری در محیط کشت حاوی آسپاراژین به میزان IUml-133/2 مشاهده شد. دو آنزیم بررسی شده فعالیت گلوتامینازی از خود نشان ندادند. نتایج نشان داد، بیشینه‌ی فعالیت آنزیم تولیدی توسط جدایه‌ی PW4 در دمای 37 درجه سلسیوس بوده و فعالیت آنزیم در دماهای پائین‌تر و بالاترکاهش از آن کاهش می یابد. این نتایج خاطرنشان می سازد که این آنزیم قابلیت مطالعات بیشتر جهت استفاده در طراحی دارو را دارا می باشد.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Isolation and Identification of asparaginase-producing bacteria from potato processing wastewater

نویسندگان [English]

  • Neda Neghabi 1
  • Elaheh Zadeh Hosseingholi 1
  • Mohammad Pazhang 1
  • Nader Chaparzadeh 2

1 Department of Biology, Faculty of Basic Sciences, Azarbaijan Shahid Madani University, Tabriz, Iran

2 Department of Biology, Faculty of Basic Sciences, Azarbaijan Shahid Madani University, Tabriz, Iran

چکیده [English]

L-asparaginase is an enzyme which hydrolyze the amino acid asparagine into aspartic acid and ammonia. L-asparaginase used for leukemia and lymphoma treatment is produced mainly from bacteria such as Escherichia coli and Erwinia chrysanthemi and search continues to find new sources for this enzyme. In this study, isolation of bacteria producing L-asparaginase from wastewater of potato processing was performed.The wastewater containing all the soluble compounds in potato juice, such as significant amounts of asparagine amino acids. Bacterial isolation and screening were performed on nitrogen agar and M9 media. Two isolates, called PW4 and PW5, were able to produce ammonium in the M9 medium. The results of molecular identification and biochemical tests showed that these isolates belong to the genus Escherichia and Enterococcus, respectively. Quantitative and qualitative measurements of the enzyme production of these isolates were carried out in different conditions. The highest enzyme activity of 10 IUml-1 was seen in PW4 isolate growth in the in a medium containing glutamine. The maximum amount of enzyme activity of PW5 isolate, 2.33IUml-1 was observed as a result of bacterial culture in a culture medium containing asparagine. The enzymes produced by both isolates did not show glutaminase activity. The maximum activity of the enzyme produced by PW4 isolate was evaluated at 37 ° C and enzyme activity decreased at lower and higher temperatures. These results suggest that this enzyme has a potential to be further studies for use in drug design .

کلیدواژه‌ها [English]

  • Wastewater
  • Potato
  • Asparaginase
  • Escherichia
  • Enterococcus

جداسازی و شناسایی باکتری‌هایتولیدکننده آسپاراژیناز از پساب فراوری سیب‌زمینی

ندا نقابی، الهه زاده حسینقلی* ، محمد پاژنگ و نادر چاپارزاده

ایران تبریز، دانشگاه شهید مدنی آذربایجان، دانشکده علوم پایه، گروه زیست شناسی

تاریخ دریافت: 11/6/98                تاریخ پذیرش: 24/2/99

چکیده

L-آسپاراژیناز آنزیمی است که اسید آمینه ی آسپاراژین را به آسپارتیک­اسید و آمونیاک هیدرولیز می­کند. L -آسپاراژیناز داروئی برای درمان لوکمیا و لنفوما به‌طور اساسی از باکتری‌هایی مانند  Escherichia coliوErwina chrysanthemi تولید می‌شود و جستجو برای یافتن منابع جدید برای این آنزیم ادامه دارد. در این تحقیق جداسازی باکتری­های تولید کننده آنزیم L-آسپاراژیناز از پساب حاصل از فرآوری سیب زمینی انجام شد. پساب حاصل از مرحله شستشو، حاوی تمام ترکیبات محلول در آب سیب‌زمینی نظیر مقادیر قابل توجهی از اسید آمینه ی آسپاراژین است. جداسازی و غربالگری باکتری‌ها بر روی محیط‌های نوترینت آگار و محیط M9 انجام شد. دو جدایه با نام­های PW4 وPW5 قابلیت تولید آمونیوم در محیط M9 را دارا بودند. شناسایی مولکولی و آزمایشات بیوشیمیایی نشان داد که این جدایه­ها بترتیب متعلق به جنس Escherichia وEnterococcus  هستند. سنجش کمی و کیفی میزان تولید آنزیم این جدایه­ها در شرایط مختلف انجام شد. بیشترین میزان تولید را جدایه­ی PW4 در صورت رشد در محیط حاوی گلوتامین با میزان IUml-1 10 نشان داد. بیشینه‌ی میزان تولید آنزیم توسط جدایه­ی PW5 نیز در نتیجه تغلیظ مایع رویی حاصل از کشت باکتری در محیط کشت حاوی آسپاراژین به میزان IUml-133/2 مشاهده شد. دو آنزیم بررسی شده فعالیت گلوتامینازی از خود نشان ندادند. نتایج نشان داد، بیشینه‌ی فعالیت آنزیم تولیدی توسط جدایه­ی PW4 در دمای 37 درجه سلسیوس بوده و فعالیت آنزیم در دماهای پائین­تر و بالاتر از آن کاهش می یابد. این نتایج خاطرنشان می سازد که این آنزیم قابلیت مطالعات بیشتر جهت استفاده در طراحی دارو را دارا می باشد.

واژه های کلیدی: پساب، سیب­زمینی، آسپاراژیناز، Escherichia، Enterococcus

* نویسنده مسئول، تلفن: 09144029361، پست الکترونیکی: [email protected]

مقدمه

 

L-آسپاراژیناز (L-آسپاراژین آمیدوهیدرولاز E.C.3.5.1.1) یک آنزیم امیدبخش در درمان لنفوسیتیک لوکمیای حاد، بیماری هوجکین، میلوسیتیک لوکمیای حاد، کرونیک لنفوسیتیک لوکمیا، لنفوسارکوما، رتیکولوساربوم و ملانوسارکوما است. این آنزیماسیدآمینه آسپاراژین را به اسید آسپارتیک­ و آمونیاک هیدرولیز کرده و از طریق جلوگیری از سنتز پروتئین در سلولهای سرطانی و القاء آپاپتوز باعث مرگ سلول می‌شود. در اکثر سلول‌های طبیعی انسانی، کمبود آسپاراژین می‌تواند توسط مسیرهای سنتزی دیگر که توسط آنزیم آسپاراژین­سنتتاز تسهیل می شود جبران شود، درحالی‌که سلول‌های سرطانی به خاطر کمبود فعالیت این آنزیم توانائی مذکور را ندارند (17، 8) فعالیت L-آسپاراژیناز به طور گسترده ای در گیاهان، حیوانات و میکروارگانیسم ها گزارش شده است اما تنها آسپاراژیناز تولید شده از Escherichia coliو Erwinia chrysanthemiبه‌طور عمده برای درمان لوکمیا و لنفوما کاربرد دارد و در مقیاس صنعتی تولید می شوند. اگرچه هر دو داروی تولید شده مکانیسم های عمل مشابهی دارند، اما ویژگی‍های دارویی آنها متفاوت است (13). فعالیت گلوتامینازی تولید شده توسط این آنزیم‌ها می‌تواند اثرات ثانویه همچون واکنش آلرژیک، تهوع و استفراغ، دیابت، آماس لوزالمعده و لخته ­شدن غیرنرمال داشته باشد. اکثر آسپاراژینازها پایداری و فعالیت کاتالیزوری پایینی دارند (46، 15).

از لحاظ صنعتی نیز  ازسال 2002، دانشمندان به این نتیجه رسیده‌اند که می‌توان با استفاده از این آنزیم موفق بهکاهشسطحآکریلآمیددرطی سرخ کردن غذاهای نشاسته دار در دمای بالا گردید (34). سیب‌زمینی غذای مهمی در بسیاری از کشورها محسوب می‌شود. سیب‌زمینی منبع غنی از قندها، ویتامین‌ها، پتاسیم، فیبر، آمینواسید‌ها و پروتئین‌ها می‌باشد (35). از سال 2005 صنعت سیب‌زمینی رشد سریعی را در سرتاسر دنیا داشته است. این پدیده با تولید ضایعات آلی و پساب‌های بسیار زیاد درنتیجه‌ی مراحل مختلف فراوری سیب‌زمینی از قبیل شستشو، پوست‌گیری و عملیات اضافی دیگر، همراه بوده است (44). پساب حاصل از شستشو حاوی تمام ترکیبات محلول در آب سیب‌زمینی است. آب حاصل حاوی 1 درصد مواد حل شونده است که 60 درصد این مواد ترکیبات نیتروژنی هستند. دوسوم این ترکیبات نیتروژنی را اسیدهای آمینه ویک‌سوم باقیمانده را پروتئین‌ها تشکیل می‌دهند. مطالعات کروماتوگرافیک نشان داده است که  حدود 6/23 درصد اسید های آمینه متعلق به آمینواسید آسپاراژین است و میزان این اسید آمینه بعد از گلوتامین در جایگاه دوم قرار دارد (26).

بنابراین با توجه به کاربردهای دارویی و صنعتی (صنایع غذایی) آنزیم L-آسپاراژیناز، به نظر می­رسد بررسی و کشف باکتری­های تولید کننده آنزیم L-آسپاراژینازبه ویژه آنزیم­هایی با عوارض جانبی کم­تر از منابع جدید هم به لحاظ علمی و هم به لحاظ پزشکی و صنعتی حائز اهمیت باشد. ازآنجا که احتمال جداسازی باکتری تولیدکننده‌ی یک آنزیم در محیط ‌هایی که سوبسترای آن وجود دارد بیشتراست، مطالعه حاضر احتمال حضور باکتری‌های تولیدکننده‌ی آنزیم آسپاراژیناز را در پساب حاصل از فراوری سیب‌زمینی را مورد بررسی قرار داد.

مواد و روشها

محل و روش نمونه‌برداری: نمونه‌برداری از پساب حاصل از شستشوی سیب‌زمینی بعد از کنده شدن پوست سیب‌زمینی از یک کارخانه‌ی تولید چیپس در شهرک صنعتی شبستر (ﺑﺎ ﻋﺮض ﺟﻐﺮاﻓﯿﺎﯾﯽ 38، طول جغرافیایی 45 و ارتفاع 1340 متر از سطح دریا) در ظرف‌های شیشه‌ای استریل و با رعایت شرایط استریل انجام شد و نمونه ها با حفظ دمای 4 درجه سلسیوس به آزمایشگاه منتقل شد.

جداسازی باکتری‌های موجود در پساب: درشرایط استریل به میزان یک‌دهم حجم نمونه‌ها محیط کشت
Luria Broth (LB) روی نمونه‌ها ریخته شد و در دمای 37 درجه­ سلسیوس به مدت 24 ساعت گرماگذاری شدند تا باکتری‌ها رشد کرده و میزان آن‌ها افزایش یابد. پس از تهیه سری رقت از باکتری‌ها چندین نمونه‌ی 100 میکرولیتری از لوله‌ها برداشت شد و روی محیط نوترینت آگار تلقیح شد و در دمای 37 درجه سلسیوس به مدت 24 ساعت گرماگذاری گردید. بررسی ویژگی‌های ماکروسکوپی شامل اندازهی کلنی، شکل ظاهری، رنگ، سطح، حاشیه و جنس کلنی باکتری‌های رشد کرده انجام گرفت و کلنی‌های دارای ظاهر متفاوت از طریق کشت چهار منطقه‌ای خالص‌سازی شدند.

شناسایی ویژگی های بیوشیمیایی جدایه ها: شناسایی اولیه جدایه­ها بر اساس ویژگیهای میکروسکوپی شامل شکل میکروارگانیسم (میله ای، کروی، مارپیچی)، اندازه، و وجود اسپور انجام شد  (32، 5) با آزمون های حرکت (41)، کاتالاز (37) و اکسیداز (19) نیز برخی از ویژگی‌های بیوشیمیایی اولیه‌ی این جدایه‌ها تعیین گردید.

غربالگری و نگهداری جدایه­های تولیدکننده‌ی آسپاراژیناز: برای تعیین باکتری کارآمد در تولید آنزیم‌های تخریب‌کننده آسپاراژیناز محیط کشت M9 (25) استفاده شد. محیط کشت بعد از تهیه اتوکلاو شد سپس گلوگز و اسید آمینه ی آسپاراژین در شرایط استریل به داخل محیط کشت اضافه گردید. باکتری ها به‌ صورت خطی در پلیت های حاوی محیط کشت داده شدند. پلیت­ها به مدت24 ساعت در37 درجه سلسیوس گرماگذاری شدند. کلنی­هایی که در اطرافشان هاله‌ی صورتی رنگ ایجاد شده بود انتخاب و برای بقیه مراحل از آن‌ها استفاده شد. نگهداری جدایه­های تولیدکننده‌ی آنزیم آسپاراژیناز نیز در محیط حاوی گلیسرول و در فریزر 20- درجه سلسیوس انجام شد.

شناسایی مولکولی و آنالیز فیلوژنتیکی جدایه­های منتخب: برای شناسایی مولکولی و تایید خصوصیات بیوشمیایی ابتدا استخراج DNAباکتری‌ها به روش فنل-کلروفرم انجام شد (11). تکثیرتوالی 16S rDNA باکتری‌های منتخب با استفاده از آغازگرهای عمومی رفت27F : 5'AGAGTTTGATCCTGGCTCAG3' و آغازگرهای عمومی برگشت 1492R: 5'TACGGCTACCTTGTTACGACTT3' انجام شد (23). شرایط دمایی دستگاه ترموسایکلر نیز بدین صورت بود: واسرشت ابتدایی در دمای oC95 به مدت 5 دقیقه، مرحله تکثیر شامل مرحله واسرشت 30 ثانیه در  oC94، مرحله اتصال پرایمرها 40 ثانیه در oC60، مرحله طویل شدن 40 ثانیه در oC 72 و در نهایت مرحله گسترش نهایی 10 دقیقه در oC 72 انجام گرفت. پس از انجام PCR، قطعات حاصل از تکثیر روی ژل آگارز یک درصد الکتروفورز گردید. محصولات PCRتخلیص شده جهت توالی­یابی ارسال شد. ترادف بدست آمده توسط نرم‌افزار ChromasPro بازخوانی و ویرایش شده و سپس با استفاده از نرم‌افزارBLAST در بانک ژن با دیگر توالی­های موجود در این پایگاه اطلاعاتی مقایسه شد و میزان شباهت آن با باکتری‌های مختلف ثبت‌ شده، تعیین و برای بررسی­های بعدی ذخیره گردید. تحلیل فیلوژنتیکی جدایه­ها پس از یافتن توالی­های مشابه ورسم درخت فیلوژنتیک با استفاده از نرم‌افزار  MEGA5(42) و با الگوریتم Neibour-joiningh انجام گردید. بررسی شاخه­های درخت با استفاده از الگوریتم Bootstrap با 1000 بار نمونه­گیری انجام شد (20).

سنجش کیفی میزان فعالیت آنزیم آسپاراژیناز: جدایه های انتخاب شده در محیط کشت LB به مدت 24 ساعت کشت داده شدند. 30 میکرولیتر از هر یک از سوسپانسیون‌های باکتریایی در چاهک‌های ایجادشده توسط پیپت پاستور در مرکز پلیت حاوی محیط کشت M9 ریخته شد. برای کنترل از پلیت­های محیط کشت M9بدون L-آسپاراژین و محیط کشت M9 حاوی  NaNO3(به‌ عنوان منبع نیتروژن به‌جای آسپاراژین) استفاده شد. سپس سنجش قطر هاله‌ی صورتی در اطراف کلنی و چاهک‌ها انجام گرفت (29).

سنجش کمی فعالیت آنزیم آسپاراژیناز در توده‌ی زیستی و مایع رویی حاصل از کشت جدایه­ها: ابتدا از جدایه ی تولید کننده ی آنزیم پیش­کشت تهیه شد و اجازه داده شد که باکتری به مدت 24 ساعت در دمای 37 درجه سلسیوس با سرعت 170 دور در دقیقه، در داخل انکوباتور شیکر هوادهی شده و رشد کند. بعد از گذشت 24 ساعت، 5/2 میلی‌لیتر از پیش­کشت به فلاسک­های حاوی 250 میلی­لیتر محیط کشت M9حاوی 1% آسپاراژین، گلوتامین، NaNO3 و فلاسک شاهد حاوی محیط کشت بدون هیچ منبع نیتروژنی اضافه گردید و ارلن ها مجدداً در انکوباتور شیکر به مدت2روز در دمای 37 درجه قرار گرفتند. بعد از 2 روز محتویات فلاسک، به فالکن 50 میلی­لیتری منتقل و به مدت 20 دقیقه با دور 6000 سانتریفیوژ شدند (4). پس از اتمام سانتریفیوژ، مایع رویی فالکون­ها جمع­آوری گردید. رسوبات مربوط به توده‌ی زیستی نیز جداسازی شد. بر روی رسوبات مربوط به توده‌ی زیستی 5 میلی‌لیتر بافر Tris 05/0 میلی مولار (8/7=pH) اضافه شد. سونیکاسیون 30 پالس در 6 دقیقه و در دمای 4 درجه سلسیوس اعمال شد و محصول سونیکاسیون مورد سانتریفیوژ یخچالدار با دور 13000 به مدت 20 دقیقه قرار گرفتند (12). 500 میکرولیتر از خود مایع­رویی حاصل از سانتریفیوژ اولیه باکتری‌ها و یا مایع رویی حاصل از سونیکاسیون رسوبات توده‌ی زیستی با 500 میکرولیتر بافر Tris-HCl50 میلی مولار (5/8=pH) و 500 میکرولیتر L-آسپاراژین 04/0 مولار مخلوط شد و در دمای 37 درجه سلسیوس به مدت 20 دقیقه گرماگذاری گردید. سپس 500 میکرولیتر(W/V10%)TCA  جهت توقف واکنش آنزیمی افزوده شد و به مدت 10 دقیقه با سرعت 12000 دور در دقیقه سانتریفیوژ شد. برای نمونه شاهد بدون فعالیت آنزیمی هم همین مراحل تکرار شد با این تفاوت که پس از توقف واکنش آنزیمی توسط TCA آنزیم به مخلوط بافر و سوبسترا اضافه شد. سپس سانتریفیوژ نمونه­ها  به مدت 10 دقیقه با سرعت 12000 دور در دقیقه انجام گرفت. سنجش کمی تولید آنزیم آسپاراژیناز بر پایه‌ی روش رنگ سنجی و واکنش نسلریزاسیون انجام گرفت. در طی این واکنش نرخ هیدرولیز L-آسپاراژین با اندازه‌گیری انتشارآمونیاک با استفاده از واکنش نسلر و استفاده از معرف نسلر، تعیین می‌شود. بنابراین100 میکرولیتر از نمونه با 100 میکرولیتر معرف نسلر و 8/3 میلی‌لیتر آب مقطر مخلوط شد و به مدت 20 دقیقه در 25 درجه سلسیوس گرماگذاری شد و در نهایت OD نمونه­ها در طول موج 450 نانومتر خوانده شد و بر اساس اختلاف OD های حاصل، مقدارآمونیاک آزاد شده با استفاده از منحنی استاندارد آمونیوم محاسبه شد. یک واحد فعالیت آنزیم برابر با مقدار آنزیمی است که بتواند در عرض یک دقیقه 1 میکرومول آمونیاک تولید نماید (4).

سنجش فعالیت آنزیم پس از تغلیظ آنزیم تولیدشده توسط جدایه­ها: پس ازجمع آوری مایع­رویی حاصل از رشد جدایه­ها، پروتئین‌های موجود در مایع رویی با استفاده از نمک آمونیوم سولفات80 درصد در دمای 4 درجه­ سلسیوس رسوب داده شد. محلول به مدت یک شب در یخچال نگهداری شد و در ادامه محلول رسوب داده ‌شده را به درون فالکون 50 میلی­لیتری ریخته و 20 دقیقه با دور 6000 سانتریفیوژ گردید، رسوب حاصل از آن جمع‌آوری و در بافر  Tris-HCl(Mm 50، 5/8=pH) معلق شد (3). برای حذف نمک از کیسه­های دیالیز استفاده گردید. برای تعیین غلظت میزان پروتئین‌های مایع­روئی و مایع­روئی تغلیظ شده ابتدا نمودار استاندارد جذب نوری غلظت‌های معین سرم آلبومین گاوی، با استفاده از روش برادفورد ترسیم گردید و سپس رابطه­ی خطی آن با استفاده از نرم‌افزار Excel محاسبه شد. برای سنجش غلظت پروتئین تخلیص شده با روش برادفورد، 100 میکرولیتر پروتئین تخلیص شده با 900 میکرولیتر معرف برادفورد مخلوط شده و جذب در 595 نانومتر خوانده شد (6). سپس تعیین فعالیت آنزیمی انجام شد با این تفاوت که به ‌جای استفاده از مایع رویی از مقادیر مساوی از پروتئین تغلیظ شده استفاده گردید.

سنجش کمی فعالیت Lگلوتامینازی آنزیم تولیدی توسط جدایه­ها: برای بررسی فعالیت آنزیمی L-گلوتامیناز فقط در سنجش فعالیت به‌جای سوبسترای آسپاراژین از سوبسترای گلوتامین به میزان 04/0 مولار استفاده شد و سنجش در 20 دقیقه انجام گرفت (28).

سنجش دمای بهینه ی فعالیت آنزیم: برای بررسی تاثیر دما های مختلف بر روی فعالیت آنزیم، سنجش فعالبت آنزبم بعد از گرماگذاری مخلوط سنجش در دماهای 25، 37، 40، 45، 50، 55، 60 درجه سلسیوس و به مدت 30 دقیقه انجام شد (18).

نتایج

جداسازی و غربالگری و شناسایی اولیه‌ی جدایه­ها: پس از جداسازی باکتری‌ها بر روی پلیت­های نوترینت آگار 5 کلونی انتخاب و خالص‌سازی شدندو ویژگی‌های بیوشیمیایی اولیه آن‌ها تعیین شد. سپس کشت آن‌ها بر روی محیط M9 نشان داد که 2 جدایه قابلیت تغییر رنگ پلیت­ها به رنگ صورتی را داشتند. این تغییر رنگ نشان‌دهنده شرایط قلیایی در محیط و تولید آمونیاک در اثر شکستن آسپاراژین توسط فعالیت آنزیم آسپاراژیناز است. نتایج تست‌های ظاهری، میکروسکوپی، بیوشیمیایی و ایجاد هاله در محیط M9 در جدول 1 آمده است.

 

جدول 1- ویژگی‌های ظاهری و کلنی‌های منتخب

نام انتخابی برای جدایه

ویژگی کلنی

ایجاد هاله‌ی صورتی در M9

نوع گرم

تولید اسپور

تست اکسیداز

تست کاتالاز

حرکت

شکل میکروسکوپی

PW1

سفید رنگ مواج با حاشیه‌های غیر منظم

-

-

-

_

+

+

میله‌ای کوتاه

PW2

زرد رنگ موکوئیدی گرد و محدب

_

+

+

+

+

+

میله‌ای

PW3

زرد رنگ، شفاف، کمی محدب

_

_

-

_

+

+

میله‌ای

PW4

سفید، گرد، شفاف صاف با حاشیه‌ی منظم

+

-

-

-

+

+

میله‌ای کوتاه

PW5

سفید مایل به کرم، کوچک صاف

+

+

-

-

-

_

کوکسی

 


شناسایی مولکولی جدایه­های تولیدکننده‌ی آنزیم و نتایج آزمایش‌های بیوشیمیایی تائیدی: نتایج ژل الکتروفورز محصولات حاصل از تکثیر توالی S rDNA16جدایه­ها در شکل 1 آورده شده است. مقایسه نتایج توالی یابی قطعات تکثیر یافته‌ی جدایه­های منتخب با توالی­های موجود در پایگاه اطلاعاتی NCBI مشخص گردید که جدایه یPW4، 8/99 % به باکتری E. coliو جدایه ی PW525/97% به باکتری  Enterococcus italicusشباهت دارد. درخت فیلوژنتیک رسم شده برای نشان دادن روابط جدایه ها نیز در شکل 2و 3 نشان داده‌ شده است.

 

 

 

شکل 1-باندهای (bp1500) مربوط به تکثیر توالی S rDNA 16جدایه ها. ستون1: نشانگر اندازه DNA (bp 100)

ستون2 تا 5: محصولات .PCR

 

شکل 2-درخت فیلوژنتیک جدایه­ی PW4. روابط فیلوژنتیک بر اساس روش Neighbor-joining نمایش داده شده­اند. اعداد ذکر شده در محل انشعاب نشانگر درصد نمونه­گیری Bootstrap  از 1000 نمونه است. باکتریSalmonella entericaبه عنوان outgroup قرار داده شده است.

 

شکل 3-درخت فیلوژنتیک جدایه ی PW5. روابط فیلوژنتیک بر اساس روش Neighbor-joining نمایش داده شده­اند. اعداد ذکر شده در محل انشعاب نشانگر درصد نمونه­گیری Bootstrap از 1000 نمونه است. باکتریLactococus lactis به عنوان outgroup قرار داده شده است.


سنجش فعالیت آنزیمی: سنجش کیفی تولید آنزیم از طریق سنجش قطر هاله‌ی صورتی رنگ در اطراف کلنی نشان داد که قطر هاله‌ی ایجاد شده در مورد جدایه ی PW4 15 میلی‌متر و در مورد جدایه­ی PW5 8 میلی‌متر بود. در سنجش کمی نیز مقادیر اختلاف OD در رابطه خطی حاصل از رسم منحنی استاندارد گنجانده شد و میزان آمونیوم آزادشده برحسب میکرومول محاسبه و سپس میزان واحد فعالیت آنزیم تعیین گردید. میزان اختلاف OD حاصل از سنجش فعالیت آنزیم در مایع رویی حاصل از کشت باکتری‌ها، سونیکاسیون توده‌ی زیستی و تغلیظ پروتئین در جدول 2 آمده است. فعالیت ویژه­ی آنزیم، میزان پروتئین، میزان خالص­سازی و بازده آنزیم در مورد بیشترین فعالیت آنزیم در مایع­رویی و پس از تغلیظ آن نیز در جدول 3 آورده شده است. میزان فعالیت آنزیم آسپاراژیناز در صورت استفاده از گلوتامین در کشت باکتری و سنجش فعالیت آنزیم در مایع­رویی حاصل از کشت باکتری در جدایه­ی PW4 از همه بالاتر و برابر باIU 10 است. میزان تولید آنزیم توسط PW5 در شرایط مشابه برابر با IU2 است. سنجش فعالیت گلوتامینازی آنزیم تولیدی در مورد هر دو جدایه ی ناچیز و نزدیک به صفر بود (جدول 4). میزان فعالیت آنزیم آسپاراژیناز در صورت استفاده از آسپاراژین در کشت باکتری و سنجش فعالیت آنزیم در مایع­رویی حاصل از کشت باکتری در جدایه­ی PW4 برابر با IU 66/6 است. میزان تولید آنزیم توسط PW5 در شرایط مشابه برابر با IU 33/2 بود.

 

 

جدول 2-میزان فعالیت آسپاراژینازی (IUml-1) در مایع­رویی(A) وزیست‌توده‌ی سونیکه شده (B) و مایع­رویی تغلیظ شده (C) در مورد  جدایه­های PW4 و PW5

        PW4                           PW5

جدایه

نوع محیط کشت

0                               033/0

A

محیط کشت شاهد

066/0                         033/0

0                                 0

B

C

033/0                        066/0

A

محیط کشت حاوی NaNO3

1/0                              1/0

033/0                            0

B

C

6/6                            33/2

A

محیط کشت حاوی آسپاراژین

3/0                               1/0

5                                 2

B

C

10                               2

A

محیط کشت حاوی گلوتامین

2/0                             1/0

9                              65/1

B

C

 

جدول 3- محاسبه ی میزان پروتئین، فعالیت ویژه­ی آنزیم، بازده و میزان خالص­سازی آنزیم در مورد بیشینه­ی فعالیت آنزیم در مایع­رویی و مایع­رویی تغلیظ شده در مورد جدایه­هایPW4 و PW5

نمونه

فعالیت آنزیم (IUml-1)

میزان پروتئین (mg ml-1)

فعالیت ویژه (IUmg-1)

بازده (%)

جدایه

مایع­رویی

10

33/2

233/1

43/0

11/8

41/5

100

100

PW4

PW5

مایع­رویی تغلیظ شده

9

2

706/0

28/0

85/12

14/7

90

85

PW4

PW5

 

جدول 4- میزان  فعالیت گلوتامبنازی (IUml-1) آنزیم تولیدشده توسط جدایه­ی  PW4وPW5

PW4         PW5

جدایه

نوع محیط کشت

0                 0

محیط کشت شاهد

0                0

محیط کشت حاوی NaNO3

0             066/0

محیط کشت حاوی آسپاراژین

033/0        033/0

محیط کشت حاوی گلوتامین


سنجش دمای بهینه ی فعالیت آنزیم: نتایج مربوط به سنجش میزان فعالیت آنزیم تولیدی توسط جدایه­ی PW4 در شرایط اعمال دماهای مختلف به مدت 30 دقیقه در شکل 4 دیده می‌شود. همانطور که اعداد نمودار نشان می‌دهد بهینه‌ی فعالیت آنزیم پس از اعمال  دمای 37 تا 40 درجه سلسیوس مشاهده می شود. فعالیت آنزیم در 25 درجه‌ی سلسیوس کمتر از 37 درجه‌ی سلسیوس است. در دمای 60 درجه‌ی سلسیوس فعالیت آنزیم به نصف کاهش می‌یابد.

 

شکل 4-نمودار تاثیر دما های مختلف بر روی فعالیت آنزیم حاصل از جدایه­ی PW4

بحث

اخیراً مطالعات در مورد آنزیم L–آسپاراژیناز به دلیل خاصیت ضدسرطانی آن مورد توجه بیشتری قرار گرفته است. آسپاراژیناز در بسیاری از گیاهان، پستانداران و گونه­های باکتری یافت شده است (1). در این مطالعه جهت جداسازی باکتری‌های تولیدکننده آسپاراژیناز از روش غربالگری در پلیت استفاده شد. دو جدایه باکتریایی با قابلیت تولید آنزیم ­L-آسپاراژیناز خالص­سازی گردید یکی از جدایه­ها (PW4) به‌ عنوان باکتری  E. coliشناسایی شد. این باکتری گرم منفی از رده­ی Gammaproteobacteria، راسته­ی Enterobacterials و خانواده‌ی Enterobacteriaceaeاست. حضور بسیاری از باکتری­ها در سیب‌زمینی فرآوری نشده، نیمه فراوری شده و کاملاً فرآوری شده گزارش شده است. نوع باکتری­های موجود در کارخانجات فرآوری و محصولات تحت تاثیر خاک بستر رشد سیب­زمینی، تیمارهای پرورشی کشاورزان، روش­های برداشت، نحوه­ی نگهداری و وضعیت هوای کارخانه دارد و باکتری E. coliیکی از شایعترین باکتری­های موجود در این کارخانجات است (14). محتوای میکروبی آب مورد استفاده برای شستشوی سیب­زمینی نیز یک فاکتور تاثیرگذار در محتوای میکروبی پساب کارخانجات فراوری سیب­زمینی است (21). باکتری E. coliیک باکتری همه جائی است و عضو فلور نرمال روده­ی انسان نیز است (45). با توجه به نکات ذکر شده حضور این نوع باکتری در پساب فراوری سیب زمینی کاملاً قابل قبول است. تولید آسپاراژیناز توسط این باکتری در منابع مختلفی گزارش‌شده است. اصلی­ترین باکتری تولیدکننده‌ی آنزیم آسپاراژیناز به ‌عنوان مصارف داروئی نیز این باکتری می‌باشد (7). در سال 2015 Syed Sajitha و همکارانش ژن کدکننده L-آسپاراژیناز (ansB) را از باکتری E. coliجداسازی کردند. کلون و بیان ژن کد کننده آنزیم در میزبان یوکاریوتی (مخمر) و سنجش میزان تولید آنزیم نوترکیب خارج­سلولی  میزان IU/ml5/2 را نشان داد (39). جدایه­ی دوم (PW5) به­عنوان italicus Enterococcus شناسائی شد. این باکتری‌های گرم مثبت از رده‌ی Bacilli، راسته‌ی Lactic acid bacteria و خانواده­ی Enterococaceae است (43). حضور اعضای جنس Enterococcus قبلاً در کارخانجات مختلف غذایی و سطوح گیاهان مختلف به اثبات رسیده است (38، 31، 9، 2). وجود اعضای جنس Enterococcus در خاک­ها و روده­ی انسان نیز به اثبات رسیده است (24،27).  باکتری italicus E. نیز اولین بار از پنبر جداسازی شده است (22). تولید آنزیم آسپاراژیناز توسط اعضای این جنس به سبب وجود ژن آسپاراژیناز در آنها قابل پیش­بینی است (16). هیچ گزارشی مبنی بر جداسازی این باکتری از کارخانجات مرتبط با فراوری سیب زمینی و یا سنجش میزان تولید آنزیم آسپاراژیناز توسط این باکتری وجود ندارد. سنجش مقادیر تولید آنزیم (جدول 2) در مایع­رویی و زیست توده­ی سونیکه­شده نشان می دهد که آنزیم خارج­سلولی است. سنجش مقادیر تولید آنزیم در مایع­رویی نیز نشان می­دهد که بالاترین میزان تولید آنزیم آسپاراژیناژ توسط باکتری  E. coli10 واحد و بالاترین میزان تولید آنزیم توسط E. italicus 33/2 واحد است. طبق نتایج بدست آمده به نظر می رسد استفاده از سوبسترای اولیه گلوتامین در مورد جدایه­ی PW4 اثرات تحریکی برای تولید آنزیم آسپاراژیناز دارد. پدیده­ی مشابهی در سال 2004 گزارش شده است (33). سنجش میزان فعالیت گلوتامینازی آنزیم نیز نشان (جدول 4) داد که آنزیم تولیدی هیچ یک از جدایه­ها فعالیت گلوتامینازی قابل توجهی را نشان نمی­دهند و این امر در مقاصد استفاده از آنزیم در مصارف داروی ضدسرطانی مزیت محسوب می شود؛ چرا که نشان داده شده است که نه تنها این فعالیت برای اثرات ضدسرطانی آسپاراژیناز لازم نیست، بلکه فعالیت آسپاراژینازی در کنار فعالیت گلوتامینازی کاهش نیز می­یابد و فعالیت گلوتامینازی باعث ایجاد اثرات جانبی در بیماران می‌شود (10). در سال 2017 Anjana و همکارانش به جداسازی باکتری­های تولید کننده­ی آنزیم آسپاراژیناز بدون فعالیت گلوتامینازی از ریزوسفر گیاهان مختلف و آب رودخانه‌ها پرداختند. نتایج حاکی از آن بود که تنها 4 جدایه­ی Pseudomonas otitidis، Enterobacter cloacae، Ochrobactrum anthropicوEcsherichia fergusoniفاقد فعالیت گلوتامینازی بودند (40). سنجش بهینه ی دمائی آنزیم تولیدی توسط جدایه ی PW4 (شکل 5) نیز نشان داد که بالاترین فعالیت آنزیم در 37 درجه سلسیوس بوده است. در تحقیقی که در سال 2016 توسط Zeinat K.Mohamed و همکارانش انجام شد، 150 باکتری جدا شده از رود نیل از نظر توانایی تولید آنزیم L-آسپاراژیناز مورد بررسی قرار گرفت و نتایج نشان داد که بیشترین فعالیت تولید آسپاراژیناز مربوط به باکتری E. coliو دمای بهینه برای تولید آنزیم 37 درجه سلسیوس است (30). در مطالعه­ای دیگری در همان سال Remya Radha و همکارانش بررسی‌هایی بر روی L-آسپاراژیناز نوترکیب تولید شده توسط Vibrio choleraانجام داده اند که نتایج نشان داده است که این آنزیم حداکثر فعالیت خود را در دمای بهینه 37 درجه سلسیوس نشان می­دهد (36).

1- آب خویی، لیلا ، مینایی تهرانی، داریوش، کلاهدوز محمدی، مینا، افتخار، فرشته، کرجی، نیلوفر، میر فخار، فرزانه، وزیری تبار، نازنین. (1394). خالص سازی وتعیین خصوصیات کینتیکی آنزیم آسپاراژیناز در باکتریSerratia marcescens. مجله پژوهش های سلولی و مولکولی.. 153-145: (2) 28
2- طالبی، سارا، مخدومی، علی، بحرینی، معصومه. (1398).جداسازی باکتری  Enterococcus sp. 7C 37 با توانمندی پروبیوتیکی بالا از پنیر قاینی به عنوان یک محصول تخمیری لبنی در استان خراسان جنوبی. مجله پژوهش های سلولی و مولکولی. (4)32.
 
3- Abd El Baky, H. H., El Baroty, G. S., 2016. Optimization of growth conditions for purification and production of L-asparaginase by Spirulina maxima. Evidence-Based Complementary and Alternative Medicine.
4- Badoei-Dalfard, A., 2016. L-asparaginase production in the pseudomonas pseudoalcaligenes strain JHS-71 isolated from Jooshan Hot-spring. Molecular Biology Research Communications. 5 (1), 1-10.
5- Bartholomew, J. W., Mittwer, T., 1950. A simplified bacterial spore stain. Stain technology. 25(3), 153-156.
6- Bradford, M. M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical biochemistry. 72, 248-254.
7- Brumano, L. P., Vitor Santos da Silva1, F., Costa-Silva, T. A., Apolinário, A. C., Santos J. H. M. Kleingesinds, E. K., Monteiro, G., Rangel-Yagui, C.  O., Benyahia,  B., Junior A. P., 2018. Development of L-Asparaginase biobetters: Current research status and review of the desirable quality profiles. Frontiers in bioengineering and biotechnology. 6(212).
8- Cachumba, J. J .M., Fernandes Antunes, F. A., Dias Peres, G. F., Brumano, L. P., Santos, J. C., Silva, S. S, 2016. Current applications and different approaches for microbial L-asparaginase production. brazilian journal of microbiology. 47, 77-85.
 9- Chajęcka-Wierzchowska, W., Zadernowska, A., Laniewska-Trokenheim L., 2017. Virulence factors of Enterococcus spp. presented in food. LWT- Food Science and Technology. 75, 670-676.
10- Chan, W. K., Lorenzi, P. L., Anishkin, A., Purwaha, P., Rogers, D. M., Sukharev, S., Rempe, S. B., Weinstein, J. N., 2014. The glutaminase activity of L-asparaginase is not required for anticancer activity against ASNS-negative cells. Blood. 123(23), 3596-3606.
11- Cheng, H. R., Jiang, N., 2006. Extremely rapid extraction of DNA from bacteria and yeasts. Biotechnology letters. 28(1), 55-59.
12- Deshpande, N., Choubey, P., Agashe, M., 2014. Studies on optimization of growth parameters for L-asparaginase production by Streptomyces ginsengisoli. The Scientific World Journal.
13- Dhanam, J., Kannan, S., 2013. l-Asparaginase-types, perspectives and applications. Advanced BioTech. 13(1), 1-5.
14- Doan, C. H., Davidson P. M., 2000. Microbiology of potatoes and potato products: a review. Journal of food protection. 63(5), 668-683.
15- Duval, M., Suciu, S., Ferster, A., Rialland, X., Nelken, B., Lutz, P., Benoit, Y., Robert, A., Manel, A.  M., Vilmer, E., Otten, J., Philippe, N., 2002. Comparison of Escherichia coli–asparaginase withErwinia-asparaginase in the treatment of childhood lymphoid malignancies: results of a randomized European Organisation for Research and Treatment of Cancer—Children's Leukemia Group phase 3 trial. Blood. 99(8), 2734-2739.
16- Dwivedi, V. D., Mishra, S. K., 2014. In silico analysis of L-asparaginase from different source organisms. Interdisciplinary Sciences: Computational Life Sciences. 6(2), 93-99.
17- El-Ghonemy, D. H., 2015. Microbial amidases and their industrial applications: a review. Journal of Medical Microbiology & Diagnosis. 4(1).
18- El-Naggar, N. E. A., Deraz, S. F., El-Ewasy, S. M., Suddek, G. M., 2018. Purification, characterization and immunogenicity assessment of glutaminase free L-asparaginase from Streptomyces brollosae NEAE-115. BMC Pharmacology and Toxicology. 19(1), 51-79.
19- Faller, A., Schleifer, K. H., 1981. Modified oxidase and benzidine tests for separation of staphylococci from micrococci. Journal of Clinical Microbiology. 13(6),1031-1035.
20- Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution.  39(4), 783-791.
21- Forslund, A., Ensink, J. H. J., Battilani, A., Kljujev, I., Gola, S., Raicevic, V., Jovanovic, Z., Stikic, R., Sandeie. L., Fletcherg, A., Dalsgaarda, T., 2010. Faecal contamination and hygiene aspect associated with the use of treated wastewater and canal water for irrigation of potatoes (Solanum tuberosum). Agricultural Water Management. 98(3), 440-450.
22- Fortina, M. G., Ricci, G., Mora, D., Manachini, P. L., 2004. Molecular analysis of artisanal Italian cheeses reveals Enterococcus italicus sp. nov. International Journal of Systematic and Evolutionary Microbiology. 54(5), 1717-1721.
23- Frank, J. A., Reich, C. I., Sharma, S., Weisbaum, J. S., Wilson, B. A., Olsen, G. J., 2008. Critical evaluation of two primers commonly used for amplification of bacterial 16S rRNA genes. Appl. Environ. Microbiol. 74(8), 2461-2470.
24- Fujioka, R., Sian‐Denton, C., Borja, M., Castro, J., Morphew, K., 1998. Soil: the environmental source of Escherichia coli and enterococci in Guam's streams. Journal of Applied Microbiology. 85(S1), 83S-89S.
25- Ghoshoon, M. B., Raee, M. J., 2008. An optimized medium for screening of L-asparaginase production by Escherichia coli. Am J Biochem Biotechnol. 4(4), 422-424.
26- Heisler, E., Siciliano J., Treadway, R. H., Woodward, C. F., 1959. Recovery of free amino compounds from potato starch processing water by use of ion exchange. American Journal of Potato Research. 36(1), 1-11.
27- Hui, Y. H., Chandan, R. C., 2007. Handbook of food products manufacturing: Health, meat, milk, poultry, seafood, and vegetables. John Wiley & Sons, Inc.
28- Imada, A., Igarasi, S., Nakahama, K., Isono, M., 1973. Asparaginase and glutaminase activities of micro-organisms. Microbiology. 76(1), 85-99.
29- Kaur, P., Saxena, S. G., 2014. Screening of endophytic fungi for production of Asparaginase enzyme. Dissertation.
30- Mohamed, Z. K., Elnagdy, Sh. M., Seufi, A. E., Gamal, M., 2016. Production and optimization of L-asparaginase in Escherichia coli. Egyptian Journal of Botany. 56(1), 203-224.
31- Müller, T., Ulrich, A., Ott, E. M., Müller, M., 2001. Identification of plant‐associated enterococci. Journal of Applied Microbiology. 91(2), 268-278.
32- Norris, J., Swain, H., 1971. Staining bacteria. Methods in microbiology. 5, 105-134.
33- Panosyan, E. H., Grigoryan, R. S., Avramis, I. A., Seibel, N. L., Gaynon, P. S., Siegel, S. E., Fingert, H. J, Avramis, V. I., 2004. Deamination of glutamine is a prerequisite for optimal asparagine deamination by asparaginases in vivo (CCG-1961). Anticancer research. 24(2C),1121-1126.
34- Pedreschi, F., Mariotti, M. S., Granby, K., 2014. Current issues in dietary acrylamide: formation, mitigation and risk assessment. Journal of the Science of Food and Agriculture. 94(1), 9-20.
35- Plata-Guerrero, R., Guerra-Hernandez, E., Garcia-Villanova B., 2009. Determination of reducing sugar and asparagine in potatoes. Journal of Liquid Chromatography & Related Technologies. 32(17), 2556-2568.
36- Radha, R., Arumugam, N. Gummadi, S. N., 2018. Glutaminase free L-asparaginase from Vibrio cholerae: heterologous expression, purification and biochemical characterization. International journal of biological macromolecules. 111, 129-138.
37- Reiner, K., 2010. Catalase test protocol. Wasinghton, DC: American Society for Microbiology, ASMMicrobeLibrary, http://www.microbelibrary.org.
38- Riboldi, G. P., Frazzon, J., Alves d'Azevedo, P., Guedes Frazzon, A. P., 2009. Antimicrobial resistance profile of Enterococcus spp isolated from food in Southern Brazil. Brazilian Journal of Microbiology. 40(1),125-128.
39- Sajitha, S., Karunakaran, V., Parameswaran, B., Ashok, P., 2015. Cloning and expression of l-asparaginase from E. coli in eukaryotic expression system. Biochemical engineering journal. 102, 14-17.
40- Sharma, A., Husain, I., 2017. Evaluation of antitumor activity of glutaminase-free periplasmic asparaginase from indigenous bacterial isolates as candidates for cancer therapy. Proceedings of the National Academy of Sciences, India Section B: Biological Sciences. 87(3), 997-1004.
41- Shields, P., Cathcart, L., 2011. Motility test medium protocol. Wasinghton, DC: American Society for Microbiology; http://www.microbelibrary.org.
42- Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular biology and evolution. 28(10), 2731-2739.
43- Vu, J., Carvalho, J., 2011. Enterococcus: review of its physiology, pathogenesis, diseases and the challenges it poses for clinical microbiology. Frontiers in Biology. 6(5), 357.
44- Wang, L. K., Hung, Y. T., Yapijakis, C., Lo, H. H., 2005. Waste treatment in the food processing industry. CRC Press.
45- Wanke, C.A., 2001. To know Escherichia coli is to know bacterial diarrheal disease. Clinical Infectious Diseases. 32(12), 1710-1712.
46- Zuo, S., Zhang, T., Jiang, B., Mu, W., 2015. Recent research progress on microbial L-asparaginases. Applied microbiology and biotechnology. 99(3), 1069-1079.