نوع مقاله : مقاله پژوهشی

نویسندگان

1 گروه زیست شناسی سلولی و مولکولی، دانشکده علوم پایه، دانشگاه مرغه، مرغه، ایران مرکز تحقیقات ایمونولوژی، دانشگاه علوم پزشکی تبریز،

2 هیئت علمی دانشگاه دولتی مراغه

3 مرکز تحقیقات ایمونولوژی، دانشگاه علوم پزشکی تبریز، تبریز، ایران

چکیده

پیشینه: لوسمی لنفوبلاستیک حاد T-cell (T-ALL) یک بدخیمی لنفوئیدی است که به علت دگرگونی اونکوژنیک اجدادT-cell ایجاد می شود. بسیاری از تغییرات ژنتیکی و اپی ژنتیکی به عنوان فاکتور های اصلی این دگرگونی بیان شده اند. اخیرا گزارش شده است که microRNA ها در لوسمی های مختلف از جمله T-ALL نقش دارند. بیان نابجای این microRNA ها در تکثیر، تهاجم و آپوپتوز از طریق هدف قرار دادن مسیر های سیگنالی گزارش شده است. miR-34a یک سرکوب کننده تومور در بسیاری از سرطان ها از جمله T-ALL است.
مواد و روش ها: در این مطالعه تجربی، سلول های لوسمی لنفوبلاستیک حاد T-cell (T-ALL) ، Jurkat در محیط کشت کامل RPMI 1640 کشت شدند و miR-34a mimic با استفاده از معرف ترانسفکشن vitro DNA in jetPEI ، ترانسفکت شد. پس از گذشت 24 ساعت، استخراج RNA و سنتز cDNA انجام شد. میزان بیان miR-34a و ژن های BACH1، PTEN وSIRT1 با استفاده از روش Real-Time PCR بررسی شد.
یافته ها: تجزیه و تحلیل نتایج حاصل از qPCR نشان داد که در سلول های Jurkat پس از ترانسفکشن با miR-34a بیان ژن های BACH1، وSIRT1 کاهش و بیان ژن PTEN افزایش می یابد.
بحث و نتیجه گیری: کاهش بیان miR-34a با متاستاز و تهاجم تومور در سرطان های مختلف نقش دارد. در مطالعه حاضر، نتایج ما نشان داد که بیان ژن های BACH1، وSIRT1 که جزو ژن های انکوژن هستند پس از ترانسفکت miR-34a کاهش می یابد و بیان ژن PTEN که تومور ساپرسور می باشد پس از ترانسفکت miR-34a افزایش می یابد.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

The role of microRNA-34a in BACH1، PTEN and SIRT1 expression in T-cell acute lymphoblastic leukemia cell line (Jurkat)

نویسندگان [English]

  • Shiva Najjary 1
  • Reza Mohammadzadeh 2
  • Behzad Baradaran 3

1 Department of Cell and Molecular Biology, Faculty of Science, University of Maragheh, Maragheh, Iran Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran

2 University of Maragheh

3 2 Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran

چکیده [English]

Background: T-cell acute lymphoblastic leukemia is a lymphoid malignancy affected by oncogenic transformation of immature T-cell progenitors. Recently, it has been reported that microRNAs play a role in various leukemias including T-ALL. The aberrant expression of these microRNAs in proliferation, invasion, and apoptosis has been reported through targeting signaling pathways. miR-34a is a tumor suppressor in many cancers, including T-ALL.
Materials and methods: In this experimental study, Jurkat T-cell acute lymphoblastic leukemia (T-ALL) cells were maintained in RPMI 1640. miR-34a mimic was transfected using jetPEI in vitro DNA transfection reagent. RNA extraction and cDNA synthesis were performed after 24 h. Expression of miR-34a and BACH1, PTEN and SIRT1 genes were examined using qRT-PCR.
Results: qRT-PCR analyses showed that in Jurkat cells after transfection with miR-34a mimic the expression of BACH1 and SIRT1 genes were reduced and the expression of PTEN was increased.
Conclusion: Low expression level of miR-34a in associated with metastasis and tumor invasion in different cancers. In current study, our results showed that the expression levels of BACH1 and SIRT1 genes which are oncogenes reduced and the expression levels of PTEN which is tumor suppressor increased after the transfection with miR-34a.
Keyword: -cell acute lymphoblastic leukemia (T-ALL), miR-34a, Jurkat cell line

کلیدواژه‌ها [English]

  • T-cell acute lymphoblastic leukemia (T-ALL)
  • miR-34a
  • Jurkat cell line

نقش تنظیمی  miR-34aدر پیشروی سلول های لوسمی لنفوبلاستیک حاد T-cell با هدف قرار دادن ژن­های BACH1، PTEN و SIRT1

شیوا نجاری1،2، رضا محمدزاده1* و بهزاد برادران2

1 ایران، مراغه، دانشگاه مراغه، دانشکده علوم پایه، گروه زیست شناسی سلولی و مولکولی

2 ایران، تبریز، دانشگاه علوم پزشکی تبریز، مرکز تحقیقات ایمونولوژی

تاریخ دریافت: 11/3/98                تاریخ پذیرش: 9/6/98

چکیده

لوسمی لنفوبلاستیک حاد T-cell (T-ALL) یک بدخیمی لنفوئیدی است که بعلت دگرگونی اونکوژنیک اجدادT-cell  ایجاد می­شود. اخیرا گزارش شده است که میکرو RNAها در لوسمی­های مختلف از جمله T-ALL نقش دارند. بیان نابجای این میکرو RNAها در تکثیر، تهاجم و آپوپتوز از طریق هدف قرار دادن مسیر­های سیگنالی گزارش شده است. MiR-34a یک سرکوب کننده­تومور در بسیاری از سرطان­ها از جمله T-ALL است. هدف از این مطالعه، بررسی نقش تنظیمی miR-34a در پیشروی سلول­های لوسمی لنفوبلاستیک حاد T-cell با هدف قرار دادن ژن­هایBACH1 ، PTEN وSIRT1  می­باشد. در این مطالعه سلول­های لوسمی لنفوبلاستیک حاد T-cell (T-ALL) در محیط کشت کامل RPMI 1640 کشت شدند و miR-34a mimic با استفاده از معرف ترانسفکشن vitro DNA in jetPEI، ترانسفکت شد. پس از گذشت 24 ساعت، استخراج RNA و سنتز cDNA انجام شد. میزان بیان miR-34a و ژن­های BACH1، PTEN وSIRT1  با استفاده از روش Real-Time PCR مورد بررسی قرار گرفت. نتایج توسط نرم افزار Graph Pad Prism 6 و آزمون Sidak وTurkey، تجزیه و تحلیل شدند. تجزیه و تحلیل نتایج حاصل از qPCR نشان داد که بیان ژن­های BACH1 وSIRT1 که جزء ژن­های انکوژن هستند پس از ترانسفکتmiR-34a  کاهش می­یابد و بیان ژن PTEN که سرکوبگر تومور می­باشد پس از ترانسفکت miR-34a  افزایش می­یابد.

واژه های کلیدی: لوسمی لنفوبلاستیک حاد T-cell (T-ALL)، miR-34a، BACH1، PTEN و SIRT1

* نویسنده مسئول، تلفن: 04137272072، پست الکترونیکی:[email protected]

مقدمه

 

لوسمی حدود 8 درصد از کل موارد سرطان را در جهان تشکیل می­دهد و شامل همه­ی گروه­های سنی با بروز متفاوت در ایران و جهان است (54). لوسمی لنفوبلاستیک­حاد (ALL) یک بدخیمی خونی بسیار تهاجمی است که ناشی از تکثیر و گسترش بلاست­های لنفوئیدی در خون، مغز استخوان و سایراعضای بدن است (32). ALL رایج ترین بیماری لوسمی حاد دوران کودکی است که 80٪ از لوسمی­های کودکان را شامل می­شود اما تنها 20٪ از لوسمی­های بالغین را تشکیل می ­دهد (5). ALL با توجه به سلول­های لنفوبلاستیکی که تحت تاثیر قرار می­گیرند، می­تواند به T-cell ALL (T-ALL) و B-cell ALL (B-ALL) تقسیم شود (41).  T-ALL تقریبا 20٪ از همه موارد ALL را تشخیص می­دهد و در بزرگسالان نسبت به کودکان شایع­تر است (50). تظاهرات بالینی T-ALL شامل تب، ترومبوسیتوپنی، خونریزی، عفونت و توده های تیموسی بزرگ متعدد می­باشد (9, 33). در حال حاضر درمان T-ALL شیمی درمانی با دوز بالا است که میزان بقای کودکان بیمار را افزایش داده است. با این حال شیمی درمانی دارای عوارض جانبی کوتاه مدت و بلند مدت است. همچنین عود بیماری چالش مهم دیگری است که در بیماران T-ALL مشاهده می­شود (19,25). کشف میکرو RNA­ها درک جدیدی را از سرطان زایی بوجود آورده است. تنظیم نابجای میکرو RNAها می­تواند منجر به اختلال در سیستم خونی و ایجاد سرطان خون شود (39). میکرو RNAها برای اولین بار در سال 1993 توسط لی و همکارانش در نماتد سینورابدیتیس الگانس (Caenorhabditis elegans) شناسایی شدند (30). ­miRNAها نقش مهمی در تنظیم مسیرهای متابولیک و سلولی متعدد مانند کنترل تکثیر سلولی، تمایز و بقا دارند. اعضای خانواده miR-34 شامل سه میکرو RNA پردازش شده است که شامل  miR-34a و همولوگ های miR-34b و miR-34c است (3,14) و حذف در این مناطق اغلب در انواع سرطان­هایی از جمله سرطان پستان، سرطان ریه، سرطان کولورکتال و بدخیمی های خونی دیده می­شود (4). miR-34a از میکرو RNAهای سرکوبگر توموراست که کاهش بیان دارد و در این مورد درمان با بازگرداندن بیان این میکرو RNA بحالت نرمال انجام می­گیرد که برای این منظور از روش درمان با جایگزینی میکرو RNA استفاده می­شود (6,47). افزایش بیان miR-34 با رشد سلول­های کلونوژنیک، تهاجم سلولی، متوقف شدن آپوپتوز و کاهش حساسیت سلولها به شیمی درمانی در سرطان پانکراس مرتبط است. در مطالعه دیگری نشان داده شد که خانواده miR-34 می تواند بیان و جهش p53 را تنظیم کند، در حالی که miR-34b و miR-34c، MYC را هدف قرار می ­دهد (11,16, 27, 43). علاوه بر این، miR-34a می­تواند بیان ژن SIRT1 را مهار کند و بیان p53 استیله و p21 را افزایش دهد و موجب تنظیم چرخه سلولی و آپوپتوز شود (52). BACH1 یک ژن کد کننده پروتئین است. از مسیرهای مرتبط با آن می­توان به مسیر سرطان پستان یکپارچه و مسیر BRCA1 اشاره کرد. تفسیر هستی شناسی ژن مربوط به BACH1 شامل فعالیت فاکتور رونویسی اتصال دهنده  DNAو اتصال پروتئین هِم است (18). پروتئین PTEN یک مهارکننده تومور است که فعالیت آن اغلب در سرطان های انسانی کاهش می­یابد. بنابراین فعال شدن مجدد چنین پروتئینی بطور بالقوه می­تواند یک درمان مؤثرعلیه سرطان باشد (53). سیتروئین­ها بدلیل نقش­های متنوعی که در وقایع مختلف فیزیولوژیکی و پاتولوژیکی از جمله اختلالات مرتبط با سن، چاقی، التهاب و سرطان دارند، توجه ویژه­ای به خود جلب کرده­اند. نقش SIRT1 در سرطان­ها در سال­های اخیر بسیار مورد مطالعه قرار گرفته است. با این حال نقش سیتروئین­ها در سرطان­ها هنوز هم مورد بحث است زیرا می­توانند با توجه به بافت سلولی یا اهداف آن در مسیرهای خاص سیگنالی یا سرطانهای خاص بعنوان سرکوبگر تومور یا انکوژن عمل کنند (31). شناسایی میکرو RNAها و اهداف آنها که در توسعه سرطان و متاستاز نقش دارند، ممکن است فرصت­های درمانی جدیدی فراهم کند (20, 28, 34, 35, 49). هدف از پژوهش حاضر بررسی تاثیرترانسفکت miR-34a و افزایش بیان آن بر میزان بیان ژن‌های هدف BACH1، PTEN و SIRT1 در رده سلولی  Jurkat  در لوسمی لنفوبلاستیک حادT-cell  (T-ALL) می­باشد.

مواد و روشها

کشت سلول­های JURKAT: رده سلولیJurkat  از انستیتو­پاستور ایران به صورت ویال خریداری شد. سلول ها در محیط کشت RPMI-1640 غنی شده با 10% FBS (USA-GibcoBRL) و 1% آنتی بیوتیک پنی سیلین/ استرپتومایسین (USA-GibcoBRL) در 37 درجه سانتی گراد و اتمسفر مرطوب حاوی 5% CO2 کشت داده شدند.

ترانسفکت miR-34a: برای ترانسفکتmiR-34a ، سلول­های Jurkat در پلیت 6 خانه­ای به مقدار تقریبی105× 8 سلول در هر چاهک کشت شدند. برای انجام بقیه مراحل انتقال از پروتکل شرکتjetPEI  (PolyPlus-transfection, Strasbourg, France) استفاده شد. برای این منظور ابتدا در میکروتیوپ 200 μl، بافر و غلظت های 1 و 5 و 10 نانومول از miR-34a و4μl  jetPEI اضافه شد و بمدت 15 دقیقه در دمای محیط انکوبه گردید. پس از گذشت این مدت زمان، مخلوط موجود به چاهک­های پلیت منتقل شد و سپس پلیت حاوی سلول­های ترانسفکت شده بمدت 24 ساعت در انکوباتور 37 درجه سانتی گراد با 5% CO2 انکوبه گردید. زمان و غلظت موثر miR-34a بر روی سلول­هایJurkat بررسی شد و در نهایت ازغلظت متوسط (5 نانومول) استفاده شد. دراین آزمایش از U6 بعنوان کنترل داخلی استفاده شد و بیان ژن های مرتبط با کنترل که 1 در نظر گرفته شده بود، محاسبه گردید.

استخراج RNA و سنتز cDNA : کارایی ترانسفکشن miR-34a پس از 24 ساعت بررسی شد و بمنظور تغییر بیان ژن­ها توسط میکروRNA ، RNA کل سلول با استفاده از محلول Riboex (GENEALL Biotechnology, Seoul, Korea) استخراج شد. سپس میزان خلوص RNA استخراج شده توسط دستگاه Nano drop اندازه گیری شد. DNA مکمل (cDNA) با استفاده از کیت سنتز miScript II RT (QIAGEN, Hilden, Germany) برای miR-34a با توجه به پروتکل شرکت سازنده سنتز شد. سنتز cDNA ژن‌های BACH1، PTEN و SIRT1 با استفاده از کیت (BIOFACT, korea) انجام شد. سنتز رشته cDNA از روی رشته RNA به کمک پرایمر Random hexamer صورت گرفت.

qRT-PCR: تغییرات میزان بیان میکروRNA با روش qRT-PCR با استفاده از کیت miScript SYBR Green PCR (QIAGEN, Hilden, Germany) که حاوی پرایمر­های اختصاصی این میکرو RNA است، بررسی شد. ژن U6 بعنوان کنترل داخلی miR-34a و ژن β‐Actin بعنوان کنترل داخلی ژن­های BACH1، PTEN وSIRT1 استفاده شد. طراحی پرایمرها با استفاده از سایت مخصوص طراحی پرایمر، primer blast در NCBI صورت گرفت و توسط شرکت تکاپو زیست، پرایمر‌ها سنتز شدند. توالی هدف پرایمر miR-34a در جدول1 و توالی پرایمر ژن های BACH1، PTEN  وSIRT1  در جدول2 نشان داده شده است. داده ها با استفاده از روش Pfaffle (2-∆∆Ct) آنالیزشد.

 

جدول 1- توالی هدف پرایمر miR-34a

UGGCAGUGUCUUAGCUGGUUGU

miR-34a

Forward : CTTCGGCAGCACATATACTAAAATTGG

U6

Reverse : TCATCCTTGCGCAGGGG

 

جدول 2- توالی پرایمر ژن های BACH1، PTEN  و SIRT1

Forward : TCCCTGGAGAAGAGCTACG

β‐Actin

Reverse : GTAGTTTCGTGGATGCCACA

Forward :TGCGATGTCACCATCTTTGT

BACH1

Reverse : CCTGGCCTACGATTCTTGAG

Forward : TGGCAAAGGAGCAGATTAGTAGG

SIRT1

Reverse : CTGCCACAAGAACTAGAGGATAAGA

Forward : GGTTTTTTGAGGTGTTT

PTEN

Reverse : AAAAACTAAACACAATCACA

 


آنالیز آماری: جهت تجزیه و تحلیل آماری نتایج بدست آمده از نرم افزار Graph Pad Prism 6 استفاده شد. برای تعیین تغییرات متغیر بین گروه­های کنترل و ترانسفکت شده با میکرو RNA از آزمون Sidak و Turkey استفاده گردید که سطح معنی داری p< 0.05 در نظر گرفته شد.

نتایج

تغییر بیان miR-34a پس از ترانسفکشن سلول Jurkat: بیان miR-34a در گروه کنترل و گروه سلول­های ترانسفکت شده با miR-34a توسط آزمایش qRT-PCR ارزیابی شد. نتایج نشان داد که بعد از ترانسفکت miR-34a میزان بیان این میکرو­RNA بمیزان قابل توجهی پس از 72 ساعت افزایش یافته است و بـا اسـتفاده از روش 2-∆∆Ctافزایش 300 برابری بوده است (شکل 1). دراین مطالعه 05/0 > p (غلظت) و 00001/0 > p (زمان) معنی­دار در نظر گرفته شد. این نتایج تجزیه و تحلیل بیان نشان داد که miR-34a ممکن است یک هدف مهم درمانی باشد.

 

 

شکل1- تغییرات بیان miR-34a  در سلول های ترانسفکت شده با miR-34a و گروه کنترل در زمان های 24، 48 و 72 ساعت و غلظت های 1، 5 و 10 نانومول توسط qRT-PCR ارزیابی شد، (A) بیان miR-34a درغلظت های مختلف و P <0.05)) معنی دار است، (B) بیان miR-34a در زمان های مختلف و (P <0.00001) معنی­دار است.

 


ارتباط بیان miR-34a و بیان ژن‌های BACH1، PTEN و SIRT1: نتایج نشان داد که میزان بیان ژن‌های BACH1 وSIRT1  در اثر ترانسفکشن با miR-34a نسبت به گروه کنترل کاهش می­یابد که این کاهش معنی دار است (001/0 > p) و بیان ژن PTEN در اثر ترانسفکشن با miR-34a نسبت به گروه کنترل افزایش می­یابد که این افزایش معنی­دار است (001/0 > p). سطح بیان نسبی ژن BACH1 در گروه ترانسفکت شده با میکرو RNA، 7 درصد بود که نسبت به نمونه کنترل کاهش یافته بود (شکل2). سطح بیان نسبی ژن SIRT1 در گروه ترانسفکت شده با میکرو RNA، 8 درصد بود که نسبت به نمونه کنترل کاهش یافته بود (شکل3). سطح بیان نسبی ژن PTEN در گروه ترانسفکت شده با میکرو RNA ، 17 درصد بود که نسبت به نمونه کنترل افزایش یافته بود (شکل4).

بحث

لوسمی لنفوبلاستیک حاد (ALL) شایع ترین  بدخیمی  در

کودکان است. T-ALL، سلول­های بنیادی تولید کننده سلول­های لنفوئیدی، بخصوص نوعی از سلول­های سفید خون به نام لنفوسیت­های T را تحت تاثیر قرار می­دهد (10,51).

 

 

 

شکل2- تغییرات بیان ژنBACH1  در سلول­های ترانسفکت شده با غلظت 5 نانومول از miR-34a و گروه کنترل در سلول Jurkat توسط qRT-PCR ارزیابی شد.

 

شکل3- تغییرات بیان ژنSIRT1  در سلول های ترانسفکت شده با غلظت 5 نانومول از miR-34a و گروه کنترل در سلول Jurkat توسط qRT-PCR ارزیابی شد.

 

 

شکل4- تغییرات بیان ژنPTEN  در سلول های ترانسفکت شده با غلظت 5 نانومول از miR-34a و گروه کنترل در سلول Jurkat توسط qRT-PCR ارزیابی شد.

میکرو RNA­ها کلاسی از RNA­های غیر کدکننده درون­زا هستند که بعنوان تنظیم کننده­های اصلی ژنوم انسان عمل می­کنند (1, 2, 8).  بیان نابجا و عملکرد میکرو RNA­ها در بسیاری از بیماری های انسانی این اجزای کوچک سلولی را به اهداف درمانی تبدیل کرده است (15,22). بویژه در سرطان، برخی از میکرو RNA­ها با معیارهای سختگیرانه­ای برای تبدیل شدن به اهداف ایده­آل درمانی با عملکرد به عنوان آنکوژن­ها و سرکوب کننده توموررو به رو می­شوند (23, 29, 44, 45). میکروRNA ها تقریبا در تمام بدخیمی های جامد و خونی تنظیم نابجا دارند (36). miR-34a بعنوان یک میکرو­RNA سرکوب­کننده تومور شناخته شده است. با توجه به شواهد علمی که در حال افزایش است، مشخص است که miR-34a از طریق تنظیم و تغییر تعدادی از آنکوژن­ها، رشد تومور را مهار می­کند. مطالعات مختلفی در مورد نقش miR-34a در سرطان­های مختلف انجام شده است. در مطالعه­ای توسط Qing و همکارانش miR-34 mimic که به سلول سرطانی معده، Kato III ترانسفکت شده بود، باعث کاهش رشد سلول، مهار پیشرفت در طی چرخه سلول و افزایش آپوپتوز دراین سلول­ها شد (26). در مطالعه دیگری Mraz و همکارانش مشاهده کردند که بیان miR-34a به طور مداوم در CLL با جهش های p53 کاهش می­یابد که نشان می­دهد تشخیص بیان miR-34a می­تواند بعنوان پیش بینی کننده برای پاسخ درمانی استفاده شود (40).  BACH1 یک ژن کد کننده و یک عامل رونویسی است که در تعادل سلولی پاسخ استرس هِم اکسیداتیو، تنظیم پیشرفت چرخه سلولی و تنظیم HO-1 (هموژناز1) در سرطان­ها دخالت دارد. همچنین BACH1 بعنوان پروتئین متصل به گروه پروستتیک هِم نیز شناخته می­شود. این پروتئین از طریق دومِین BTB-POZ هترودیمر تشکیل می ­دهد که به کمپلکس DNA-binding متصل می­شود و در تنظیم ساختار کروموزومی دخالت دارد. ویژگی اتصال به هِم به طور منفی فعالیت DNA-binding را تنظیم می­کند. اگرچه BACH1 به عنوان مهار­کننده رونویسی گزارش شده است ولی می­تواند به عنوان فعال کننده ژن­های هدف نیز عمل کند. بر اساس مطالعات دخالت BACH1 در سرطان ها بویژه سرطان پستان گزارش شده است. ژن BACH1 در تنظیم چندین ژن از جمله CXCR4 و MMP1 که در مهاجرت و متاستاز سلول های سرطانی به ارگان­های دیگر نقش دارند، دخالت دارد (18). در مطالعه دیگری ژن BACH1 در میان ژن های کروموزوم 21 شناسایی شده است که بیان بالای آن در لوسمی مگاکاریوبلاستیک مزمن (AMKL) نشان داده شده است (12). فسفاتاز PTEN دارای موتیف فعال اختصاصی برای خانواده پروتئین تریروزین فسفاتازاست و فسفاتیدیل اینوزیتول تری فسفات (PIP3) سوبسترای اصلی آن است (21). همچنین PTEN آنتاگونیست اصلی مسیر PI3 کیناز است که نشان دهنده نقش مهم آن در کنترل پیشرفت و توسعه تومور است. نتایج مطالعات بر روی PTEN درک بسیاری از جنبه­های زیست شناسی مانند متابولیسم فسفولیپید و مسیرهای سیگنالی پایین دست، تنظیم فرآیندهای سلولی مانند مهاجرت و در نهایت اصول ژنتیکی مهار سرطان را فراهم آورده است. ارتباط مهارPTEN در سطح رونویسی با لوسمی T cell بیان شده است (53). همچنین بر اساس مطالعات ارتباط بین مقاومت به گاما-سکرتاز (GSI) در لوسمی تحت تاثیرNOTCH1 با جهش PTEN یافت شده است که نشان دهنده اهمیت مسیر PTEN در این بدخیمی هاست. علاوه بر این مطالعات مشابه در مورد نقش PTEN در درمان­های هدفمند در مورد ارتباط تغییرات PTEN/PI3K و مقاومت به مهارکننده های HER2، Herceptin/Trastuzumab در سرطان پستان (42) و مقاومت به مهار کننده­های EGFR، Erlotinib و Gefitinib در بیماران گلیوبلاستوما انجام شده است (38). SIRT1 یکی از اعضای خانواده Sirtuin است. SIRT1 یک نیکوتین آمید آدنوزین دی نوکلئوتید (NAD) وابسته به دِاستیلاز است و گروه استیل را از بسیاری از پروتئین­های هیستونی و غیر هیستونی جدا می­کند (37,46).  بر اساس گزارشات بیان شده است که سطح SIRT1 بطور چشمگیری در سرطان پروستات (24)، لوسمی میلوئیدی حاد (13) و سرطان کولون در مرحله اولیه (48) بالا است.

نتیجه گیری

 در این مطالعه تاثیر miR-34a بر میزان بیان ژن­های BACH1، PTEN وSIRT1  در رده سلولیJurkat  مورد مطالعه قرار گرفت. نتایج نشان داد که میزان بیان PTEN که یک سرکوبگر تومور است در اثر انتقال با miR-34a افزایش و میزان بیان ژن های BACH1 و SIRT1 که انکوژن هستند، کاهش می­یابد. در مطالعه ای که توسط Yamakuchi و همکارانش  نیز انجام شد، نشان دادند miR-34a بیان ژن SIRT1 را مهار می­کند که منجر به افزایش بیان ژن های P53 و P21 می­شود که در نهایت موجب القای آپوپتوز در سلول های سرطان کولون WT می­شود (52). نتایج ما می­تواند بیان کننده این باشد که با القای افزایش بیان این میکرو RNA و تاثیر آن بر افزایش بیان PTEN و کاهش بیان ژن های BACH1 وSIRT1  می­توان تکثیر سلول­ها در این بیماری را کاهش داد. علاوه براین، ژن PTEN می­تواند بعنوان مارکر تشخیصی، پیش آگهی و همچنین هدف درمانی سرطان، مورد بررسی­های بیشتر قرار گیرد. بـا توجـه بـه محـدودیتهـای مطالعه حاضرازقبیل بررسی در سطح آزمایشگاهی و مطالعه بر روی یک رده سلولی، پیشنهاد می­شود که میزان بیـان miR-34a در دیگر رده های سلولی و در سطح کلینیکی نیز مورد بررسی قرار گیرد.

1- سهرابی، سید سجاد، اسماعیلی، نظریان فیروزآبادی و فلاحی. (2019). شناسایی و تعیین خصوصیات میکرو RNA‌های حفاظت شده در عدس. مجله پژوهش‌های سلولی و مولکولی.‎
2- صمدی، بهاره، قائدی، کامران، صنعتی، محمد حسین. (2019). بررسی ارتباط پلی مورفیسم تک نوکلئوتیدی rs2976394 ژن PSCA مرتبط با hsa-miR-3934 و ابتلا به سرطان معده. مجله پژوهش‌های سلولی و مولکولی.‎
 
3- Adachi, N., & Lieber, M. R. (2002). Bidirectional gene organization: a common architectural feature of the human genome. Cell, 109(7), 807-809.
4- Agostini, M., & Knight, R. A. J. O. (2014). miR-34: from bench to bedside. Oncotarget, 5(4), 872.
5- Aldoss, I., Forman, S. J., & Pullarkat, V. J. J. o. o. p. (2019). Acute lymphoblastic leukemia in the older adult. ournal of oncology practice, 15(2), 67-75.
6- Bader, A. G., Brown, D., & Winkler, M. J. C. r. (2010). The promise of microRNA replacement therapy. Cancer research, 70(18), 7027-7030.
7- Baghbani, E., Khaze, V., Sadreddini, S., Mokhtarzadeh, A., Mansoori, B., Mohammadi, A., Baradaran, B. J. A. P. B. (2018). PTPN22 Silencing in Human Acute T-Cell Leukemia Cell Line (Jurkat Cell) and its Effect on the Expression of miR-181a and miR-181b. Advanced Pharmaceutical Bulletin, 8(2), 277.
8- Bartel, D. P. J. c. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell, 116(2), 281-297.
9- Bazarbachi, A., Suarez, F., Fields, P., & Hermine, O. J. B. (2011). How I treat adult T-cell leukemia/lymphoma. blood-2011-2003-345702.
10- Board, P. P. T. E. (2019). Childhood Acute Lymphoblastic Leukemia Treatment (PDQ®). In PDQ Cancer Information Summaries [Internet]: National Cancer Institute (US).
11- Bonetti, P., Climent, M., Panebianco, F., Tordonato, C., Santoro, A., Marzi, M. J., Nicassio, F. J. O. (2019). Dual role for miR-34a in the control of early progenitor proliferation and commitment in the mammary gland and in breast cancer. Oncogene, 38(3), 360.
12- Bourquin, J.-P., Subramanian, A., Langebrake, C., Reinhardt, D., Bernard, O., Ballerini, P., Hasle, H. J. P. o. t. N. A. o. S. (2006). Identification of distinct molecular phenotypes in acute megakaryoblastic leukemia by gene expression profiling. Proceedings of the National Academy of Sciences, 103(9), 3339-3344.
13- Bradbury, C., Khanim, F., Hayden, R., Bunce, C., White, D., Drayson, M., Turner, B. J. L. (2005). Histone deacetylases in acute myeloid leukaemia show a distinctive pattern of expression that changes selectively in response to deacetylase inhibitors.Leukemia, 19(10), 1751.
14- Buanne, P., Corrente, G., Micheli, L., Palena, A., Lavia, P., Spadafora, C., Quarto, M. J. G. (2000). Cloning of PC3B, a novel member of the PC3/BTG/TOB family of growth inhibitory genes, highly expressed in the olfactory epithelium.Genomics, 68(3), 253-263.
15- Calin, G. A., & Croce, C. M. J. N. r. c. (2006). MicroRNA signatures in human cancers.Nature reviews cancer, 6(11), 857.
16- Cannell, I., & Bushell, M. J. C. C. (2010). Regulation of Myc by miR-34c: A mechanism to prevent genomic instability? . Cell Cycle, 9(14), 2798-2802.
17- Cheng, C.-Y., Hwang, C.-I., Corney, D. C., Flesken-Nikitin, A., Jiang, L., Öner, G. M., Nikitin, A. Y. J. C. r. (2014). miR-34 cooperates with p53 in suppression of prostate cancer by joint regulation of stem cell compartment. Cell reports, 6(6), 1000-1007.
18- Davudian, S., Mansoori, B., Shajari, N., Mohammadi, A., & Baradaran, B. J. G. (2016). BACH1, the master regulator gene: A novel candidate target for cancer therapy.Gene, 588(1), 30-37.
19- den Hoed, M. A., Pluijm, S. M., te Winkel, M. L., de Groot-Kruseman, H. A., Fiocco, M., Hoogerbrugge, P., Bresters, D. J. h. (2015). Aggravated bone density decline following symptomatic osteonecrosis in children with acute lymphoblastic leukemia. Haematologica, 100(12), 1564-1570.
20- Deng, Z.-Q., Yin, J.-Y., Tang, Q., Liu, F.-Q., Qian, J., Lin, J., .pathology, e. (2014). Over-expression of miR-98 in FFPE tissues might serve as a valuable source for biomarker discovery in breast cancer patients.International journal of clinical and experimental pathology, 7(3), 1166.
21- Engelman, J. A., Luo, J., & Cantley, L. C. J. N. R. G. (2006). The evolution of phosphatidylinositol 3-kinases as regulators of growth and metabolism.Nature Reviews Genetics, 7(8), 606.
22- Esquela-Kerscher, A., & Slack, F. J. J. N. R. C. (2006). Oncomirs—microRNAs with a role in cancer. Nature reviews cancer, 6(4), 259.
23- Hayden, E. C. J. N. (2008). Cancer complexity slows quest for cure. Nature, 455(7210), 148-149.
24- Huffman, D. M., Grizzle, W. E., Bamman, M. M., Kim, J.-s., Eltoum, I. A., Elgavish, A., & Nagy, T. R. J. C. r. (2007). SIRT1 is significantly elevated in mouse and human prostate cancer. Cancer research, 67(14), 6612-6618.
25- Hunger, S. P., Lu, X., Devidas, M., Camitta, B. M., Gaynon, P. S., Winick, N. J., Carroll, W. L. J. J. o. C. O. (2012). Improved survival for children and adolescents with acute lymphoblastic leukemia between 1990 and 2005: a report from the children's oncology group.  Journal of Clinical Oncology, 30(14), 1663.
26- Ji, Q., Hao, X., Meng, Y., Zhang, M., DeSano, J., Fan, D., & Xu, L. J. B. c. (2008). Restoration of tumor suppressor miR-34 inhibits human p53-mutant gastric cancer tumorspheres.BMC cancer, 8(1), 266.
27- Ji, Q., Hao, X., Zhang, M., Tang, W., Yang, M., Li, L., Fan, D. J. P. o. (2009). MicroRNA miR-34 inhibits human pancreatic cancer tumor-initiating cells. PloS one, 4(8), e6816.
28- Jiang, Q., Lu, X., Huang, P., Gao, C., Zhao, X., Xing, T., Zheng, H. J. B. r. i. (2018). Expression of miR-652-3p and effect on apoptosis and drug sensitivity in pediatric acute lymphoblastic leukemia. BioMed research international, 2018.
29- Jones, S., Zhang, X., Parsons, D. W., Lin, J. C.-H., Leary, R. J., Angenendt, P., Jimeno, A. J. s. (2008). Core signaling pathways in human pancreatic cancers revealed by global genomic analyses. Science, 321(5897), 1801-1806.
30- Lee, R. C., Feinbaum, R. L., & Ambros, V. (1993). The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell, 75(5), 843-854.
31- L Lin, Z., & Fang, D. (2013). The roles of SIRT1 in cancer. Genes & cancer, 4(3-4), 97-104.
32- Litzow, M. R., & Ferrando, A. A. (2015). How I treat T-cell acute lymphoblastic leukemia in adults. Blood, 126(7), 833-841.
33- Litzow, M. R., & Ferrando, A. A. J. B. (2015b). How we treat T-cell acute lymphoblastic leukemia in adults. Blood-2014-2010-551895.
34- Liu, Y., Yin, J., Abou-Kheir, W., Hynes, P., Casey, O., Fang, L., Sheppard-Tillman, H. J. O. (2013). MiR-1 and miR-200 inhibit EMT via Slug-dependent and tumorigenesis via Slug-independent mechanisms. Oncogene, 32(3), 296.
35- Liu, Z., Zhu, J., Cao, H., Ren, H., & Fang, X. J. I. j. o. o. (2012). miR-10b promotes cell invasion through RhoC-AKT signaling pathway by targeting HOXD10 in gastric cancer. International journal of oncology, 40(5), 1553-1560.
36- Lu, J., Getz, G., Miska, E. A., Alvarez-Saavedra, E., Lamb, J., Peck, D., Ferrando, A. A. J. n. (2005). MicroRNA expression profiles classify human cancers. Nature, 435(7043), 834.
37- Luo, Y., Chen, J.-J., Lv, Q., Qin, J., Huang, Y.-Z., Yu, M.-H., & Zhong, M. J. C. l. (2019). Long non-coding RNA NEAT1 promotes colorectal cancer progression by competitively binding miR-34a with SIRT1 and enhancing the Wnt/β-catenin signaling pathway. Cancer letters, 440, 11-22.
38- Mellinghoff, I. K., Wang, M. Y., Vivanco, I., Haas-Kogan, D. A., Zhu, S., Dia, E. Q., Chute, D. J. J. N. E. J. o. M. (2005). Molecular determinants of the response of glioblastomas to EGFR kinase inhibitors. New England Journal of Medicine, 353(19), 2012-2024.
39- Miao, M.-h., Ji, X.-q., Zhang, H., Xu, J., Zhu, H., & Shao, X.-j. J. O. (2016). miR-590 promotes cell proliferation and invasion in T-cell acute lymphoblastic leukaemia by inhibiting RB1. Oncotarget, 7(26), 39527.
40- Mraz, M., Malinova, K., Kotaskova, J., Pavlova, S., Tichy, B., Malcikova, J., Doubek, M. J. L. (2009). miR-34a, miR-29c and miR-17-5p are downregulated in CLL patients with TP53 abnormalities. Leukemia, 23(6), 1159.
41- Mullighan, C. G. J. A. E. P. B. (2014). The genomic landscape of acute lymphoblastic leukemia in children and young adults.ASH Education Program Book, 2014(1), 174-180.
42- Nagata, Y., Lan, K.-H., Zhou, X., Tan, M., Esteva, F. J., Sahin, A. A., Nguyen, N. T. J. C. c. (2004). PTEN activation contributes to tumor inhibition by trastuzumab, and loss of PTEN predicts trastuzumab resistance in patients.Cancer cell, 6(2), 117-127.
43- Okada, N., Lin, C.-P., Ribeiro, M. C., Biton, A., Lai, G., He, X., development. (2014). A positive feedback between p53 and miR-34 miRNAs mediates tumor suppression. Genes & development28(5), 438-450.
44- Ors-Kumoglu, G., Gulce-Iz, S., & Biray-Avci, C. J. C. (2019). Therapeutic microRNAs in human cancer. Cytotechnology, 71(1), 411-425.
45- Parsons, D. W., Jones, S., Zhang, X., Lin, J. C.-H., Leary, R. J., Angenendt, P., Gallia, G. L. J. S. (2008). An integrated genomic analysis of human glioblastoma multiforme. Science321(5897), 1807-1812.
46- Pillarisetti, S. J. R. p. o. c. d. d. (2008). A review of Sirt1 and Sirt1 modulators in cardiovascular and metabolic diseases. Recent patents on cardiovascular drug discovery, 3(3), 156-164.
47- Slabáková, E., Culig, Z., Remšík, J., & Souček, K. (2017). Alternative mechanisms of miR-34a regulation in cancer. Cell death & disease, 8(10), e3100.
48- Stünkel, W., Peh, B. K., Tan, Y. C., Nayagam, V. M., Wang, X., Salto‐Tellez, M., Wood, J. J. B. J. H. N. T. (2007). Function of the SIRT1 protein deacetylase in cancer. Biotechnology Journal: Healthcare Nutrition Technology2(11), 1360-1368.
49- Tsang, T. Y., Tang, W. Y., Chan, J. Y. W., Yeung, C. L. A., Yau, P. L., Kong, S. K., Kwok, T. T. J. A. (2011). P-glycoprotein enhances radiation-induced apoptotic cell death through the regulation of miR-16 and Bcl-2 expressions in hepatocellular carcinoma cells. Apoptosis, 16(5), 524-535.
50- Vadillo, E., Dorantes-Acosta, E., Pelayo, R., & Schnoor, M. J. B. r. (2018). T cell acute lymphoblastic leukemia (T-ALL): new insights into the cellular origins and infiltration mechanisms common and unique among hematologic malignancies. Blood reviews, 32(1), 36-51.
51- Van Vlierberghe, P., & Ferrando, A. J. T. J. o. c. i. (2012). The molecular basis of T cell acute lymphoblastic leukemia. The Journal of clinical investigation, 122(10), 3398-3406.
52- Yamakuchi, M., Ferlito, M., & Lowenstein, C. J. J. P. o. t. N. A. o. S. (2008). miR-34a repression of SIRT1 regulates apoptosis. Proceedings of the National Academy of Sciences, 105(36), 13421-13426.
53- Yin, Y., & Shen, W. J. O. (2008). PTEN: a new guardian of the genome. Oncogene, 27(41), 5443.
54- Zand, A., Sa’adati, M., Borna, H., Ziaei, R., & Honari, H. J. K. M. J. (2010). Effect of age, gender and blood group on blood cancer types.Kowsar Medical journal, 15(2), 111-114.