تغییرات بیان ژن آدنوزین دآمیناز (ADA) در سلول‌های سرطان پستان انسانی رده‌های MCF-7 و MDA-MB-231 و سلول‌های رده نرمال MCF-10A تیمار شده با عصاره شیرین بیان

نوع مقاله : مقاله پژوهشی

نویسندگان

1 دانشگاه آزاد اسلامی - واحد نیشابور- گروه زیست شناسی

2 دانشگاه آزاد اسلامی - واحد نیشابور

3 دانشکده علوم پایه، دانشگاه آزاد اسلامی واحد نیشابور، نیشابور، ایران

چکیده

هدف: آنزیم آدنوزین دآمیناز (ADA) در متابولیسم پورین‌ها شرکت داشته و نقش اساسی در تکثیر و بلوغ سلول‌های پستانداران دارد و همچنین فعالیت آن در سلول‌های سرطان پستان افزایش می‌یابد. در این پژوهش اثر عصاره آبی ریشه گیاه شیرین‌بیان بر درصد زنده‌مانی و بیان ژن ADA در دو رده‌ سرطانی پستان انسانی MCF-7 و MDA-MB-231 و همچنین یک رده نرمال MCF-10A مورد مطالعه قرار گرفت.
مواد و روش‌ها: سمیت سلولی عصاره آبی شیرین‌بیان به روش رنگ سنجی MTT بررسی گردید و بیان ژن ADA با روش Real-time PCR سنجیده شد.
نتایج: با افزایش غلظت عصاره درصد زنده ماندن سلول‌ها به ویژه در رده‌های سرطانی به طور معنی‌داری کاهش یافت و همچنین بیان ژن ADA در غلظت 200 میکروگرم در میلی لیتر عصاره در رده‌های MCF-7 و MDA-MB-231 به ترتیب به میزان 4 و 8/4 برابر کاهش پیدا کرد.
نتیجه‌گیری: نتایج بیانگر آن است که عصاره این گیاه با کاهش بیان ژن ADA سبب کاهش درصد زنده‌مانی سلول‌های سرطانی پستان شده است.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Adenosine deaminase (ADA) gene expression changes in human breast cancer cell lines MCF-7 and MDA-MB-231 and normal cell line MCF-10A treated by Glycyrrhiza glabra extract

نویسندگان [English]

  • Fatemeh Saeid Nematpour 2
  • Amir Shirzad 3

2 Neyshabur Branch, Islamic Azad University

3 Islamic azad university neyshabur branch, neyshabur, iran

چکیده [English]

Objective: The adenosine deaminase enzyme participates in the metabolism of purines, and plays an essential role in the proliferation and maturation of mammalian cells and, also its activity increases in breast cancer cells. In this study, the effect of aqueous extract of Glycyrrhiza glabra on viability and ADA gene expression in two human breast cancer cell lines (MCF-7 and MDA-MB-231) and one normal cell line (MCF-10A) were studied.
Materials and Methods: Cytotoxicity of the G. glabra extract was examined by MTT assay. The expression ADA gene was evaluated by Real-time PCR.
Results: The vitality of cancerous cells are decreased by increasing the concentration of the extract significantly. The expression of ADA gene at the concentration of 200 μg/ml of extract in MCF-7 and MDA-MB-231 lines decreased by 4 and 4.8 fold, respectively.
Conclusion: The decrease in viability of breast cancer cells observed in this study could be the result of the reduction of ADA gene expression.

کلیدواژه‌ها [English]

  • Breast cancer
  • Glycyrrhiza glabra
  • Adenosine deaminase
  • cell culture

تغییرات بیان ژن آدنوزین دآمیناز (ADA) در سلولهای سرطان پستان انسانی رده­های MCF-7 و MDA-MB-231 و سلولهای رده نرمال MCF-10A تیمار شده با عصاره شیرین بیان

اکبر صفی پور افشار*، فاطمه سعید نعمت پور و امیر شیرزاد

ایران، نیشابور، دانشگاه آزاد اسلامی، واحد نیشابور، گروه زیست شناسی

تاریخ دریافت: 10/04/1398          تاریخ پذیرش: 04/06/1398

چکیده

آنزیم آدنوزین دآمیناز (ADA) در متابولیسم پورینها شرکت داشته و نقش اساسی در تکثیر و بلوغ سلولهای پستانداران دارد و همچنین فعالیت آن در سلولهای سرطان پستان افزایش می‌یابد. در این پژوهش اثر عصاره آبی ریشه گیاه شیرین­بیان بر درصد زنده­مانی و بیان ژن ADA در دو رده­ سرطانی پستان انسانی MCF-7 و MDA-MB-231 و همچنین یک رده نرمال MCF-10A مورد مطالعه قرار گرفت. سمیت سلولی عصاره آبی شیرین­بیان به روش رنگ سنجی MTT بررسی گردید و بیان ژن ADA با روش Real-time PCR سنجیده شد. با افزایش غلظت عصاره درصد زنده ماندن سلولها به ویژه در رده‌های سرطانی به طور معنی­داری کاهش یافت و همچنین بیان ژن ADA در غلظت 200 میکروگرم در میلی لیتر عصاره در رده­های MCF-7 و MDA-MB-231 به ترتیب به میزان 4 و 8/4 برابر کاهش پیدا کرد. نتایج بیانگر آن است که عصاره این گیاه با کاهش بیان ژن ADA سبب کاهش درصد زنده­مانی سلولهای سرطانی پستان شده است.

واژه­های کلیدی: سرطان پستان، شیرین­بیان، آدنوزین دآمیناز، کشت سلول

* نویسنده مسئول، تلفن: 055166133905 ، پست الکترونیکی: [email protected]

مقدمه

 

سرطان پستان، بیشترین سرطان تشخیص داده شده و دومین عامل مرگ ناشی از سرطان در میان زنان است  (19). بر اساس گزارش وزارت بهداشت ایران، سرطان پستان با 25/28 درصد ابتلا، شایع­ترین سرطان در میان زنان ایرانی است و میانگین سنی سرطان پستان در ایران 10 تا 15 سال پایین­تر از کشورهای توسعه یافته و میانگین سنی جهان است (12). نتایج مطالعات متعدد نشان می­دهد که میانگین سنی بیماران مبتلا به سرطان پستان 40 تا 50 سال است (19). حدود 23 درصد سرطانهای پستان در ایران در سن کمتر از 40 سالگی اتفاق می­افتد و 70 درصد آنها در مراحل پیشرفته بیماری تشخیص داده شده است (13). این در حالی است که تشخیص زود هنگام این بیماری به ویژه در مراحل اول در کاهش مرگ و میر بسیار اهمیت دارد (10). به دلیل تغییر در فعالیت آنزیمهای توموری و به منظور شناسایی سریع تر سرطان پستان ، مطالعات متعددی بر فعالیتهای آنزیمی متمرکز شده است. در این بین آنزیمهای درگیر در متابولیسم پورینها، به طور خاص آنزیم آدنوزین دآمیناز (EC 3.5.4.4)  مورد مناسب به شمار می­رود (3 و 4).

آنزیم آدنوزین دآمیناز در متابولیسم پورینها شرکت دارد و واکنش هیدرولیز آدنوزین به اینوزین را کاتالیز می­کند (17). این آنزیم در توسعه و نگهداری سیستم ایمنی بدن نقش اساسی دارد، به علاوه آنزیم آدنوزین دآمیناز نقش اساسی در تکثیر و بلوغ سلولهای پستانداران دارد و آنزیمی کلیدی در متابولیسمهای هسته‌ای به شمار می‌رود. به دلیل اینکه واکنش کاتالیز شده توسط این آنزیم یک طرفه و غیر قابل بازگشت می­باشد، آدنوزین دآمیناز، آنزیم کلیدی در تجزیه آدنوزین می‌باشد. ژن آدنوزین دآمیناز بر روی بازوی بزرگ کروموزوم 20 و در موقعیت 1312 قرار دارد (20q13.12). طول توالی این ژن 32168 جفت باز و تعداد اگزونهای آن 12 عدد می‌باشد. جهشهای مختلفی برای این ژن شرح داده شده است که با بیماریهای انسان در ارتباط است. کمبود در این آنزیم باعث یک بیماری نقص ایمنی ترکیبی شدید (SCID) می‌شود که در آن اختلال عملکرد هر دو لنفوسیتهای B و T همراه با اختلال ایمنی سلولی و کاهش تولید ایمونوگلوبولین دیده می‌شود، در حالی که سطوح بالای این آنزیم با کم خونی همولیتیک مادرزادی همراه است‌. گزارشهای متعدد حاکی از این است که در سلولهای سرطان پستان فعالیت این آنزیم افزایش می‌یابد (22). بنابراین، کاهش بیان ژن ADA و فعالیت آنزیم مربوطه می­تواند یک استراتژی مناسب برای درمان سرطان پستان باشد (1).

گیاه شیرین­بیان (Glycyrrhiza glabra L.) گیاهی مدیترانه­ای بوده و از جنوب اروپا تا آسیای مرکزی میان دو عرض جغرافیایی 30 تا 45 درجه نیمکره شمالی رویش دارد. در ایران نیز تقریباً در تمام شمال، شرق، غرب و مرکز کشور به وفور یافت می­شود. این گیاه چند ساله، از طایفه Astragaleae، زیر تیره Papilionacea و تیره Fabaceae می­باشد (7). ریشه شیرین­بیان دارای ترکیبات متعددی نظیر قندهای مختلف (تا 18 درصد)، فلاوونوئیدها، استرولها، اسیدهای آمینه، صمغ و نشاسته، اسانسهای روغنی و ساپونینها می­باشد (21). از شیرین بیان در طب سنتی آسیا و اروپا برای درمان گاستریت، عفونتهای تنفسی، زخمهای پپتیک، هپاتیت، رشد تومور و بیماریهای قلبی استفاده می­شود. در طب سنتی ایران نیز گیاه شیرین بیان به عنوان درمان ورم معده و ضدسرفه استفاده می­شده است (11). امروزه نیز عصاره شیرین­بیان یکی از اجزای ترکیبی شربت سرفه به شمار می­رود. همچنین به عنوان داروی مسکن در التهابهای پوستی و برای درمان اسپاسم، تورم و روماتیسم کاربرد دارد. خواص ضدسرطانی نیز برای این گیاه گزارش شده است (20). برخی از ترکیبات این گیاه اثرات ضدسرطانی و برخی اثرات مهار آنزیمها را بر عهده دارند.  وجود ترکیبات کاهش دهنده چربی و فلاونوئیدها با فعالیت آنتی­اکسیدان قوی در این گیاه گزارش شده است. اثرات سمیت سلولی عصاره شیرین­بیان نیز بررسی شده است (18).

با توجه به ضرورت استفاده از داروهای با منشاء طبیعی، هدف تحقیق پیش­رو  ارزیابی اثر عصاره گیاه شیرین­بیان بر میزان بیان ژن ADA و تکثیر سلولی در سلولهای سرطانی پستان و مقایسه آن با سلولهای سالم است.

مواد و روشها

تهیه مواد: مواد شیمیایی مورد استفاده از شرکتهای (Sigma) USA و (Germany) Merk تهیه گردید. مواد و آنزیمهای کاربردی در بیولوژی مولکولی از سینا ژن (ایران) و (USA) ABI، همچنین کیتها و مواد مورد استفاده در RT-PCR از شرکت فرمنتاز(fermentas) تهیه شد.

کشت سلول: در این طرح از رده­های سلولی سرطان پستان MCF-7 و MDA-MB-231 و رده سلولی نرمال MCF-10A استفاده شد. سلولهای MCF-7 از آزمایشگاه کشت سلول دانشکده علوم دانشگاه فردوسی تهیه شد و دو رده دیگر از بانک سلولی انستیتو پاستور ایران (تهران) خریداری شدند. سلولها در پلیتهای 25 سانتیمتر مکعب در انکوباتور CO2 5 درصد و دمای 37 درجه سانتی­گراد و رطوبت 95 درصد در محیط کشت DMEM به علاوه 10 درصد FBS کشت داده شدند.

تهیه عصاره آبی: برای تهیه عصاره آبی 50 گرم ریشه گیاه شیرین­بیان در محفظه دستگاه سوکسله قرار داده شد. عصاره گیری به مدت 4 ساعت ادامه یافت و پس از تبخیر کردن آب به وسیله دستگاه روتاری، عصاره پودر شده به فریزر 20- منتقل شد. در این پژوهش از غلظتهای صفر، 10، 20، 50، 100 و 200 میکروگرم در میلی­لیتر عصاره‌ استفاده شد. جهت تهیه این غلظتها ابتدا یک محلول اصلی 100 میلی­گرم در میلی­لیتر از عصاره خشک حل شده در DMSO 1 درصد تهیه و برای ساخت سایر غلظتها استفاده شد. برای غلظت صفر از آب مقطر دیونیزه استفاده شد.

تست MTT: برای انجام تست MTT پس از شمارش سلولها، 5000 سلول در هر چاهک پلیت 96 خانه کشت شد و پس از پایداری سلولها، تیمار برای 72 ساعت با غلظتهای تهیه شده و کنترلها انجام گردید. سپس رنگ آمیزی با  MTT5 میلی­گرم در میلی­لیتر انجام و جذب نوری با دستگاه ELISA reader در طول موج 545-630 نانومتر اندازه­گیری شد. به منظور تعیین درصد زنده­مانی، میانگین جذبهای نوری سلولهای تیمار شده با عصاره بر میانگین جذب­های نوری محلول معادل DMSO تقسیم و در نهایت عدد حاصل در 100 ضرب شد. به منظور محاسبه IC50 عصاره‌ها از نرم افزار Prism 5.0 استفاده شد.

بررسی میزان بیان ژن ADA: به منظور بررسی بیان ژن مورد مطالعه، تیمار برای 48 ساعت با غلظتهای تهیه شده از عصاره آبی شیرین­بیان برای سلولهای هر 3 رده سلولی با 3 تکرار انجام گردید. برای طراحی آغازگرهای ویژه ژن آدنین دآمیناز (ADA) و بتا اکتین (ACTB) از توالی مربوط به mRNA ‌این ژنها که در پایگاه اطلاعاتی NCBI به ترتیب با شماره دسترسی NM_000022.2 و NM_001101.3  موجود است، استفاده گردید (جدول 1).

 

جدول 1- خصوصیات پرایمرهای طراحی شده برای ژن­های ADA و ACTB

طول قطعه تکثیر شده

دمای ذوب (ºC)

طول نوکلئوتیدی

توالی 5´ - 3´

نام آغازگر

100

61

22

ACCAGGCTAACTACTCGCTCAA

ADA-FW

61

22

TCAGTAAAGCCCATGTCCCGTT

ADA-RV

154

60

20

TCCATCATGAAGTGTGACGT

ACT-FW

60

22

GAGCAATGATCTTGATCTTCAT

ACT-RV

 

 

مقایسه نسبی بیان ژن‌  ADA با استفاده از روش Real Time SYBER Green PCR با استفاده از دستگاه ABI Step-One (Applied Biosystems)  صورت گرفت. cDNA ساخته شده به عنوان الگو برای واکنشهای qRT – PCR تحت شرایط دمایی 95 درجه سانتی­گراد برای 10 دقیقه در واسرشته سازی اولیه و سپس در 40 چرخه، 15 ثانیه القای دمای 95 درجه سانتی­گراد برای واسرشته سازی و پس از آن 60 ثانیه القای دمای 60 درجه سانتی­گراد برای اتصال پرایمر و طویل شدن با پرایمرهای اختصاصی طراحی شده برای ژنها در نظر گرفته شد و ژن بتا اکتین هم به عنوان کنترل داخلی استفاده شد.

برای تجزیه واریانس داده‌های مربوط به اثرات سمیت سلولی از نرم‌افزار SAS استفاده شد. اعداد سیکل آستانه مربوط به واکنش qRT – PCR از نرم‌افزار دستگاه Real-time PCR استخراج و پس از محاسبه پارامترهای مربوطه، آنالیزهای آماری توسط نرم‌افزار SAS انجام شد. برای مقایسه میانگینها از آزمون LSD استفاده شد. رسم نمودارها توسط نرم‌افزار Excel انجام گردید.

نتایج

بررسی سمیت سلولی عصاره آبی گیاه شیرین­بیان: نتایج نشان داد که با افزایش غلظت عصاره درصد زنده ماندن سلولها به طور معنی داری کاهش می‌یابد و این کاهش در رده‌های سرطانی بیشتر از رده نرمال است. در مقایسه بین دو رده سرطانی، رده MCF-7 تحت تأثیر بیشتری قرار گرفته است و درصد زنده‌مانی این رده سلولی در همه غلظتها کمتر از رده دیگر است (شکل 1). مقدار IC50  عصاره این گیاه برای رده MCF-7 معادل 03/49 میکروگرم در میلی­لیتر و برای رده MBA-MD-231 معادل 9/66 میکروگرم در میلی­لیتر محاسبه گردید.

 

شکل 1- منحنی تغییرات اثر غلظتهای مختلف عصاره گیاه شیرین­بیان بر درصد زنده­مانی سه رده سلولی پستان. داده‌ها میانگین 3 بار تکرار درصد زنده ماندن سلولها در هر غلظت به همراه انحراف معیار می‌باشد.

 

میزان بیان نسبی ژن ADA تحت تأثیر عصاره آبی گیاه شیرین­بیان: مقایسه میانگین تغییرات بیان ژن ADA در سه رده سلولی تیمار شده با غلظتهای مختلف عصاره گیاه شیرین­بیان نشانگر کاهش بیان ژن با افزایش غلظت عصاره‌ها نسبت به شاهد است. همچنین در هر یک از غلظتهای عصاره گیاه شیرین­بیان کمترین کاهش بیان ژن مربوط به رده نرمال و بیشترین کاهش مربوط به رده MDA-MB-231 است. به جز غلظت 200 میکروگرم در میلی­لیتر در سایر غلظتها تفاوت معنی داری بین دو رده MDA-MB-231 و MCF-7 وجود ندارد. بیشترین کاهش بیان ژن ADA تحت تأثیر غلظت 200 میکروگرم در میلی­لیتر عصاره گیاه شیرین بیان در رده سلولی MDA-MB-231 به میزان 8/4 برابر رخ داده است (شکل 2).

شکل 2- مقایسه تغییرات بیان ژن ADA  در سه رده سلولی تیمار شده با غلظتهای مختلف عصاره گیاه شیرین­بیان. داده‌ها میانگین 3 بار تکرار در هر غلظت به همراه انحراف معیار می‌باشد.

 

بحث

نتایج حاکی از آن است که عصاره گیاه شیرین­بیان بر رده­های سرطانی و غیرسرطانی در محدوده غلظتی به کار رفته دارای اثر سمیت سلولی است، منتهی میزان سمیت سلولی آن بر سلولهای سرطانی MCF-7 از همه بیشتر و بر سلولهای غیرسرطانی MCF-10A از همه کمتر بود. مشخص شد که پس از قرارگیری سلولهای سرطانی و غیرسرطانی در مجاورت عصاره یک رابطه خطی نزولی میان غلظت عصاره با درصد زنده ماندن سلولها ایجاد می‌شود. البته در سلولهای سرطانی یک کاهش قابل توجه در درصد زنده ماندن سلولها از غلظت 50 به 100 میکروگرم در میلی­لیتر و در رده نرمال از غلظت 100 به 200 میکروگرم در میلی­لیتر مشاهده می‌شود. این نتیجه را شاید بتوان به این دلیل دانست که غلظتهای خیلی کم عصاره آن قدر کافی نیست که بتواند با اثر بر تعداد قابل ملاحظه‌ای سلول باعث مرگ و میر فراوانی در آنها شود.

شیرین­بیان گیاه کاملاً شناخته شده‌ای است که در صنایع غذایی به عنوان شیرین­کننده و ادویه کاربرد داشته و در صنایع دارویی نیز استفاده‌های متعدد دارد. از این گیاه یک گلیکوزید تری­ترپن به نام گلیسریزین به دست می‌آید که شیرین بوده و در بعضی کشورها مانند ژاپن جایگزین قند استفاده می‌شود. اما گروه دیگری از ترکیبات که در ریشه این گیاه حضور دارند، ترکیبات فنلی ­ـ ­فلاونوئیدی هستند که مطالعات متعددی در زمینه خواص ضدالتهابی، ضدمیکروبی، آنتی‌اکسیدانی، سمیت سلولی و ضدسرطانی آنها انجام شده است (9 و 22)، که می­توان به مطالعهZheng  و همکاران (2014) اشاره کرد که تأثیر فلاونوئید ایزولیکوریتیژنین (ISL) را بر سلولهای سرطانی پستان رده MDA-MB-231 مطالعه کردند و نتایج مشخص کرد این ترکیب با کاهش بیان ژنهای COX-2  و CYP4A سبب مهار رشد سلول­های سرطانی می‌شود (23) و همچنین در پژوهشی دیگر اثر فلاونوئید Glabridin بر سلولهای رده MDA-MB-231 مطالعه شد و مشخص گردید که تا غلظت 10 میکرومولار این ترکیب اثر سمی بر سلولهای سرطانی ندارد اما بر روند جابه­جایی و تهاجم این سلولها تأثیر گذار است (8). به علاوه در مطالعه­ای اثر سمیت سلولی عصاره این گیاه بر رده سرطانی پستان T47D  بررسی و IC50 معادل 75/0 میلی گرم در میلی لیتر گزارش شد (16). بنابر نتایج این پژوهش و مطالعات ذکر شده در بالا می‌توان چنین استنباط کرد که ریشه گیاه شیرین­بیان پتانسیل استفاده در تولید داروهای ضدسرطانی را دارا بوده و البته شناسایی ترکیبات مؤثر عصاره این گیاه و تعیین غلظت مناسب این ترکیبات جهت خاصیت ضد سرطانی در مطالعات تکمیلی ضروری می‌باشد.

آدنوزین دآمیناز آنزیمی است که دآمینه شدن هیدرولیتیک آدنوزین به اینوزین را کاتالیز می‌کند. آدنوزین مولکول سیگنال مهمی است که در واکنشهای ضدالتهابی در بافتهای سرطانی و مهار رشد سلولهای سرطانی نقش دارد. گزارشاتی مبنی بر افزایش فعالیت این آنزیم در بافت سرطانی پستان وجود دارد (2)؛ بنابراین مهار فعالیت این آنزیم یا کاهش سطح بیان ژن آن یکی از اهداف مطالعات ضدسرطان می­تواند باشد. به این منظور مطالعات متعددی با استفاده از ترکیبات یا عصاره­های گیاهی انجام شده است از جمله Erguder و همکاران (2008)  عصاره آبی چای سبز را بر فعالیت آنزیم آدنوزین دآمیناز در بافتهای سرطانی و غیرسرطانی روده بزرگ و معده بررسی کردند و نتایج حاکی از کاهش فعالیت این آنزیم در بافتهای سرطانی بود (6). به علاوه در مطالعه‌ای دیگر اثر عصاره انگور سیاه بر بافت سرطانی و نرمال روده بزرگ مطالعه شد و نتایج بیانگر کاهش فعالیت آنزیم آدنوزین دآمیناز در بافتهای سرطانی نسبت به بافت نرمال بود (5) و در تحقیقی دیگر بافتهای نمونه برداری شده از افراد مبتلا به سرطان معده و روده بزرگ تحت تأثیر غلظتهای مختلف عصاره آبی گیاهان سویا، دارواش و شبدر به مدت یک ساعت قرار گرفتند. نتایج سنجش فعالیت آنزیم آدنوزین دآمیناز حاکی از کاهش معنی دار فعالیت این آنزیم در مقایسه با نمونه­های تیمار نشده بود (15) و همچنین در پژوهشی متفاوت، افزودن عصاره میوه توتهای مختلف به مدت یک هفته به رژیم غذایی موشهای مبتلا به سرطان روده بزرگ منجر به کاهش تعداد و اندازه تومورها شد. همچنین اندازه­گیری بیان ژنهای درگیر در ایجاد سرطان روده بزرگ از جمله ژن ADA نشان از کاهش بیان آنها داشت (14).

با توجه به سوابق مطالعاتی و اهمیت شناخت مکانیسمهای ضدسرطانی عصاره‌های گیاهی در پژوهش حاضر اثر عصاره گیاه شیرین­بیان بر بیان ژن ADA در رده‌های سلولی سرطان پستان بررسی شد. عصاره این گیاه به ویژه در محدوده غلظتی IC50 میزان بیان این ژن را  در دو رده سرطانی (MCF-7 و MDA-MB-231)  نسبت به رده غیرسرطانی (MCF-10A) کاهش داد. در توجیه اثرات عصاره­های گیاهی بر فعالیت آنزیم آدنوزین دآمیناز که موضوع پژوهشهای متعددی بوده است و اینجا نیز به مواردی از آنها اشاره شد، اطلاعات کافی در دسترس نبوده و بسیاری از محققین تنها به گزارش نتایج اکتفا کرده‌اند؛ لذا مطالعات بیشتر و تمرکز بر روندها و مسیرهای پیام رسانی درون سلولی لازم است. در مورد نتایج این تحقیق و تأثیر عصاره­ها بر بیان ژنADA  نیز اگر چه به مکانیسم شناخته شده‌ای به وضوح نمی­توان اشاره داشت، اما احتمالاً روند تأثیرگذاری از طریق ترکیبات فعال موجود در عصاره و اثر بر مسیرهای پیام رسانی و نهایتاً بر فاکتورهای رونویسی خواهد بود.

نتیجه گیری

در این تحقیق اثر عصاره گیاه شیرین­بیان بر درصد زنده‌ماندن سلولی و بیان ژن ADA درگیر در سرطان در دو رده سلولی سرطانی و یک رده نرمال بررسی شد. نتایج بیانگر اثر سمیت سلولی عصاره این گیاه بر سلولهای سرطانی بود. همچنین بیان ژن ADA در سلولهای سرطانی تحت تیمار عصاره کاهش یافت. اگر چه در مطالعات مختلف دلایل زیادی همچون مهار چرخه سلولی، وقوع آپاپتوز و.... را برای توجیه اثر سمیت سلولی عصاره‌ها یا ترکیبات گیاهی ذکر کرده‌اند اما در تحقیق حاضر به دلیل همبستگی مثبت و معنی دار بین درصد زنده ماندن سلولها و بیان ژن ADA می‌توان احتمال داد که عصاره این گیاه با کاهش بیان این ژن که نقش اساسی در شکل گیری سرطان و تداوم آن دارد، سبب سمیت سلولی می‌گردد.

  • Afshar AS, Nematpour FS, Meshkani M, Khafi A. 2017. Growth inhibition of human breast cancer cells and down-regulation of ODC1 and ADA genes by Nepeta binaloudensis. Revista Brasileira de Farmacognosia 27:84-90
  • Aghaei M, Karami-Tehrani F, Salami S, Atri M. 2005. Adenosine deaminase activity in the serum and malignant tumors of breast cancer: the assessment of isoenzyme ADA1 and ADA2 activities. Clinical biochemistry 38:887-91
  • Borzenko B. 1991. Use of the study of DNA metabolism enzyme activities as a test system in the treatment of breast cancer. Sovetskaia meditsina:14-7
  • Borzenko B, Gorbachev A, Dumanskiĭ I, Shevchenko V, Shepliakov M. 1990. Activity of the enzymes of DNA metabolism in the blood of patients with breast cancer. Voprosy onkologii 36:17-23
  • Durak İ, Çetin R, Devrim E, Ergüder İB. 2005. Effects of black grape extract on activities of DNA turn-over enzymes in cancerous and non cancerous human colon tissues. Life sciences 76:2995-3000
  • Erguder IB, Namuslu M, Sozener U, Devrím E, Avci A, et al. 2008. Effects of Aqueous Green Tea Extract on Activities of DNA Turn-over Enzymes in Cancerous and Noncancerous Human Gastric and Colon Tissues. Alternative therapies in health and medicine 14:30-5
  • Ghayedi N, Bahaoddini A, Khoshnam SE, Gholampour F, Khosravi AR, Moein MR. 2016. Evaluation the effect of hydro-alcoholic extract of GlycyrrhizaGlabra rhizome on the isolated colon contractions of male rats. SSU_Journals 24:576-86
  • Hsu YL, Wu LY, Hou MF, Tsai EM, Lee JN, et al. 2011. Glabridin, an isoflavan from licorice root, inhibits migration, invasion and angiogenesis of MDA‐MB‐231 human breast adenocarcinoma cells by inhibiting focal adhesion kinase/Rho signaling pathway. Molecular nutrition & food research 55:318-27
  • Kinghorn AD, Chai H-b, Sung CK, Keller WJ. 2011. The classical drug discovery approach to defining bioactive constituents of botanicals. Fitoterapia 82:71-9
  • Kojima R, Okada E, Ukawa S, Mori M, Wakai K, et al. 2017. Dietary patterns and breast cancer risk in a prospective Japanese study. Breast cancer 24:152-60
  • Lorusso V, Marech I. 2013. Novel plant-derived target drugs: a step forward from licorice? : Taylor & Francis
  • Motie MR, Besharat S, Torkjazi R, Shojaa M, Besharat M, et al. 2011. Modifiable risk of breast cancer in northeast iran: hope for the future. a case-control study. Breast Care 6:453-6
  • Mousavi SM, Montazeri A, Mohagheghi MA, Jarrahi AM, Harirchi I, et al. 2007. Breast cancer in Iran: an epidemiological review. The breast journal 13:383-91
  • Mutanen M, Pajari A-M, Päivärinta E, Misikangas M, Rajakangas J, et al. 2008. Berries as chemopreventive dietary constituents-a mechanistic approach with the ApcMin/+ mouse. Asia Pacific journal of clinical nutrition 17:123-5
  • Namuslu M, Kocaoglu H, Celik H, Avci A, Devrim E, et al. 2014. Effects of aqueous soybean, mistletoe and red clover extracts on activities of adenosine deaminase and xanthine oxidase enzyme. Bratislavske lekarske listy 115:367-71
  • Sadat Shandiz S, Salehzadeh A, Ahmadzadeh M, Khalatbari K. 2017. Evaluation of Cytotoxicity Activity and NM23 Gene Expression in T47D Breast Cancer Cell Line Treated with Glycyrrhiza glabra Journal of Genetic Resources 3(1):47-53.
  • Shatova O, Borzenko B, Zinkovich I, Sedakov 2009. Lactate dehydrogenase, adenosine deaminase and thymidine phosphorylase activity of blood and tissues in breast cancer. Ukrains' kyi biokhimichnyi zhurnal (1999) 81:88-93
  • Song NR, Lee E, Byun S, Kim J-E, Mottamal M, et al. 2013. Isoangustone A, a novel licorice compound, inhibits cell proliferation by targeting PI3K, MKK4, and MKK7 in human melanoma. Cancer Prevention Research 6:1293-303
  • Tehranian N, Shobeiri F, Pour FH, Hagizadeh E. 2010. Risk factors for breast cancer in Iranian women aged less than 40 years. Asian Pacific journal of cancer prevention: APJCP 11:1723-5
  • Wang ZY, Nixon DW. 2001. Licorice and cancer. Nutrition and cancer 39:1-11
  • Zhang Q, Ye M. 2009. Chemical analysis of the Chinese herbal medicine Gan-Cao (licorice). Journal of Chromatography A 1216:1954-69
  • Tafrihi M, Nakhaei Sistani R. 2017. E-cadherin/β-catenin Complex; A Target for Anti-cancer and Anti-metastasis Plants/Plant-derived Compounds. Nutrition and Cancer: An International Journal 69(5):702-722. doi: 10.1080/01635581.2017.1320415
  • Zheng H, Li Y, Wang Y, Zhao H, Zhang J, et al. 2014. Downregulation of COX-2 and CYP 4A signaling by isoliquiritigenin inhibits human breast cancer metastasis through preventing anoikis resistance, migration and invasion. Toxicology and applied pharmacology 280:10-20
دوره 34، شماره 2
تیر 1400
صفحه 304-318
  • تاریخ دریافت: 17 فروردین 1398
  • تاریخ بازنگری: 10 تیر 1398
  • تاریخ پذیرش: 04 شهریور 1398
  • تاریخ اولین انتشار: 01 تیر 1400