شناسایی باکتری های پروبیوتیک عصاره آبی خرماهای مضافتی، پیارم و زاهدی

نوع مقاله : مقاله پژوهشی

نویسندگان

1 دانش آموخته دکتری گروه زیست شناسی دانشکده علوم دانشگاه اصفهان

2 پژوهشکده آبزی‌پروری آب‌های داخلی، موسسه تحقیقات علوم شیلاتی کشور، سازمان تحقیقات، آموزش و ترویج کشاورزی، بندرانزلی، ایران

3 هیئت علمی گروه زیست شناسی دانشکده علوم دانشگاه اصفهان

4 دانشیار پژوهشکده آبزی پروری آبهای داخلی، بندرانزلی

چکیده

مقدمه: تاثیر مفید باکتری‌های پروبیوتیک بر سلامت انسان و حیوان به نحو گسترده مورد مطالعه قرار گرفته و در موارد مختلف تایید شده است. برای دستیابی به باکتری‌های پروبیوتیک باسیلوس و اسیدلاکتیک خرما به عنوان یکی از مواد غذایی مهم که می‌توانند منبع جداسازی این باکتری‌ها باشند، بررسی شد. هدف: این مطالعه با هدف جداسازی باکتری‌های پروبیوتیک اسید لاکتیک و باسیلوس از عصاره آبی خرماهای مضافتی، پیارم و زاهدی انجام شد. روش کار: برای جداسازی باکتری های اسید لاکتیک و باسیلوس، عصاره روی محیط MRS آگار و نوترینت آگار کشت داده شد. پس از ۵ روز انکوباسیون در دمای ۳۷ درجه سلسیوس در شرایط بی‌هوازی و هوازی کلنی‌های دارای خصوصیات مرفولوژی و شکل میکرسکپی مرتبط دارای باکتری‌های گرم مثبت کاتالاز منفی جدا شده از MRS آگار در شرایط بی‌هوازی و و کاتالاز مثیت جدا شده از نوترینت آگا در شرایط هوازی با روش‌های بیوشیمیایی و Polymerase chain reaction بررسی شدند. نتایج: با توجه به آزمایشات شیمیایی و مولکولی باکتری‌های جدا شده از عصاره خرمای مضافتی به Lecunostoc mesenteroeides subsp mesenteroeides، پیارم بهBacilus subtilis strain UD1022 و زاهدی به Pediococcus parvalus strainSC8B متعلق بود. هر سه باکتری پروبیوتیک بودند. بحث و نتیجه گیری: با توجه به نتایج آزمایشات خرما در مجموعه غذاهای پروبیوتیک قرار دارد. می توان عصاره آبی خرما را برای غنی سازی و تهیه مواد غذایی پروبیوتیک به کار برد. همچنین با توجه به ویژگی‌های باکتری‌های پروبیوتیک می‌توان عصاره آبی خرما یا گوشت خرما برای جلوگیری از جایگزینی باکتری‌های بیماری‌زا و بیماری برای مصرف کنندگان توصیه کرد.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Identification of probiotic bacteria in aqueous extract from Mazafatit, Piarom and Zahedi

نویسندگان [English]

  • mina seifzadeh 1 2
  • mohammad rabbani 3
  • aliasghar khanipour 4

1 Dept. of Biology, Faculty of Science, University of Isfahan , Isfahan, I.R. of Iran

2 Dept. of Biology, Faculty of Science, University of Isfahan , Isfahan, I.R. of Iran

3 Associate Prof, Dept. of Biology, Science Faculty, University of Isfahan. I.R. of Iran

4 Associate Prof, Inland Water Aquaculture Research center, Anzali, I.R. of Iran

چکیده [English]

Agricultural Research Education and Extension Organization (AREEO), Bandar Anzali, Iran
Introduction: The beneficial effects of probiotic bacteria on human and animal health has been widely studied and confirmed in various cases. To obtain probiotic bacteria, Bacillus and lactic acid bacteria, dates were considered as one of the important nutrients that could be the source of isolation of these bacteria. Aim: The aim of this study was to isolate probiotic bacteria of lactic acid bacteria and Bacillus from aqueous extract of Mazafati, Pourm and Zahedi. Methods: For isolation of lactic acid bacteria and Bacillus, the extract was grown on MRS agar and agar nutrient. After 5 days of incubation at 37 ° C under aerobic and anaerobic conditions, colonies isolated with morphological characteristics and microscopic form associated including positive gram bacteria. positive and negative catalase bacteria isolated from MRS agar and nutrient agar, respectively. These bacteria were evaluated using biochemical and polymerase chain reactions. Results: According to chemical and molecular tests, Lecunostoc mesenteroeides subsp mesenteroeides, Bacillus subtilis strain UD1022 and Pediococcus parvalus strainSC8B isolated from Mazafati, Piarom and Zahedi date extract . All three bacteria were probiotic. Discussion and Conclusion: According to the results of the experiments, dates are in the probiotic collection. Aqueous extract of dates can be used to enrichment and preparing of probiotic foods. Also, according to the characteristics of probiotic bacteria, aqueous extract of dates or dates may be recommended to prevent of pathogenic bacteria replacement and disease for consumers.

کلیدواژه‌ها [English]

  • 16srRNA
  • Date fruit
  • Lactic acid bacteria
  • Bacilus subtilis

شناسایی باکتریهای پروبیوتیک عصاره آبی خرماهای مضافتی، پیارم و زاهدی

مینا سیف زاده1،2، محمد ربانی1* و علی اصغر خانی پور2

1 اصفهان، دانشگاه اصفهان، دانشکده علوم، گروه زیست شناسی

2 ایران، انزلی، سازمان تحقیقات، آموزش و ترویج کشاورزی، موسسه تحقیقات علوم شیلاتی کشور، پژوهشکده آبزی پروری آبهای داخلی، مرکز ملی تحقیقات فرآوری آبزیان

تاریخ دریافت: 22/10/1398            تاریخ پذیرش: 5/11/1398

چکیده

تأثیر مفید باکتریهای پروبیوتیک بر سلامت انسان و حیوان به نحو گسترده موردمطالعه قرارگرفته و در موارد مختلف تأیید شده است. برای دستیابی باکتریهای پروبیوتیک باسیلوس و اسیدلاکتیک خرما به عنوان یکی از مواد غذایی مهم که می­تواند منبع جداسازی این باکتریها باشد، بررسی شد. این مطالعه باهدف جداسازی باکتریهای پروبیوتیک اسیدلاکتیک و باسیلوس از عصاره آبی خرماهای مضافتی، پیارم و زاهدی انجام شد. برای جداسازی باکتریهای اسیدلاکتیک و باسیلوس، عصاره روی محیط MRS  آگار و نوترینت آگار کشت داده شد. پس از ۵ روز انکوباسیون در دمای ۳۷ درجه سلسیوس در شرایط بی­هوازی و هوازی کلونیهای دارای خصوصیات مرفولوژی و شکل میکروسکوپی مرتبط دارای باکتریهای گرم مثبت کاتالاز منفی جداشده از  MRS آگار در شرایط بی­هوازی و کاتالاز مثبت جداشده از نوترینت آگا در شرایط هوازی با روشهای بیوشیمیایی و Polymerase chain reaction بررسی شدند. نتایج: با توجه به آزمایشات شیمیایی و مولکولی باکتریهای جداشده از عصاره خرمای مضافتی به   Lecunostoc mesenteroeides  subsp mesenteroeides، پیارم بهBacilus subtilis strain UD1022  و زاهدی به Pediococcus parvalus strainSC8B متعلق  بود. هر سه باکتری پروبیوتیک بودند. با توجه به نتایج آزمایشات خرما در مجموعه غذاهای پروبیوتیک قرار دارد. می‌توان عصاره آبی خرما را برای غنی‌سازی و تهیه مواد غذایی پروبیوتیک به کار برد. همچنین با توجه به ویژگیهای باکتریهای پروبیوتیک می­توان عصاره آبی خرما یا گوشت خرما برای جلوگیری از جایگزینی باکتریهای بیماری­زا و بیماری برای مصرف‌کنندگان توصیه کرد.

واژه های کلیدی: 16srRNA،  میوه خرما، لاکتیک اسید باکتری ، Bacilus subtilis

* نویسنده مسئول، تلفن: 03144560032 ، پست الکترونیکی: [email protected]

مقدمه

 

نخل خرما، Phoenix dactylifera، یکی از مهم­ترین گونه‌های خانواده پالم (Arecaceae) و همچنین یکی از بزرگ‌ترین و قدیمی­ترین درختانی است که توسط انسان کشت می‌شود (2). این درخت حدود 200 جنس و بیش از 2500 گونه دارد (13، 14). این گونه‌های چندساله و دو هسته‌ای، سنگ بنای اقتصاد در بسیاری از کشورهای تولیدکننده، به ویژه در غرب آسیا و شمال آفریقاست. خرما یک منبع غذایی مهم در بسیاری از کشورهاست. میوه خرما، جزء مهمی از رژیم غذایی در اکثر کشورهای عربی با هزینه کم هستند. در حال حاضر میوه خرما برای مصارف محلی، تجارت و صادرات در 37 کشور در سراسر جهان رشد می‌کند. تولید سالیانه خرمای دنیا بیش از 7 میلیون تن در سال است (3) که نشان‌دهنده یک ارزش مبادله ارز با بیش از 1 میلیارد دلار است. ایران با تولید ۱۴ درصد از کل تولید خرمای جهان دومین کشور تولیدکننده خرماست. خرما ازلحاظ بافت، شکل، رنگ، ترکیب شیمیایی، ژنوتیپ، محیط، فصل و اعمال پرورشی تنوع زیادی را نشان می‌دهد . بیش از 600 نوع از خرما بر اساس شکل و خواص حسی وجود دارد. حدود ۴۰۰ گونه خرما در ایران رشد می‌کند (15).

خرمای مضافتی بم از نوع خرمای نرم می‌باشد. این نوع خرما برنگ قهوه‌ای تیره تا سیاه دارای ۲۰-1۶ درصد رطوبت است. (19) مرغوب‌ترین و خوش‌طعم‌ترین نوع خرمای مضافتی در شهرستان بم واقع در جنوب شرقی ایران پرورش می‌یابد. ایران یکی از بزرگ‌ترین تولیدکنندگان خرماست که خرمای مضافتی آن ارزش صادرات بالایی دارد و سالانه مقدار زیادی خرمای مضافتی بم صادر می‌شود (29).

خرمای پیارم مرغوب‌ترین انواع خرمای شناخته‌شده در جهان می‌باشد و شهرستان حاجی‌آباد در استان هرمزگان مرغوب‌ترین خرمای پیارم را در خود پرورش می‌دهد. پوست نازک خرمای پیارم به رنگ قهوه‌ای تیره و با توجه به اینکه گوشت و پوست آن کاملاً‌ به یکدیگر چسبیده‌اند، ظاهری زیبا و مطلوب دارد، درصد رطوبت میوه آن کم است و از ارقام نیمه‌خشک محسوب می‌شود. از میوه‌های دیررس است، کیفیت میوه آن مطلوب و ازنظر صادرات بسیار بازارپسند است (8 و9).

میوه در مرحله خارک زردرنگ، در مرحله رطب قهوه‌ای روشن و در مرحله خرما قهوه‌ای متمایل به قرمز تا زرد کم رنگ می‌شود. خرمای پیارم از انواع بسیار مرغوب بوده و برای نگهداری در انبار و حمل‌ونقل آسان مطلوب می باشد (14). مطالعات نشان داده‌اند که خرما دارای فعالیتهای ضد انعقادی، آنتی‌اکسیدان، ضد میکروبی، ضدالتهابی، ضد اشعه، ضد نفروپاتیک و ضد سرطان است (19).

اگرچه، میوه خرما به مدت چندین قرن به عنوان غذای اصلی به میلیونها نفر خدمت می‌کند. اما طی این مدت مردم سراسر جهان، مطالعات کافی در مورد مزایای تغذیه‌ای، بهداشتی، اجتماعی و اقتصادی آن نداشتند. علاوه بر این به عنوان یک غذای سالم توسط متخصصان بهداشت و عمومی شناخته‌نشده بود (4 و 5).

محصولات خرما شامل آب‌میوه، مربا، ژله، شربت،  قند مایع، عرق، پنیر و طارونه "Tarooneh" است. محصولات تخمیر شده خرما مانند الکل، شراب، اسیدهای آلی، نوشیدنی تخمیر شده و پروتئین تک‌سلولی است محصولات جانبی حاوی  هسته خرما و کیک فشرده را می‌توان در تولید الکل و خوراک دام استفاده کرد. هسته خرما شامل الیاف رژیمی و ترکیبات فنولی است، و می‌توان آن را در تولید غذاهای عمل‌گرا استفاده کرد (7). عصاره خرما یک محصول جانبی از خرما هست که در صنایع غذایی کاربردهای زیادی دارد. عصاره خرما از خرماهای مضافتی، پیارم و زاهدی که دارای مقادیر زیادی فیبر، کربوهیدراتها مانند گلوکز، فروکتوزی، ساکاروز، اسیدهای آمینه و پروتئینهاست استخراج می شود. روش آبی می‌تواند برای تهیه عصاره از خرما بدون داشتن اثرات سمی روی مواد غذایی و مصرف‌کنندگان به کار رود (13).

علی رغم وجود چندین گزارش در مورد ترکیب شیمیایی و ارزش غذایی خرما، بسیاری از مزایای دیگر این میوه هنوز کشف نشده است. تحقیقات فیتوشیمیایی نشان داده است که خرما شامل آنتوسیانینها، فنولها، استرولها، کاروتنوئیدها، پروپی یانیدینها و لوانوئیدها است. فیتوکمیکالهای طبیعی و ترکیبات فنولیک که از انواع متعددی از گیاهان استخراج می‌شود اهمیت زیادی برای افزودن به غذا دارد. که مرتبط به اهمیت آنها برای سلامتی انسان است. همینطور نشان داده‌شده که بیشترین فعالیت آنتی‌اکسیدانی را دارند (10، 21 و 24). علاوه بر این چندین مطالعه فعالیت ضد باکتریایی ترکیبات فنولیک را ثابت کرده است (16، 22 و 24)

بر اساس تحقیقات انجام‌شده توسط محققین مختلف خرما دارای خاصیت ضد میکروبی برعلیه بیماری­زا­های غذایی مانند لیستریا منوسایتوژنژ و استافیلوکوکوس ساپروفیتیکوس هست (23 و۲6). بر این اساس در پژوهش حاضر، حضور باکتریهای اسیدلاکتیک و باسیلوس پروبیوتیک در عصاره خرما موردبررسی قرار گرفت.

مواد و روشها

خرمای مضافتی بم، زاهدی (در مرحله رطب) و پیارم در فصل بهار سال 1397 از بازار خریداری شد. عصاره گیری به روش آبی انجام شد. برای عصاره گیری   ۱۰۰ گرم خرما در ۲۰۰ میلی‌لیتر آب مقطر به مدت ۷۲ ساعت در تاریکی و دمای یخچال غوطه‌ور شد. سپس با یک میکسر کاملاً مخلوط شد. و با صافی شماره ۱ از جنس کاغذ معمولی و قطر منافذ 90 میلی‌متر فیلتر شد. مخلوط در دمای ۴ درجه سلسیوس به مدت ۱۵ دقیقه و ۳۰۰۰ rpm سانتریفیوژ شد. مایع رویی برای تهیه عصاره استفاده شد (20) . عصاره تا زمان استفاده در یخچال ذخیره گردید. سپس عصاره روی محیط کشت ((MRS De Man, Rogosa and Sharpe agar و نوترینت آگار به روش سطحی کشت داده شد. پلیتهای کشت داده‌شده به مدت ۵ روز در جار بی‌هوازی و همچنین در شرایط هوازی در دمای ۳۷ درجه سلسیوس قرار گرفتند. کلونیهای مرتبط دارای باکتریهای گرم مثبت کاتالاز منفی و دارای هاله شفاف در اطراف روی محیط MRS آمار و کلونیهای مرتبط دارای باکتریهای گرم مثبت و کاتالاز مثبت در محیط نوترینت آمار به روش بیوشیمیایی و مولکولی موردبررسی قرار گرفتند.

باکتریهای جداشده از عصاره مضافتی و زاهدی روی محیط MRS آگار و باکتریهای جداشده از عصاره پیارم روی نوترینت آگار رشد کردند. باکتریهای رشد کرده روی محیط نوترینت اگار و MRS آگار با استفاده از محیطهای TSI، SIM و سیمون سیترات برای تشخیص جنس به روش بیوشیمیایی مورد بررسی قرار گرفتند. برای شناسایی شیمیایی باکتریهای جداشده از عصاره آبی مضافتی و زاهدی از تست کاتالاز و تخمیر قندهای آرابینوز، سوکروز، گلوکز، سلولوز، سلوبیوز، فروکتوز، گالاکتوز، لاکتوز، مالتوز، مانیتول، مانوز، سوکروز، ترهالوز، گزیلوز، ملیبیوز، رافینوز، ریبوز، سالیسین، آمونیاک از آرژنین، هیدرولیز اسکولین،تولید دکستران و رشد در pH ۸/۴ و اتانول ۱۰ درصد استفاده شد. برای شناسایی بیوشیمیایی باکتریهای جداشده از عصاره خرمای پیارم از تست کاتالاز و تستهای بیوشیمیایی شامل آرابینوز، گلوکز، مانوز، مانیتول، سالیسین، گزیلوز، نشاسته، رشد در پی­اچ ۷ ،۸، ۹ و ۱۰ ، رشد در نمک ۲ و ۱۰ درصد، رشد در دماهای ۵، ۱۰، ۲۰،  ۵۰  و ۶۵  درجه سلسیوس، سیترات و احیای نیترات، تورانوز، توئن ۲۰، توئن ۸۰ ، VPو لاکتوز استفاده شد. از قند ۱ درصد برای شناسایی باکتریها استفاده شد. قندها توسط فیلتر میلی پور با منافذ ۴۵/۰ میکرون استریل شدند (18).

برای شناسایی مولکولی باکتریهای جداشده از عصاره خرمای مضافتی، پیارم و زاهدی از آزمون Polymerase chain reaction با استفاده از پرایمرهای عمومی استفاده شد. برای استخراج DNA از کشت ۱۸ ساعته باکتریها در محیط کشت نوترینت آگار و  MRS آگار در دمای ۳۷ درجه سلسیوس استفاده شدند. DNA به روش Boiling استخراج شد(11). برای شناسایی مولکولی این باکتریها از Master mix DNA (Amplicon) استفاده شد. Master mix به نسبت یک برابر رقیق شد. سوسپانسیون PCR در مقادیر ۳۰ میکرولیتری تهیه شد. بدین ترتیب که  ۱۵ میکرولیتر ازMaster با ۵ میکرولیتر DNA، ۱ میکرولیتر پرایمر Reverse (DG74)، ۱ میکرولیتر پرایمر  Forward  (RW01) و ۸ میکرولیتر آب تزریقی استریل مخلوط شد. برنامه PCR برای شناسایی باکتریهای جداشده از خرما شامل دناتوراسیون اولیه به تعداد یک سیکل در دمای ۹۵ درجه سلسیوس به مدت ۵ دقیقه، Denaturation در دمای ۹۴ درجه سلسیوس به مدت ۴۵ ثانیه، Annealing در دمای ۵۴ درجه سلسیوس به مدت ۳۰ ثانیه و extension در دمای ۷۲ درجه سلسیوس به مدت ۴۵ ثانیه به تعداد ۳۰ سیکل و extension نهایی در دمای ۷۲ درجه سلسیوس به مدت ۵ دقیقه بود. محصولات  PCR (۳۷۰ جفت باز طول) توسط  توالی یابی سانگر (سوئد) تعیین توالی شدند. از پرایمرهای یونیورسال RW01
(5'AACTGGAGGAAGGTGGGGAT 3') به عنوان forward و DG74 به عنوان reverse
(5' AGGAGGTGATCCAACCGCA 3') استفاده شد (12، 27).

از ترکیب Master mix DNA بانضمام پرایمر­های forward و Reverse در مقادیر استفاده‌شده برای باکتریهای جداشده از عصاره‌های موردمطالعه به عنوان کنترل منفی استفاده شد. از باکتریهای (IBRC10793) Leuconostoc mesenteroides subsp. Mesenteroides ، subsp subtilis(IRRC10997) Bacillus subtilis  وsp (IBRC11045)  Pediococcus به عنوان کنترل مثبت استفاده شد. در این تحقیق برای بررسی خاصیت پروبیوتیکی باکتریهای جداشده از عصاره خرما از آزمایشات هیدرولیز آرژنین، همولیز ۷ درصد خون گوسفند، صفرای ۳/۰ درصد، توانایی رشد در pH ۴ و ۵/۲ به مدت ۳ و ۴ ساعت، دیسک آنتی‌بیوتیک شامل دیسکهای جنتامایسین(۱۰ میکروگرم)، سفالوتین (۳۰ میکروگرم)، پنی‌سیلین (۱۰ میکروگرم)، آموکسی­سیلین(۲۵ میکروگرم)، تتراسایکلین(۳۰ میکروگرم)، آزیترومایسین(۱۵ میکروگرم)، ونکومایسین (۳۰ میکروگرم)، استریتومایسین(۱۰ میکروگرم)، اریترومایسین(۱۵ میکروگرم)،کشت سلول برای تعیین تهاجم و چسبندگی برده سلولی و توانایی رشد در حضور پپسین و تریپسین بر اساس استاندارد ملی ایران استفاده شد (1). 

چسبندگی میکروبی با روش  Nithya و  Halami در سال ۲۰۱۳ انجام شد(21). تهاجم برده سلولی بوسیله روش Rowan و همکاران در سال ۲۰۰۱ انجام شد(25).

نتایج

باکتریهای تلقیح شده از محیط نوترینت آگار به محیط TSI آلکالن/ اسید،  غیر متحرک و قادر به تخمیر سیمون سیترات بودند.

باکتریهای جداشده از عصاره مضافتی  اسید/ اسید، غیرمتحرک و قادر به تخمیر سیمون سیترات بودند.

باکتریهای جداشده از عصاره زاهدی آلکالن / اسید، غیرمتحرک و قادر به تخمیر سیمون سیترات نبودند.

 مشخصات مرفولوژی کلونیهای دارای حاشیه سفیدرنگ، کاتالاز و حرکت منفی (عصاره خرماهای مضافتی و زاهدی) و کاتالاز مثبت (عصاره خرمای پیارم) در جدول ۱ آورده شده است.

 

جدول ۱ - نتایج بررسی مرفولوژی کلونیهای جداشده از عصاره خرماهای مضافتی، پیارم و زاهدی

خرما

رنگ کلنی

قطر کلنی (mm)

شکل کلنی

رنگ گرم

اسپور

موقعیت اسپور

شکل اسپور

گونه شناسایی‌شده

مضافنی

سفید

۲-۳

کوکوئید

+

ـ

ـ

-

Leuconostoc mesenteroides subsp. Mesenteroides strain UFLANFC 747

پیارم

سفید

۲-۳

باسیل

+

+

میانی تزدیک بانتها

بیضوی

Bacillus subtilis strain UD1022

زاهدی

سفید

۲-۳

کوکوئید

+

ـ

ـ

-

Pediococcus parvalus strain SC8B

 

 

نتایج تستهای بیوشیمیایی کلونیهای جداشده از عصاره خرماهای مضافتی و زاهدی که ازنظر مشخصات مرفولوژی کلنی بر اساس جدول ۱ هستند در جدول 2 ارائه شده است.

جدول ۲- نتایج تستهای بیوشیمیایی باکتریهای جداشده از عصاره خرماهای مضافتی و زاهدی

زاهدی

مضافتی

خرما

آزمایش

-

-

+

+

+

+

آرابینوز

سوکروز

گلوکز

تعیین نشده

+

سلولوز

تعیین نشده

+

سلوبیوز

تعیین نشده

+

فروکتوز

+

+

گالاکتوز

-

+

لاکتوز

+

+

مالتوز

_

+

گزیلوز

تعیین نشده

+

ترهالوز

تعیین نشده

_

آمونیاک از آزژنین

تعیین نشده

+

تولید دکستران

تعیین نشده

+

هیدرولیز اسکولین

تعیین نشده

_

رشد در پی­اچ 8/4

تعیین نشده

_

رشد در اتانل 10 درصد

تعیین نشده

+

رشد در دمای 37 درجه سلسیوس

-

تعیین نشده

ملیزیتوز

-

تعیین نشده

ریبوز

 

نتایج تستهای بیوشیمیایی باکتریهای جداشده از عصاره خرمای پیارم: باکتریهای جداشده از عصاره خرمای پیارم تورانوز، توئن20، توئن 80 ،  آرابینوز، گلیکوژن، گلوکز، مانوز، مانیتول، سالیسین، گزیلوز، نشاسته، پی اچ ۷، ۸ و ۱۰، سیترات، احیاء نیترات، رشد در نمک ۲ و ۱۰ درصد، رشد در دمای۲۰ و ۵۰ درجه سلسیوس، رشد در شرایط هوازی ، کاتالاز و VP مثبت بودند. این باکتریها پی­اچ  ۸ و ۱۰ ، دمای ۵، ۱۰ و ۶۵ درجه سلسیوس، لاکتوز، حرکت و رشد در شرایط بی‌هوازی منفی بودند.

آزمایشات مولکولی: نتایج تعیین توالی محصولات PCR باکتریهای ایزوله شده از خرماهای مضافتی، پیارم و زاهدی با نرم‌افزار Bioedit آنالیز شدند. سپس  توالی Fasta با استفاده از Clustal-X مرتب شد. سپس نتایج به دست آمده از PCR باکتریهای ایزوله شده از خرماهای مضافتی، پیارم و زاهدی برای تعیین همولوژی توالی در بین توالیهای رفرنس منتشرشده از طریق NCBI (NCBI,  http://blast.ncbi.nlm.nih.gov/)  بررسی شدند. همولوژی بیشتر از ۹۹ درصد برای تعیین سوش قابل قبول بود. باکتریهای جداشده از خرماهای مضافتی از  حیث مولکولی با ۱۰۰ درصد مشابهت Identity  و ازنظر آزمایشات بیوشیمیایی متعلق به Leuconostoc mesenteroides subsp. Mesenteroides strain UFLANFC 747 بود.  توالی Fasta محصولات PCR باکتریهای جداشده از خرماهای پیارم بعد از تعیین توالی و  بلاست  با NCBI  از  حیث مولکولی با ۱۰۰ درصد Identity  و ازنظر آزمایشات شیمیایی متعلق بهUD1022  Bacillus subtilis strain  بود. توالی Fasta محصولات PCR باکتریهای جدا شده از خرماهای زاهدی بعد از تعیین توالی و  بلاست  با NCBI  از  حیث مولکولی با ۱۰۰ درصد Identity  و ازنظر آزمایشات شیمیایی متعلق به Pediococcus parvalus strain SC8B بود.

همان‌طوری­که جدول ۳ نشان می‌دهد باکتریهای جداشده از عصاره خرما قادر به رشد در حضور نمکهای صفراوی، شیره معده (پپسین و تریپسین) و اسیدیته پایین بودند. و در هیچ مورد تعداد باکتریها از ۶ ۱۰ × ۱ CFU/g کمتر نبود. همچنین این باکتریها فعالیت همولیز  نداشتند و قادر به هیدرولیز آرژنین نبودند.

همان­طوری­که جدول ۴ نشان می‌دهد مقاومت آنتی‌بیوتیکی در باکتریهای لاکتوباسیلوس موردمطالعه مشاهده نشد.

 

 

             

 

نمودار ۱- ژل PCR عصاره خرماهای مضافتی، پیارم و زاهدی

 

نمودار 2- ژل PCR کنترل منفی و مثبت باکتریهای عصاره خرماهای مضافتی، پیارم و زاهدی

 

بر اساس جدول ۵ Bacillus subtilis strain smppsap2 و Leuconostoc mesenteroides subsp. Mesenteroides strain UFLANFC 747 به ترتیب بیشترین و کمترین تمایل را برای چسبندگی برده سلولی داشت. که در مقایسه
با کنترل پروبیوتیک مثبت و کنترل بیماری‌زای مثبت کاهش معنی‌دار نشان داد(۰۵/۰(P>.

 

 

جدول ۳ – بررسی رشد باکتریهای جداشده از عصاره خرماهای مضافتی، پیارم و زاهدی در حضور شیره معده، صفرا و اسیدیته

شاخص

 

باکتری

شیره معده

pH

صفرا

۴

۵/۲

تریپسین

پپسین

۳

۴

۳

۴

Leuconostoc mesenteroides subsp. Mesenteroides strain UFLANFC 747 

۸/۲ ±  ۱۰۸ × ۱

۸/۳± ۱۰۸ × ۱

۲/۱± ۱۰۸ × ۱

۲/۳± ۱۰۸ × ۱

۸/۱± ۱۰۸ × ۱

۲/۲± ۱۰۸ × ۱

ً

Bacillus subtilis strain  UD1022

۳/۱ ±  ۱۸ × ۱

۸/۲ ± ۱۰۸ × ۱

۲/۱± ۱۰۸ × ۱

۴/۳± ۱۰۸ × ۱

۸/۳± ۱۰۸ × ۱

۶/۲± ۷ ۱۰ × ۱

۳/۳±  ۷ ۱۰ × ۱

Pediococcus parvalus strain SC8B

۶/۲±  ۱۰۸ × ۱

۸/۱± ۷ ۱۰ × ۱

۹/۱± ۱۰۸ × ۱

۶/۲± ۱۰۸ × ۱

۲/۴ ± ۱۰۸ × ۱

۴/۲± ۶ ۱۰ × ۱

۸/۲±  ۱۰۸ × ۱

                                                                                                                                                                                     

 

 

Pediococcus parvalus strain SC8B  در مقایسه با سایر باکتریها تمایل خیلی جزئی برای تهاجم برده سلولی مشاهده شد. که در مقایسه با کنترل پروبیوتیک مثبت و کنترل بیماری‌زای مثبت کاهش معنی‌دار نشان داد(۰۵/۰(P>. قدرت تهاجم در باکتریهای Leuconostoc mesenteroides subsp. Mesenteroides strain و Bacillus subtilis strain smppsap2 مشاهده نشد.

بر اساس جداول ۴ و ۵ باکتریهای جداشده از عصاره خرماهای مضافتی، پیارم و زاهدی پروبیوتیک بودند.

 

 

 

جدول ۴ - نتایج قطر هاله عدم ممانعت دیسک آنتی‌بیوتیک باکتریهای جداشده از عصاره خرماهای مضاقتی، پیارم و زاهدی

دیسک

باکتری

آموکسی سیلین

پنی‌سیلین

سفالوتین

جنتامایسین

تتراسایکلین

اریترومایسین

استرپتومایسین

آزیترومایسین

ونکومایسین

L. mesenteroides subsp. Mesenteroides strain UFLANFC 747

۲/۱ ± ۴/۲

۴/۰ ± ۶/۱

۹/۰ ± ۸/۱

۷/۰ ± ۶/۲

۸/۰ ± ۴/۲

۱/۱ ± ۴/۲

۲/۱ ± ۶/۱

۹/۰ ± ۶/۱

۷/۰ ± ۵/۱

B. subtilis strain UD1022

۶/۰ ± ۲/۲

۹/۰ ± ۸/۲

۷/۰ ± ۶/۱

۴/۰ ± ۷/۱

۹/۰ ± ۸/۲

۱/۱ ± ۸/۲

۳/۱ ± ۲/۲

۴/۱ ± ۸/۲

۱/۱ ± ۶/۲

P. parvalus strain SC8B

3/1± 6/2

9/0± 4/2

8/0± 5/1

1/1± 4/2

7/0±4/2

8/0±9/1

4/1±6/2

1/1±9/1

2/1±4/2

                       

 

جدول ۵ - نتایج کشت سلولی باکتریهای جدا شده از عصاره خرماهای مضاقتی، پیارم و زاهدی

شاخص

آزمایش

تهاجم (درصد)

چسبندگی(درصد)

بافر فسفات نمکی(کنترل منفی)

                       -                    A

                         -                      A

Leuconostoc mesenteroides subsp. Mesenteroides strain UFLANFC 747 

                       -                    A

                 ۰۲/۰ ± ۷۴/۰             C

Bacillus subtilis strain UD1022

                       -                    A

                 ۰۱/۰ ± ۷۹/۰             D

Pediococcus parvalus strain SC8B

            ۰۰۰۱/۰ ± ۰۱/۰         B

                 ۰۱/۰ ± ۵۹/۰             B

Bacillus coagulans (IBRC-M 10807)

(به عنوان کنترل پروبیوتیک مثبت)

              ۰۳/۰ ± ۰۹/۰           C

                  ۰۹/۰ ± ۱/۱               E

L. monocytogenes (IBRC-M 10671)

(به عنوان کنترل بیماری‌زای مثبت)

                ۲/۱ ± ۲/۳۵         D

                  ۱۱/۰ ± ۳/۲               F

حروف یزرگ متفاوت در یک ستون نشان‌دهنده تفاوت معنی­دار می‌باشد (۰۵/۰(P<.

حروف کوچک یکسان در یک ستون نشان‌دهنده عدم تفاوت معنی­دار می‌باشد (۰۵/۰(P>.

 

بحث

خرما و فرآورده‌های آن ، عناصر ضروری برای رشد میکرواورگانیزمها را دارا هستند. باین ترتیب از آنها می‌توان به عنوان محصولات دارای ارزش‌افزوده استفاده کرد (۲8). بر اساس جداول ۱و ۲ باکتری جداشده از عصاره خرمای پیارم  متعلق بهUD1022  Bacillus subtilis strain  بود. این باکتری پروبیوتیک بود. Abass (۲۰۱۳) باکتریهای باسیلوس را از درخت خرما جدا کرد. نتایج تحقیق حاضر با این تحقیق مطابقت دارد (4). در تحقیق حاضر این باکتری در عصاره  خرماهای مضافتی و زاهدی مشاهده نشد. عدم مشاهده این باکتری در عصاره خرماهای مضافتی و زاهدی به دلیل عدم وجود خاک منطقه پرورش خرماهای مضافتی و زاهدی و آب مورداستفاده برای آبیاری این درخت‌هاست.

بر اساس این جداول باکتریهای جداشده از رطب مضافتی و زاهدی به ترتیب متعلق به جنس لوکونوستوک مزونتروییدس و Pediococcus parvalus strain SC8B بود. این باکتریها پروبیوتیک بودند. باکتریهای Pediococcus ، Bacillus subtilis و Leuconostoc تاکنون از عصاره خرما گزارش نشده‌اند. هرچند گزارشهایی مبنی بر جداسازی Leuconostoc mesenteroides ، باسیلوس و سایر باکتریهای اسیدلاکتیک ازجمله لاکتوباسیلها از درخت نخل، شیره خرما و خرما وجود دارد (۱7). جدا سازی Pediococcus ، باسیلوس سوبتیلیس و لوکونوستوک از عصاره خرما اولین گزارش مبنی بر جداسازی این باکتریها از عصاره خرماست. .Hamad (۲۰۰۸) باکتریهای Lactobacillus delbrueckii subsp. delbrueckii, Lactobacillus fructivorans, Lactobacillus collinoides, Lactobacillus salivarius را از رطب جدا کرد. Sulistiani (۲۰۰۲) باکتریهای پروبیوتیک شامل Leuconostoc mesenteroides، Lactobacillus plantarum، Fructobacillus durionis و  ructobacillus Fructobacillus را از شیره خرما جدا کرد. که با نتایج تحقیق جاری در مورد خرمای مضافتی مطابقت دارد (27). Tatsinkou Fossi و همکاران (۲۰۰۲) باکتریهای پروبیوتیک شامل  Lactobacillus plantarum, Lactobacillus rhamnosus و lactobacillus brevis را از شیره تخمیر شده درختان نخل جدا کردند (30). Arasu و Al-Dhabi   (۲۰۱۷) باکتری پروبیوتیک  Lactobacillus papaplantarum را از خرماهای تخمیر شده جدا کرد. نتایج به دست آمده از این تحقیق با نتایج تحقیق جاری مطابقت ندارد. که با توجه به منطقه پرورش خرما متفاوت است (6).

برای سالهای طولانی به سختی قادر بودند بر اساس روشهای فنوتیپی سنتی گونه‌های باکتریها را متمایز کنند. همچنین، آنالیز فیلوژنتیک ژن 16S   rRNA قادر به جداسازی گونه در مجموعه به علت ماهیت بسیار حفظ‌شده ژن نیست. بنابراین از روشهای ژنتیکی (نمودارهای 1 و 2) در ترکیب با روشهای بیوشیمیایی برای شناسایی این باکتریها استفاده شد (2).

هرچند لاکتوباسیلها جمعیت اصلی پروبیوتیکها را تشکیل می‌دهند اما برخی باسیلها نیز در شمار پروبیوتیکها قرار گرفته و یا کاندیدای تولید محصولات پروبیوتیکی هستند و با توجه به خواصی چون مقاومت در شرایط نامناسب محیطی، مواد مغذی برای دیگر تنشهای محیطی هستند. تمام اعضای جنس باسیلوس قادر به تشکیل آندوسپورهای خمیده مقاوم در برابر محدویت هستند. این اسپورها به راحتی ساخته می‌شوند و از طریق باد در محیطهایی مانند آب پراکنده‌شده و به آبزیان منتقل می‌شوند(2).

بر اساس جداول ۳، ۴ و ۵ باکتریهای Leuconostoc mesenteroides subsp. Mesenteroides strain UFLANFC 747  ، UD1022 Bacillus subtilis strain  و Pediococcus parvalus strain SC8B پروبیوتیک هستند. با توجه به گرایش جامعه به سمت غذاهای ایمن و فاقد نگهدارنده­های سنتتیک و تازه و اثرات منفی ناشی از نگهدارنده­های سنتتیک و تجمع آنها در بدن انسان و اینکه کشتهای زنده میکرواورگانیزمها به عنوان غذاهای عمل‌گرا مطرح هستند و اثرات مفید این باکتریها در بدن انسان و جلوگیری از بیماری برای استفاده از عصاره خرما به عنوان کشتهای استارتر و حفاظت مواد غذایی تخمیری تحقیقات وسیع‌تری نیاز است. علاوه بر این به دلیل خاصیت پیشگیرانه و تولید ترکیبات ضد میکروبی توسط این باکتریها برعلیه باکتریهای بیماری‌زای مواد غذایی مصرف خرما و یا عصاره‌های آن در موارد بیماری توصیه می‌شود. با توجه بآزمایشات انجام‌شده روی عصاره خرما و شناسایی باکتریهای باسیلوس در عصاره خرمای پیارم و باکتریهای اسیدلاکتیک شامل لوکونوستوک و پدیوکوکوس در عصاره خرماهای مضافتی و زاهدی  و در نظر گرفتن خواص غذایی و پروبیوتیک آنها امکان استفاده از عصاره خرماهای مضافتی، پیارم و زاهدی در صنایع غذایی به عنوان مکمل غذایی، محافظ غذایی و تخمیری می‌تواند موردتوجه قرار گیرد. با توجه به نتایج آزمایشات، خرما در مجموعه غذاهای پروبیوتیک قرار دارد. علاوه بر این می‌توان عصاره آبی خرما را برای غنی‌سازی و تهیه مواد غذایی پروبیوتیک به کار برد. همچنین با توجه به ویژگیهای باکتریهای پروبیوتیک عصاره آبی خرما یا گوشت خرما برای جلوگیری از جایگزینی باکتریهای بیماری‌زا و جلوگیری از بیماری توسط مصرف‌کنندگان قابل‌مصرف هستند.

1 - استاندارد ملی ایران شماره ۱۹۴۵۹. ۱۳۹۳. میکرواورگانیزمهای پروبیوتیک ویژگی‌ها و روشهای آزمون. موسسه استاندارد و تحقیقات صنعتی ایران.
2 – افشار محمدیان، منصور.، شیرین کردی و مشهدی نژاد، احمد. 1395. بررسی فعالیت ضد باکتریایی عصاره کلاله و گلبرگ گونه‌های مختلف زعفران. مجله پژوهش‌های سلولی و مولکولی. 29: 265- 273.
3 – تقی نژاد، حسام‌الدین.، فهمیده، لیلا.، صمصام پور، داوود و عسکری سیاهویی، مجید. 1397. تنوع ژنتیکی ارقام نخل خرما در استان‌های سیستان و بلوچستان و هرمزگان با ریز ماهواره. مجله پژوهش‌های سلولی و مولکولی. 31: 1 – 15.
 
4 – Abass, M. H. 2013. Microbial contaminants of date palm (Phoenix dactylifera L.) in Iraqi tissue culture laboratories. Emirates Journal Food Agriculture. 25 : 875-882.
5 - Al-Farsi, M., Alasalvar C., Morris, A., , M. and Shahidi, F. 2005. Comparison of antioxidant activity, anthocyanins, carotenoids, and phenolics of three native fresh and sun-dried date (Phoenix dactylifera L.) varieties grown in Oman. Journal Agriculture Food Chemistry. 21: 53:7592-9.
6 – Arasu, M. V and Al-Dhabi, N. A.  2017. In vitro antifungal, probiotic, and antioxidant functional properties of a novel Lactobacillus paraplantarum isolated from fermented dates in Saudi Arabia. Journal Science Food Agriculture. 97: 5287-5295.
7 - Ashraf, Z. and Hamidi Esfahani, Z. 2011. Date and Date Processing: A Review. Journal Food Reviews International . 27: 101-133.
8 – Baliga, M. S., Baliga, B. R. V. and Kandathil,  S. M.  2001. A review of the chemistry and pharmacology of the date fruits (Phoenix dactylifera L.). Food Research International. 44: 1812–1822.
9 – Davidson, P. M. 2001. Chemical preservatives and natural antimicrobial compounds. In Food Microbiology,  Fundamentals and Frontiers, (2nd Edition). Am Soc  Microbiol, Washington, DC, pp. 593–627
10 – Dayang, J. F., Reuben, C. R. and Raji, F. 2014. Nutritional, Socioeconomic and health benefits of dates. International Journal Food Nutrition Science. 33: 63 – 73.
11 - De Medici, D., Croci, L., Delibato, E., Di Pasquale, S.,  Filetici, E. and Toti, L. 2013. Evaluation of DNA Extraction Methods for Use in Combination with SYBR Green I Real-Time PCR To Detect Salmonella enterica Serotype Enteritidis in Poultry. Applied Environmental Microbiology. 69: 3456–3461.
12 – Dev, S. S., Nisha, E. A. and Venu, A. A. 2016. Biochemical and molecular characterization of efficient phytase producing bacterial isolates from soil samples. International Journal Current Microbiology Applied Science. 5: 218-226
13 - El Hadrami, A. and Al-Khayri, M. J. 2012. Socioeconomic and traditional importance of date palm. Emirates Journal Food Agriculture. 24: 371-385
14 - El-Sohaimy, S. A. and Hafez, E. E. 2010. Biochemical and nutritional characterizations of date palm fruits (Phoenix dactylifera L.). Journal Applied Science Research. 6: 1060–1067.
15 - FAO. 2007.  updated  June  2,  2012.  Available  from Statistical Databases; http://faostat.fao.org
17 – Hamad, S. H. 2008 . Microbial spoilage of date rutab collected from the markets of Al-Hofuf city in the Kingdom of Saudi Arabia.  Journal Food Protect. 71:1406-11.
18 – Holt, J. G., Krieg, R. N., Sneath, P. H. A., Staley,  J. T. and Williams, S. T. 1994. Bergeys manual of determinative bacteriology ninth edition, Williams & wilkins, Georgia, pp: 523 – 530.
19 – Jassim, S. A. A. and Naji, M. A. 2003. Review/novel antiviral agents: A medicinal plant perspective. Journal Applied Microbiology. 95:412–27.
20 – Mehdipour, F., Shahrokhi, N., Esmaeilpour, K., Kalantaripour, T. P., Oloumi, H., Basiri, M. and Asadi-Shekaari, M. 2017. Aqueous Date Fruit Extract can’t Ameliorate β-amyloid Induced Memory Impairments in Male Rats. Journal Biological Science. 17: 69 -75.
21 – Nithya, V. and Halami, P. M. 2013. Evaluation of the probiotic characteristics of Bacillus species isolated from different food sources. Annals Microbiology. 63:129-137.
23 – Ragava, S. C, Loganathan, M., Vidhyalakshmi, R. and Vimalin, H. J. 2016. Microbial Evaluation and Control of Microbes in Commercially Available Date . Phoenix dactylifera Lynn.)Fruits. Journal food Processing Technology. 7:7 -13.
24 – Rauha, J. P., Remes, S., Heinonen, M., Hopia A., Kähkönen, M., Kujala, T. and Pihlaja, K. 2000. Antimicrobial effects of Finnish plant extracts containing flavonoids and other phenolic compounds. International Journal Food Microbiology. 25: 56:3-12.
25 – Rowan, N. J., Deans, K., Anderson, J. G., Gemmell, C. G., Hunter, I. S. and Chai­thong, T. 2001. Putative virulence factor expression by clinical and food isolates of Bacillus spp. after growth in reconstituted infant milk for­mulae. Applied Environmental Microbiology. 67:3873-81.
26 – Saleh, F. A. and Otaibi, M. M. 2013. Antibacterial Activity of Date Palm (PhoenixDectyliferaL.) Fruit at Different Ripening Stages. Journal Food Processing Technology. 4:285.
27 - Sulistiani. 2002. Selection of Potential Probiotic Lactic Acid Bacteria Isolated from Palm Sap (Borassus flabelliferLinn.)Origin Kupang, East Nusa enggara. AIP Conference Proceeding.  020059-1–020059-9.
28 – Talebi, M., Emtiazi, G., Akhavan Sepahy, A. and Zaghian, S. 2013. Zymogram analysis of alkaline keratinase produced by nitrogen fixing Bacillus pumilus ZED17 exhibiting multiprotease enzyme activities.  Jundishapur Journal Microbiology.  6: e7974 – 6
29 – Tang, Z. X., Shi, L. E. and Aleid, S. M. 2014. Date  and  Their  Processing  Byproducts  as  Substrates  for Bioactive Compounds Production. International Journal Brazilian Archives  Biology Technology. 57: 706-713.
30 - Tatsinkou Fossi, B., Goghomu, S., Tongwa, M., Ndjouenkeu, R and Cho-Ngwa, F. 2017. Screening for bacteriocins producing probiotic bacteria from fermented sap of palm trees (Elaeis guineesis and Raffia sudanica): production and partial characterization of bacteriocins.  Journal of Applied Biotechnology and  Bioengineering. 2: 1-8.
دوره 34، شماره 2
تیر 1400
صفحه 219-231
  • تاریخ دریافت: 22 دی 1398
  • تاریخ پذیرش: 05 بهمن 1398
  • تاریخ اولین انتشار: 01 تیر 1400