نوع مقاله : مقاله پژوهشی

نویسندگان

1 گروه زیست شناسی، دانشکده علوم پایه، دانشگاه آزاد اسلامی، واحد علوم و تحقیقات تهران، تهران، ایران

2 پژوهشگاه هوا فضا، وزارت علوم و تحقیقات، تهران 834-14665، ایران

3 گروه زیست شناسی، دانشکده علوم پایه، موسسه آموزش عالی غیرانتفاعی آل طه، تهران، ایران

چکیده

سرطان کولون یکی از مهمترین بدخیمی های شایع و از عوامل عمده مرگ و میر می باشد. امروزه به استفاده از عصاره های گیاهی مانند فیکوسیانین و عصاره هندوانه ابوجهل (Citrullus colocynthis) در درمان این بیماری توجه بسیاری شده است. در این مطالعه تاثیر سینرژیک عصاره C. colocynthis و ترکیب فیکوسیانین بر رشد رده سلولی سرطان کولون و بیان ژنهای caspase-8 و Bcl2 بررسی شد. پس از تیمار رده سلولی سرطان کولون انسانی (HT-29) در زمان های (24، 48 و 72 ساعت) با غلظت‌های مختلف عصاره و فیکوسیانین و همچنین تیمار همزمان این دو ماده، درصد سلولهای زنده با روش MTT محاسبه و بیان ژن های caspase-8 و Bcl2 با روش real time PCR سنجش گردید. بیشترین مهار رشد رده سلول های سرطانی پس از تیمار هر دو ماده با غلظت های بالا مشاهده گردید. تفاوت معنی داری بین زمان های مختلف تیمار تنها در غلظت های پایین (1و2 g/ml) مشاهده شد. عصاره و فیکوسیانین به ترتیب موجب کاهش27/10 و 22/5 برابری بیان ژن Bcl2 گردید. همچنین تیمار همزمان عصاره و فیکوسیانین با کاهش 31/7 برابری بیان این ژن همراه بود. عصاره C. colocynthis بیان ژن Caspase-8 را 2/3 برابر افزایش داد. عصاره و ترکیب عصاره و فیکوسیانین با افزایش قویتر بیان ژن Caspase-8 و از طرفی فیکوسیانین و ترکیب عصاره و فیکوسیانین با کاهش قویتر بیان ژن Bcl2، سبب القاء مرگ برنامه ریزی شده در رده سلولی سرطان کولون انسانی (HT-29) شدند.

کلیدواژه‌ها

عنوان مقاله [English]

The Synergic effect of Abujahl watermelon extract (Citrullus colocynthis) and Phycocyanin on apoptosis inducton in human colon cancer cell line (HT-29)

نویسندگان [English]

  • Marjan Arbabi 1
  • Halimeh Hasanpoor 2
  • Somayeh Arabzadeh 3
  • Parvaneh Maghami 1

1 Department of biology, Faculty of science, Azad university

2 Aerospace Research institute, Ministry of science research and technology, Tehran, Iran

3 Department of biology, Faculty of science, Ale Taha institute of higher education, Tehran Iran

چکیده [English]

Colorectal Cancer is one of the most common malignancies and is one of the mojor causes of mortality. Todayes, researchers pay attention to use of herbal extracts, including phycocyanin and Citrus colocynthis extract for treatment of colon cancer. In this study the synergic effect of these compoundson colon cancer cells growth and expression of caspase-8 and Bcl2 genes was assessed. After treatment of human colon cancer cells (HT-29) in differnet times (24, 48 & 72h) and with different concentrations of aqueous and phycocyanin watermelon extract and also combination of aqueous extract and phycocyanin, percentage of live cells was calculated using MTT method. Then expression of caspase-8 and Bcl2 genes were measured by real-time PCR. The highest inhibition of growth of cancer cells was observed after treatment with high concentration of both compounds. In addition, significant differences were observed between the different treatment times with low concentration (1 and 2 g/ml). The aqueous extractand phycocyanin reduced the expression of Bcl2 gene by about 10.27 and 5.22, respectively. However, the combination of extract and phycocyanin was associated with a decrease of 7.31% in expression of this gene. The extract increased the expression of Caspase-8 gene by 2.3 fold. Citrus colocynthis extract induces apoptosis by strongly increasing the expression of caspase-8 gene. Additionally, the phycocyanin and the combination of extract and phycocyanin strongly decreased the expression of Bcl2 gene. Phycocyanin and extract and Phycocyanin combination had stronger anti-cancer effects than extract alone.

کلیدواژه‌ها [English]

  • Abujahl Watermelon Extract
  • Phycocyanin
  • Colon cancer
  • Apoptosis

اثر سینرژیک عصاره گیاه هندوانه ابوجهل(Citrullus colocynthis) و فیکوسیانین بر القای مرگ برنامه ریزی شده در دودمان سلولی سرطان کولون انسانی(HT-29)

مرجان اربابی1، حلیمه حسن پور2، سمیه عرب زاده3* و پروانه مقامی1

1 ایران، تهران، دانشگاه آزاد اسلامی، واحد علوم و تحقیقات تهران، دانشکده علوم پایه، گروه زیست شناسی

2 ایران، تهران، پژوهشگاه هوا فضا، وزارت علوم و تحقیقات

3 ایران، تهران، موسسه آموزش عالی غیرانتفاعی آل طه، دانشکده علوم پایه، گروه زیست شناسی

تاریخ دریافت: 1/5/98                  تاریخ پذیرش: 29/7/98

چکیده

سرطان کولون یکی از مهمترین بدخیمی های شایع و از عوامل عمده مرگ و میر می باشد. امروزه به استفاده از عصاره های گیاهی مانند فیکوسیانین و عصاره هندوانه ابوجهل (Citrulluscolocynthis) در درمان این بیماری توجه بسیاری شده است. در این مطالعه تاثیر سینرژیک عصاره C.colocynthis و ترکیب فیکوسیانین بر رشد رده سلولی سرطان کولون و بیان ژنهای caspase-8 و Bcl2 بررسی شد.پس از تیمار رده سلولی سرطان کولون انسانی (HT-29) در زمان های (24، 48 و 72 ساعت) با غلظت‌های مختلف عصاره و فیکوسیانین و همچنین تیمار همزمان این دو ماده، درصد سلولهای زنده با روش MTT محاسبه و بیان ژن های caspase-8 و Bcl2با روش real time PCR سنجش گردید. بیشترین مهار رشد رده سلول های سرطانی پس از تیمار هر دو ماده با غلظت های بالا مشاهده گردید. تفاوت معنی داری بین زمان های مختلف تیمار تنها در غلظت های پایین (1و2 g/ml) مشاهده شد. عصاره و فیکوسیانین به ترتیب  موجب کاهش27/10 و 22/5 برابری بیان ژن Bcl2 گردید. همچنین تیمار همزمان عصاره و فیکوسیانین با کاهش 31/7 برابری بیان این ژن همراه بود. عصاره C.colocynthis بیان ژن Caspase-8 را 2/3 برابر افزایش داد. عصاره و ترکیب عصاره و فیکوسیانین با افزایش قویتر بیان ژن Caspase-8 و از طرفی فیکوسیانین و ترکیب عصاره و فیکوسیانین با کاهش قویتر بیان ژن Bcl2، سبب القاء مرگ برنامه ریزی شده در رده سلولی سرطان کولون انسانی (HT-29) شدند.

واژه های کلیدی: عصاره هندوانه ابوجهل، فیکوسیانین، سرطان کولون، مرگ برنامه ریزی شده

* نویسنده مسئول، تلفن: 44320647-021،  پست الکترونیکی: [email protected]

مقدمه

 

سرطان کولون یا کولورکتال به بدخیمی های سلولهای مربوط به دیواره روده بزرگ الحاق می گردد که بصورت کنترل نشده رشد و تکثیر می یابندکه بسته به شدت آن به 4 مرحله درجه بندی می‌شود. در نوع 1 سرطان در دیواره داخلی روده بزرگ یا رکتوم رشد کرده ولی انتشار آن فراتر از دیواره روده بزرگ نشده است. در درجه 2، سرطان در دیواره روده یا رکتوم رشد کرده اما به غدد لنفاوی مجاور نرسیده است(8). در درجه 3 سرطان بر روی غدد لنفاوی تاثیر گذاشته ولی هنوز به سایر بخش‌های بدن متاستاز نداده است، اما در درجه 4 سلول‌های سرطانی به بخش‌های مختلفی از بدن نظیر ریه، کلیه، و کبد متاستاز می دهند(6). تغییر در عملکرد سرطان کولورکتال نیز بسیار متغیر بوده و به محل تومور و درجه یا مرحله بیماری بستگی دارد. درمان‌های رایج سرطان کولورکتال شامل درمان‌های موضعی، درمان‌های سیستمیک، جراحی، لاپاراسکوپی، شیمی‌درمانی، درمان بیولوژیک، یا پرتودرمانی می‌باشد. اگرچه این روش‌ها کمک زیادی در جلوگیری از پیشرفت بیماری دارند، اما بیشتر آنها همراه با عوارض جانبی بوده و علاوه بر هزینه بالا، ممکن است نتیجه ای نیز حاصل نگردد. بهمین منظور پیدا کردن یک روش مناسب‌تر و کم هزینه‌تر و بدون عارضه در جهت درمان این بیماری بسیار حائز اهمیت می‌باشد( 11).

هندوانه ابوجهل با نام علمی Citrullus colocynthis یک گیاه دارویی متعلق به خانواده کدوها می‌باشد. در طب سنتی استفاده از این گیاه در موارد ضعف اعمال روده، فلج ناحیه امعاء و احشاء، آب آوردن انساج و بیماریهای کبدی پیشنهاد شده است(17). نتایج تحقیقات اخیر حاکی از آن است که عصاره تام گیاه هندوانه ابوجهل ممکن است برای مهار رشد و از بین بردن برخی از سلول‌های سرطانی مؤثر باشد(5). مصرف گیاه هندوانه ابوجهل همراه با اشعه رادیو اکتیو دارای اثرات متوقف کنندگی در رشد تومورهای سرطانی می‌باشد(1، 3، 6). برخی از مطالعات نیز خواص آنتی اکسیدانی و ضدالتهابی بالای عصاره هندوانه ابوجهل را نشان دادند(9، 17، 18). [21] بنابراین با توجه به بومی بودن این گیاه در ایران و همچنین خواص درمانی بسیار بالای آن در انواعی از بیماری‌ها و همچنین برخی از انواع سلول‌های سرطانی، بنظر می رسد که عصاره این گیاه خواص ضدسرطانی خوبی علیه سلولهای سرطانی کولورکتال داشته باشد(2).

فیکوسیانین (phycocyanin) نوعی رنگدانه طبیعی باخواص فلورسنت وآنتی اکسیدانی می‌باشد که از جلبک‌های سبز آبی، ‌بویژه اسپیرولینا، بدست می‌آید. اخیرا مطالعات متعددی خواص درمانی فیکوسیانین را مورد بررسی قرار دادند. تحقیقات اخیر نشان دادند که فیکوسیانین نه تنها دارای خواص آنتی اکسیدانی و ضدالتهابی بالایی می‌باشد، بلکه دارای خواص ضدسرطانی بالایی بوده و منجر به توقف چرخه سلولی در فاز G0/G1 می‌گردد (6). نشان داده شده که فیکوسیانین با القاء آپوپتوز منجر به مهار رشد، تکثیر و متاستاز سلول‌های سرطانی می‌گردد. احتمالا فیکوسیانین از طریق چندین مکانیسم از جمله فعال شدن Caspase-8, Caspase-3 و غیرفعال کردن Bcl2 منجر به فعال شدن مرگ برنامه ریزی شده سلولی می‌گردد. بنظر می‌رسد که فیکوسیانین با القاء مسیر داخلی مرگ برنامه ریزی شده از طریق رهاسازی سیتوکروم c و همچنین فعالسازی Caspase-3,8,9  نقش موثری در القاء مرگ سلول های سرطانی داشته باشد(7). هدف از این مطالعه بررسی اثرسینرژیک عصاره گیاه هندوانه ابوجهل (C. Colocynthis) و فیکوسیانین بر مهار رشد سلولی و القای مرگ برنامه ریزی شده سلولی با بررسی بیان ژنهای Bcl2 وCaspase-8 در دودمان سلولی سرطان کولون انسانی (HT-29) می باشد.

مواد و روشها

عصاره گیاهی: در این مطالعه از عصاره آبی گیاه هندوانه ابوجهل استفاده شد. ابتدا عصاره‌گیری گیاه با متانول انجام شد. 5 گرم پودر خشک گیاه در 200 میلی لیتر متانول 80 درصد برای 48 ساعت قرار گرفت و سپس محلول رویی با روش پرکولاسیون جدا شد. متانول عصاره تبخیر شد و عصاره خشک بدست آمد. سپس غلظت های 50، 100، 250، 500، 1500، 2000 و 2500 میکروگرم/میلی لیتر از عصاره هندوانه ابوجهل در آب دیونیزه شده و همچنین غلظت‌های 5، 10، 25، 50، 100، 150، 200 و 250 میکروگرم/میلی لیتر از محلول فیکوسیانین(شرکت باریج اسانس کاشان)تهیه گردید. بر اساس درصد مرگ سلولی مشاهده شده غلظت 100 میکروگرم/میلی لیتر از هر دو تیمار به عنوان غلظت مناسب برای ادامه کار و تعیین غلظت های بعدی انتخاب شد. در نهایت سلولها با مقادیر 1، 2، 5، 10، 20، 50 و 100 میکروگرم/میلی لیتر از عصاره، فیکوسیانین و همچنین ترکیب عصاره و فیکوسیانین بصورت همزمان تیمار شدند.

تیمار سلول های HT-29 با عصاره و فیکوسیانین: در این تحقیق از دودمان سلولی سرطان کولون (رده HT-29) استفاده گردید (انیستیتو پاستور ایران). سلول‌ها در محیط DMEM و در شرایط استاندارد بمدت 24 ساعت کشت داده شدند. پس از اینکه تراکم سلول‌های سرطانی به بیش از 80% رسید، غلظت های مختلف عصاره و فیکوسیانین به سلول ها اضافه گردید. پس از گذشت  24، 48 و 72 ساعت، مرگ سلولی به روش MTT بررسی گردید تا ایده آل ترین غلظت از لحاظ تاثیرگذاری جهت مطالعه بعدی بر روی بیان ژن‌ها مورد بررسی قرار گیرد. پس از بدست آوردن IC50 غلظت‌های عصاره گیاهی، فیکوسیانین و ترکیب عصاره و فیکوسیانین با استفاده از نرم افزار Excel، سلول‌های سرطانی با غلظت های مورد نظر تیمارشده و بیان ژن‌های Bcl2 و Caspaase-8نیز مورد بررسی قرار گرفت.

اندازه گیری بقای سلولی با استفاده از روش MTT: تخمین درصد حیات سلولی با استفاده از پروتکل استاندارد روش MTT [3- (4 ,5-dimethylthiazol-2-yl) -2, 5- diphynyltetrazolium bromide] مورد بررسی قرار گرفت. در نهایت پلیت ها در طول موج 570 نانومتر توسط دستگاه اسپکترومتر خوانده شد. میانگین درصد زنده مانی سلول‌ها بمنظور بررسی اثر عصاره و ترکیب فیکوسیانین بر روی سلول‌ها مقایسه شد و درصد مرگ سلول‌ها در برابر غلظت عصاره رسم شد. درصد مرگ سلولی به شرح زیر محاسبه شد:

 

% Cytotoxicity=1-[(OD extract treated-OD blank)/(OD control-OD blank)]´100


روش Real time PCR : میزان RNA کل از سلول ها با استفاده از محلول RNX-plus (SinaClon; RN7713C) استخراج شد. سپس مقدار 1g از RNA با استفاده از پروتکل استاندارد (شرکت فرمنتاز) به cDNA تبدیل شد. در نهایت با استفاده از کیت  1x SYBR Premix Ex Taq II (Tli RNaseH Plus; Takara)  توسط دستگاه (Rotor Gene 6000 Corbett Research, Australia) به تعداد 40 سیکل و با استفاده از پرایمرهای جدول شماره 1 بیان کمی ژن ها بررسی گردید.

 میزان سطح mRNAs هر یک از ژن ها به طور نسبی در مقایسه با میزان سطح mRNAs ژن GAPDH محاسبه گردید. به این صورت که میزان (Delta Ct =ΔCT) با استفاده از فرمول [ΔCT = CT (target) – CT(control)] محاسبه شد و بیان ژن با فرمول-ΔCt2مورد ارزیابی قرار گرفت.

 

جدول 1-  مشخصات توالی پرایمرهای مربوط به هر یک از ژن‌ها

Gene

Forward

Reverse

Bcl2    

TTGGCCCCCGTTGCTT

CGGTTATCGTACCCCGTTCTC

GAPDH

GAAGGTGAAGGTCGGAGTC

GAAGATGGTGATGGGATTTC

Caspase-8

GGGCTTTGACCACGACCTTTG

CCTCCTGTCCATCAGTGCCATAG

 


آنالیزهای آماری: توصیف کمی داده‌ها با استفاده از شاخص‌های پراکندگی مرکزی از قبیل میانگین و انحراف استاندارد انجام شد و جهت تعیین نرمال بودن توزیع داده ها از آزمون شاپیروویلک و بررسی تجانس واریانس‌ها از آزمون لوین استفاده شد. هم چنین برای بررسی تغییرات معنی داری هریک از متغیرهای تحقیق، بین گروه‌های مختلف، از روش آنالیز واریانس یک طرفه و در صورت مشاهده تفاوت معنی دار آماری از آزمون تعقیبی توکی در آزمون ANOVA جهت تعیین محل اختلاف بین گروهی استفاده شد. سطح معنی داری برای تمام محاسبات 05.0>p در نظر گرفته شد. کلیه عملیات آماری با استفاده از نرم افزار SPSS نسخه 20 انجام شد.

نتایج

مهار رشد سلول‌های سرطانی توسط تیمار با عصاره هندوانه ابوجهل و فیکوسیانین پس از24، 48 و 72 ساعت: پس از گذشت 24 ، 48 و 72 ساعت تفاوت معنی داری در میانگین درصد سلول های مرده در غلطت ‌های 1 تا 30 میکروگرم/میلی لیتر از عصاره، فیکوسیانین، ترکیب عصاره و فیکوسیانین مشاهده گردید(p<0.05). همچنین در میانگین IC50 هر سه تیمار نیز تفاوت معنی داری مشاهده شد(p<0.05). میزان IC50 بدست آمده برای فیکوسیانین و ترکیب عصاره و فیکوسیانین آشکار کرد که فیکوسیانین و ترکیب عصاره و فیکوسیانین در مقایسه با عصاره هندوانه ابوجهل از قدرت سلول کشی بالاتری برخوردار بودند (جدول شماره 1، 2، 3).

با گذشت 24 ، 48 و 72 ساعت از تیمار سلول های سرطانی با غلظت‌های مختلف عصاره، فیکوسیانین و ترکیب عصاره و فیکوسیانین، میزان مهار رشد رده سلول‌های سرطانی با افزایش غلظت تیمارها افزایش یافت، به طوری که کمترین اثر گذاری در غلظت 1 میکروگرم/میلی لیتر و بیش ترین اثر گذاری نیز در غلظت 50 میکروگرم/میکرولیتر مشاهده گردید. در غلظت‌های 1 تا 30 میکروگرم/میکرولیتر فیکوسیانین و ترکیب عصاره و فیکوسیانین اثرات مهارکنندگی قویتری علیه رشد رده سلول‌های سرطانی در مقایسه با عصاره هندوانه ابوجهل از خود نشان دادند (p<0.05)، این در حالی است که تفاوت معنی داری در میانگین سلول‌های مرده در غلظت های 40 و 50 میکروگرم/میلی لیتر بین سه گروه مشاهده نگردید (جدول شماره 1، 2 ، 3).

 

 

جدول 1- مهار رشد سلول های سرطانی توسط تیمار غلظت‌های مختلف عصاره، فیکوسیانین، عصاره + فیکوسیانین پس از 24 ساعت

مقدار p

Citro + Phyco (%)

Phyco (%)

Citro (%)

غلظت (g/ml)

0.031

11.48±2.50b

14.24±2.10b

5.21±1.10a

1

0.042

20.09±3.60b

19.13±2.81b

10.84±2.31a

2

0.028

41.87±3.41b

48.67±3.52b

25.50±4.52a

5

0.027

64.08±4.72b

61.85±3.71b

42.93±5.91a

10

0.018

82.25±6.20b

75.88±4.53b

56.32±5.21a

20

0.021

90.12±7.31b

91.39±4.21b

60.47±4.81a

30

0.73

96.17±6.52a

96.92±3.81b

88.42±3.42a

40

0.68

97.66±6.22a

98.72±4.61a

95.86±4.83a

50

<0.01

5.1±0.32b

4.98±0.48b

14.2±1.12a

IC50

 

جدول 2- مهار رشد سلول های سرطانی توسط تیمار غلظت‌های مختلف عصاره، فیکوسیانین، عصاره + فیکوسیانین پس از 48ساعت

مقدار p

Citro + Phyco (%)

Phyco (%)

Citro (%)

غلظت (g/ml)

0.044

3.52±1.01a

8.56±1.12b

2.01±0.85a

1

0.046

17.12±3.52b

19.84±2.53ab

25.08±3.31a

2

0.031

36.86±4.22ab

55.19±3.61b

27.59±3.11a

5

0.017

55.89±5.12b

61.63±4.70b

32.02±4.22a

10

0.012

82.68±4.86b

73.92±4.52b

53.78±4.63a

20

0.014

94.66±5.52b

96.68±5.01b

66.67±5.51a

30

0.57

97.78±5.09a

95.07±5.71a

92.55±4.83a

40

0.42

99.30±6.10a

98.49±4.85a

96.07±3.85a

50

<0.01

6.02±0.85b

4.72±0.34b

17.4±0.5a

IC50

جدول3- مهار رشد سلول های سرطانی توسط تیمار غلظت‌های مختلف عصاره، فیکوسیانین، عصاره + فیکوسیانین پس از 72ساعت

مقدار p

Citro + Phyco (%)

Phyco (%)

Citro (%)

غلظت (g/ml)

0.014

2.20±0.21c

9.44±2.21b

24.20±2.20a

1

0.045

13.93±2.11b

26.40±2.56a

22.18±1.80a

2

0.036

48.49±4.11b

49.40±4.11b

30.61±3.10a

5

0.012

60.49±4.74b

60.59±3.72b

36.94±2.91a

10

0.017

86.53±5.23b

77.18±5.10b

51.24±2.53a

20

0.023

96.70±6.24b

91.57±4.82b

73.79±3.74a

30

0.48

97.43±5.75a

94.87±4.54a

97.16±4.22a

40

0.58

98.81±6.52a

98.53±5.51a

97.43±4.37a

50

<0.01

5.03±0.37b

5.01±0.41b

19.75±0.84a

IC50

 


اثرات غلظت های متفاوتعصاره هندوانه ابوجهل و فیکوسیانینبرالقای مرگ سلولی: در هر سه بازه‌ی زمانی با افزایش غلظت عصاره، فیکوسیانین و ترکیب هر دو، اثر مهارکنندگی آن ها بر رشد سلول‌های سرطانی به طور معنی داری افزایش یافته است (p<0.05). بطوری که در غلظت های 1 و 2 میکروگرم/میلی لیتر از عصاره و فیکوسیانین تفاوت معنی داری بین زمان های 24، 48 و 72 ساعت مشاهده شد (P<0.05). درحالیکه با افزایش غلظت این تفاوت معنی داری بین مدت زمان تیمارها مشاهده نگردید. بدین معنی که افزایش غلظت اثرات زمان را کاهش داده و القای مرگ سلولی در مدت زمان کمتر با غلظت بالاتر امکان پذیر است (نمودار 1 و 2). تیمار سلول ها با ترکیب عصاره و فیکوسیانین با غلظت های 1، 2 و 5 میکروگرم/میلی لیتر تفاوت معنی داری بین زمان های تیمار مشاهده گردید (P<0.05) (نمودار 3).

کاهش بیان ژن Bcl2 تحت تاثیرعصاره و فیکوسیانین: نتایج حاصل از آنالیز بیان ژن در گروه تیمار نسبت به گروه کنترل نشان داد که عصاره هندوانه ابوجهل و فیکوسیانین بترتیب سبب کاهش معنی دار 27/10 برابری و 22/5 برابری در بیان ژنBcl2 رده سلول‌های سرطانی گردید(p<0.001). همچنین ترکیب عصاره و فیکوسیانین نیز به طور معنی داری موجب کاهش 31/7 برابری بیان این ژن در این سلول ها شد (p<0.001) (نمودار 4).

 

 

نمودار 1- مقایسه غلظت‌های مختلف عصاره بر مهار رشد سلول‌های سرطانی پس از 24، 48 و 72 ساعت

*: معنی داری بین سه زمان 24، 48 و 72 ساعت

 

نمودار 2- مقایسه غلظت‌های مختلف فیکوسیانین بر مهار رشد سلول‌های سرطانی پس از 24، 48 و 72 ساعت

*: معنی داری بین سه زمان 24، 48 و 72 ساعت

 

نمودار3- مقایسه غلظت‎های مختلف ترکیب عصاره + فیکوسیانین بر مهار رشد سلول‌های سرطانی پس از 24، 48 و 72 ساعت

*: معنی داری بین سه زمان 24، 48 و 72 ساعت


 

نمودار4- مقایسه اثر عصاره سیترولوس (Citro)، فیکوسیانین (Phyco) و ترکیب عصاره + فیکوسیانین (Citro+Phyco) بر بیان ژن Bcl2

*: معنی داری نسبت به گروه کنترل

افزایش بیان ژنCaspase-8تحت تاثیر عصاره و فیکوسیانین: نتایج حاصل از آنالیز بیان ژن نشان داد که عصاره هندوانه ابوجهل به تنهایی سبب افزایش معنی دار 2/3 برابری در بیان ژن Caspase-8 در رده سلول‌های سرطانی گروه تیمارنسبت به گروه کنترل شد (P<0.001). در حالی که فیکوسیانین سبب افزایش 06/1 برابر ژن Caspase-8 در رده سلول‌های سرطانی گردید، اما این تفاوت از لحاظ آماری معنی دار نبود. در این سلول ها ترکیب عصاره و فیکوسیانین نیز بیان این ژن را 29/3 برابر افزایش داد (P<0.001) (نمودار 5).

 

نمودار5. مقایسه اثر عصاره سیترولوس (Citro)، فیکوسیانین (Phyco) و ترکیب عصاره + فیکوسیانین (Citro+Phyco) بر بیان ژن Caspase-8

*: معنی داری نسبت به گروه کنترل

بحث

امروزه رویکردهای جدید در درمان سرطان استفاده از عصاره ها و ترکیبات گیاهی می باشد که عوارض جانبی کمتر و قابل دسترس تر می باشند. تاکنون تحقیقات زیادی به اثرات ضد سرطانی عصاره های گیاهی در سلول های مختلف اشاره کرده اند که هر یک از طریق مسیرهای مولکولی متفاوتی موجب مهار رشد، پیشرفت و متاستاز سلول های سرطانی می گردند (19، 4، 22). محققین نشان دادند که تیمار سلول‌های سرطان رحم با ترکیب فیکوسیانین منجر به کاهش چشمگیری در تعداد سلول‌های زنده سرطانی می‌شود(12). همچنین فیکوسیانین سبب القاء بیان پروتئین Fas و ICAM-1 و کاهش بیان Bcl2 می‌گردد(12). تاکنون مطالعات حاکی از نقش ضد سرطانی فیکوسیانین در بسیاری از سرطان ها از جمله سرطان ریه، پانکراس و کولون می باشد (8، 12، 26). در مطالعه ای در سال 2018 نشان داده شد که اثر ضد سرطانی فیکوسیانین از طریق مسیر MAPK القا می شود (10). نتایج تحقیق ما مشخص کرد که فیکوسیانین از طریق القاء بیان ژن Caspase-8 و کاهش بیان ژن Bcl2 سبب کاهش درصد سلول‌های زنده رده سلولی سرطان کولون می گردد. این نتایج دال بر نقش فیکوسیانین در القاء فرآیند مرگ برنامه ریزی شده سلول می‌باشد. فیکوسیانین اثرات ضدسرطانی خود را از طریق القای مرگ برنامه ریزی شده سلولی، مرگ سلول های اتوفاژیک بر سلول های سرطانی پانکراس اعمال می‌کند (12). فیکوسیانین همچنین منجر به توقف چرخه‌ی سلولی در مرحله‌ی G2/M، مرگ برنامه ریزی شده سلولی و مرگ سلول اتوفاژیک در سلول های PANC-1 می‌شود. بدین ترتیب فیکوسیانین به عنوان یک عامل بالقوه‌ی ضد سرطان مطرح گردید(12، 22). نتایج حاصل از یک مطالعه‌ نشان داد که فیکوسیانین می‌تواند بطور چشم گیری منجر به القاء مرگ برنامه ریزی شده سلولی، توقف چرخه سلولی، سرکوب مهاجرت سلولی، ممانعت از تکثیر و توانایی تشکیل کلونی سلول های NSCLC از طریق تنظیم چندین ژن کلیدی شود(7). نتایج حاصل از مطالعه ما نیز در راستای مطالعات قبلی بوده و توانایی فیکوسیانین را در القای مرگ رده سلول‌های سرطان کولون گزارش کرد.

اخیراً محققین نشان دادند که فیکوسیانین سبب القاء فعالسازی ژنهای پیش آپپتوزی و کاهش بیان ژنهای ضد آپپتوزی و نهایتا تسریع انتقال پیام مرگ سلولی در سلول‌های سرطانی Hela می‌گردد. تجویز فیکوسیانین منجر به فعالسازی انواعی از Caspase ها از جمله Caspase-2,3,6,8,9,10در سلول‌های سرطانی می‌گردد که نشان دهنده القاء فرآیند مرگ برنامه ریزی شده سلولی وابسته به Caspaseدر سلول‌های سرطانی می‌باشد. همچنین تیمار سلول‌های سرطانی Hela با فیکوسیانین سبب القاء آزاد سازی سیتوکروم C از بخش غشاء داخلی میتوکندری به داخل سیتوزول و القاء مرگ برنامه ریزی شده سلولی می شود(13، 19، 22، 23-27).

در این پژوهش از حلال قطبی متانول برای عصاره گیری گیاه هندوانه ابوجهل استفاده شد. مطالعات، استفاده از حلال‌های مختلف را برای عصاره‌گیری گیاه هندوانه ابوجهل نشان داداند که از جمله آن استفاده از حلال کلروفروم برای استخراج  عصاره از برگ های گیاه سیترولوس کولوسینتیس بود که سطح بالایی از ممانعت از رشد سلول های سرطانی را بدون آسیب به DNA نشان داد (14). همچنین استفاده از حلال‌های اتیل استات، استون و متانول، بیشترین تاثیر را در کاهش رادیکال DPPH آزاد پایدار نشان داد (14). این تحقیقات بیانگر اثرات آنتی اکسیدانی عصاره برگ این گیاه و نهایتا کاهش احتمال ایجاد سرطان می باشند.

با بررسی اثر عصاره هندوانه ابوجهل نتایج مشابهی بر سلول های MCF-7 و HepG-2 نیز گزارش شده است. در این مطالعه نشان داده شد که عصاره هندوانه ابوجهل سبب کاهش معنی دار تعداد سلول‌های سرطانی  MCF-7و HepG-2 در یک مسیر وابسته به غلظت می‌گردد. این اثرات حتی پس از 24 تا 72 ساعت پس از تیمار نیز مشهود بود. بنابراین محققین استفاده از این عصاره را به عنوان جایگزینی برای درمان سرطان پیشنهاد کردند(15).

در مطالعه‌ی پیشرو عصاره هندوانه ابوجهل به واسطه‌ی کاهش بیان ژن Bcl2 و از طرفی افزایش بیان Caspase-8  منجر به القاء مرگ برنامه ریزی شده رده سلولهای سرطانی کولون شد. کاهش درصد سلول های سرطانی زنده در سلول های تیمار شده با عصاره این میوه در مقایسه با گروه کنترل نیز مشاهده گردید. علاوه بر این نتایج Real-time PCR نیز نشان داد که بیان ژن Caspase-8  در 48 و 72 ساعت پس از تیمار با عصاره به طور قابل توجهی افزایش یافته است. اثرات مشابهی از عصاره‌ی میوه Citrullus Colocynthis بر سلول های سرطان پستان MCF-7 در نتیجه افزایش بیان ژن Caspasae-3 نیز گزارش شده است(5).

در مطالعه ای اثر ضد تکثیری عصاره‌ی هیدروالکی Citrullus Colocynthis بر سلول های MCF-7 و AGS گزارش شد. تجزیه و تحلیل داده‌ها نشان داد که بعد از 24، 48 و 72 ساعت تفاوت معنی داری در میزان زنده مانی سلول های سرطانی وجود دارد. آن ها گزارش کردند که احتمالا اثر سیتوتکسیک اعمال شده ناشی از عصاره به واسطه ی القای مرگ برنامه ریزی شده سلولی بوده است. در نهایت تحقیقات بیشتری در زمینه تاثیر عصاره Citrullus Colocynthis، بعنوان یک عامل بالقوه‌ی شیمی درمانی علیه سلول های MCF-7 و AGS بر سلول های سرطانی مورد نیاز است(21).

با توجه به نقش اساسی پروتئین Bcl2 در مهار مرگ برنامه ریزی شده سلولی و نقش Caspase-8 در القاء مرگ برنامه ریزی شده سلولی و نتایج بدست آمده از تحقیق کنونی و تحقیقات قبلی می‌توان اظهار داشت که ترکیب فیکوسیانین و همچنین عصاره هندوانه ابوجهل دارای خواص بالایی در مهار تکثیر رده سلول‌های سرطان کولون داشته و این اثرات احتمالا از طریق فعالسازی انواعی از Caspase ها ،کاهش بیان Bcl2، آزاد سازی سیتوکروم C از غشاء میتوکندری و نهایتا القاء مرگ برنامه ریزی شده سلولی صورت می‌پذیرد. اما اثبات این موضوع نیازمند مطالعات بیشتر در سطح پروتئین است.

1-    Arnold, M., Sierra, M.S., Laversanne, M.,  Soerjomataram, I., Jemal, A., Bray, F. 2017. Global patterns and trends in colorectal cancer incidence and mortality. Gut, 66(4), 683-691.
2-    Barghamdi, B., Ghorat, F., Asadollahi, K., Sayehmiri, K., Peyghambari, R., Abangah, G.   2016. Therapeutic effects of Citrullus colocynthis fruit in patients with type II diabetes: A  clinical trial study. Journal of pharmacy & bioallied sciences, 8(2),130.
3-    Basha, O.M., Hafez, R.A., El-Ayouty, Y.M., Mahrous, K.F., Bareedy, M.H., Salama, A.M. 2008. C-Phycocyanin inhibits cell proliferation and may induce apoptosis in human HepG2 cells. Egypt J Immunol, 15(2), 161-167
4-    Choori, M., Boozarpour, S.,moradi, A., Jorjani, E. 2018. Investigation of POU5F1 and NANOG gene expression in colon cancer cell line (Caco-2) treated by dendrosomal nano-curcumin. J cell Mol Med. 31(3), 394-406.
5-    Davoodi, R., Najafi, S., Mazaheri, M. 2015. Effect of Hydro Alcoholic Extract of Citrullus Colocynthis fruit on Caspase 3 gene expression in MCF-7 breast cancer cell line. SSU_Journals, 23(5), 508-518.
6-    Fleming, M., Ravula, S., Tatishchev, S.F., Wang, H.L. 2012. Colorectal carcinoma: pathologic aspects. Journal of gastrointestinal oncology, 3(3), 153.
7-    Hao, S., Yan, Y., Li, S., Zhao, L., Zhang, C., Liu, L., Wang, C. 2018. The in vitro anti-tumor activity of phycocyanin against non-small cell lung cancer cells. Marine drugs, 16(6), 178.
8-     Jemal, A., Siegel, R.,  Ward, E., Hao, Y., Xu, J., Thun, M.J.  2009. Cancer statistics. CA: a cancer journal for clinicians, 59(4), 225-249.
9-    Jemal, A., Center, M.M., DeSantis, C., Ward, E.M. 2010. Global patterns of cancer incidence and mortality rates and trends. Cancer Epidemiology and Prevention Biomarkers, 19(8), 1893-1907.
10- Jiang, L., Wang, Y.,  Liu, G.,  Liu, H., Zhu, F.,  Ji, H., Li, B. 2018. C-Phycocyanin exerts anti-cancer effects via the MAPK signaling pathway in MDA-MB-231 cells. Cancer Cell Int. 18: 12.
11- Kuipers, E.J.,  Grady, W.M., Lieberman, D., Seufferlein, T., Sung, J.J., Boelens, P.G., van  de Velde, C.J., Watanabe, T. 2015. Colorectal cancer, Nature reviews. Disease primers, 1, 15065.
12- Liao, G., Gao, B., Gao, Y., Yang, X., Cheng, X., Ou, Y. 2016. Phycocyanin inhibits tumorigenic potential of pancreatic cancer cells: role of apoptosis and autophagy. Scientific reports, 6, 34564.
13- Li, B., Gao, M.H., Zhang, X.C., Chu, X.M. 2006. Molecular immune mechanism of C‐phycocyanin from Spirulina platensis induces apoptosis in HeLa cells in vitro. Biotechnology and applied biochemistry, 43(3), 155-164.
14- Marzouk, B., Mussi, F., Jamali, C., Galati, S., Bekkouche, K., Aouni, M., Arru, L., Marzouk, Z., Buschini, A. 2016. Inhibitory activity of leaves extracts of citrullus colocynthis schrad on HT29 human colon cancer cells. European Journal of Medicinal Plants, 12(3), 1-10.
15- Mukherjee, A., Patil, SD. 2012. Effects of alkaloid rich extract of Citrullus colocynthis fruit on Artemia salina and human cancerous (MCF-7 and HEPG-2) cells. J. Pharma Sci Tech, 1, 15-19.
16- Najafi, Sh., Mir, N., shafaghat, M. 2016. Antioxidant and Antibacterial Activities of Six Medicinally Important Species of the Genus Salvia from North East of Iran. J Genet Resour. 2(1), 41-47.
17- Ou, Y., Lin, L., Yang, X., Pan, Q., Cheng, X. 2013. Antidiabetic potential of phycocyanin: Effects on KKAy mice. Pharmaceutical biology, 51(5), 539-544.
18- Rahimi, R., Amin, G., Ardekani, M.R.S. 2012. A review on Citrullus colocynthis Schrad.: from traditional Iranian medicine to modern phytotherapy. The journal of alternative and complementary medicine, 18(6), 551-554.
19- Ranji, Najmeh. 2014. Investigation of Survivin and hTERT gene expression in gastric adenocarcinoma cell line (AGS) treated by nano Curcumin. J cell Mol Med. 27(2), 233-241.
20- Ravi, M., Tentu, S., Baskar, G., Prasad, S.R., Raghavan, S., Jayaprakash, P., Jeyakanthan, J., Rayala, S.K.,Venkatraman, G. 2015. Molecular mechanism of anti-cancer activity of phycocyanin in triple-negative breast cancer cells. BMC cancer, 15(1), 768.
21- Rezai, M. Davoodi, A., Asori, M., Azadbakht. M. 2018. Cytotoxic Activity of Citrullus colocynthis (L.) Schrad Fruit Extract on Gastric Adenocarcinoma and Breast Cancer Cell Lines. International Journal of Pharmaceutical Sciences Review and Research, 45(1), 175-178.
22- Subhashini, J., Mahipal, S., Reddy, M., Reddy, M., Rachamallu, A., Reddanna, P. 2004. Molecular mechanisms in C-Phycocyanin induced apoptosis in human chronic myeloid leukemia cell line-K562. Biochemical pharmacology, 68(3), 453-462.
23- Tafrihi, M., Nakhaei Sistani, R. 2017. E-cadherin/β-catenin Complex; A Target for Anti-cancer and Anti-metastasis Plants/Plant-derived Compounds. Nutrition and Cancer: An International Journal, 69(5), 702-722.
24- Thangam, R., Suresh, V., Princy, W.A., Rajkumar, M., Senthilkumar, N., Gunasekaran, P., Rengasamy, R., Anbazhagan, C., Kaveri, K., Kannan, S. 2013. C-Phycocyanin from Oscillatoria tenuis exhibited an antioxidant and in vitro antiproliferative activity through induction of apoptosis and G0/G1 cell cycle arrest. Food chemistry, 140(1-2), 262-272.
25-  Wang, H., Liu, Y., Gao, X., Carter, CL., Liu, ZR. 2007. The recombinant β subunit of C-phycocyanin inhibits cell proliferation and induces apoptosis. Cancer letters, 247(1), 150-158.
26- Wen, P., Hu, TG., Wen, Y., Linhardt, RJ., Zong, MH., Zou, YX., Wu, H. 2019.Targeted delivery of phycocyanin for the prevention of colon cancer using electrospun fibers. Food Funct.10(4),1816-1825.
27-  Ying, J., Wang, J., Ji, H., Lin, C., Pan, R., Zhou, L., Song, Y., Zhang, E., Ren, P., Chen, J. 2016. Transcriptome analysis of phycocyanin inhibitory effects on SKOV-3 cell proliferation. Gene, 585(1), 58-64.