نوع مقاله : مقاله پژوهشی

نویسندگان

1 گروه گیاهپزشکی، دانشکده کشاورزی، دانشگاه زابل، زابل، ایران

2 دانشیار گروه گیاهپژشکی، دانشکده کشاورزی، دانشگاه زابل، زابل، ایران

3 دانشیار گروه زیست شناسی، دانشکده علوم پایه، دانشگاه یزد، یزد، ایران

4 دانشیار گروه گیاهپزشکی، دانشکده کشاورزی، دانشگاه زابل، زابل، ایران.

5 استادیار گروه زیست شناسی، دانشکده علوم، دانشگاه یزد، یزد، ایران

چکیده

آ. قارچ Aspergillus nigerمیکروارگانیسمی است که آنزیم های گروه پکتیناز را در سطوح بالایی تولید می کند. در این قارچ ژن های PgaA خانواده شماره 28 گلیکوزید هیدروزلازها که آنزیم های پلی گالاکتوروناز ترشح می کنند را کد می کنند. جلبک های سبز و جلبک های سبز-آبی با داشتن ترکیبات پکتینی، سلولزی و همی سلولزی زایلان، آرابینوزایلان و غیره در ساختار خود می توانند به عنوان پیش ماده برای تولید آنزیم های سلولاز، زایلاناز و پکتیناز در قارچ ها عمل نمایند. در این پژوهش تاثیر غلظت های 500 و 1000 میکروگرم در میلی لیتر عصاره جلبک سبز Spirogyra sp. بر میزان ترشح آنزیم پکتیناز و همچنین سطح بیان ژن PgaA در بازه های زمانی چهار و هشت روز پس از افزودن عصاره جلبک به محیط کشت، با استفاده ازتکنیک Quantitative Real-time PCR ارزیابی گردید.. بیشترین میزان ترشح آنزیم در روز هشتم پس از اضافه کردن عصاره جلبک با غلظت 100 میلی گرم در میلی لیتر به محیط کشت مشاهده شد (28/4 واحد بر میلی لیتر). آنالیز بیان ژن PgaA نشان داد که بیشترین میزان سطح بیان ژن مربوط به بازه زمانی 4 روز بعد از افزودن عصاره جلبک به محیط کشت با غلظت 1000 میکرو گرم ر میلی لیتر بوده است:.با توجه به تاثیر مثبت ترکیبات جلبک اسپیژوژیر بر میزان بیان ژن رمز کننده آنزیم های پکتیناز و افزایش ترشح آنزیم چنین نتیجه گیری می شود که میکروجلبکها می تواننند منابع بسیار مناسبی جهت تولید آنزیم از قارچ های مستعد باشند و در صنایع بیوتکنولوژی مورد استفاده قرار گیرند

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Effect of green algae extract; Spirogyra sp. on the rate of pectinase enzyme secretion and expression level of PgaA gene in Aspergillus niger

نویسندگان [English]

  • amir masoud heydari nezhad 1
  • Naser Panjehkeh 2
  • Seayed kazem Sabbagh 3
  • Mohammad Salari 4
  • Mohammad Reza Sarafraz ardakani 5

1 Plant Protection Dep., Faculty of Agriculture., University of Zabol. Zabol, IR. of Iran

2 Associate prof. Plant Protection Dep., Faculty of Agriculture., University of Zabol. Zabol, IR. of Iran

3 Associate prof. Biology Dep., Faculty of Science., Yazd University. Yazd, IR. of Iran

4 َAssociate prof. Plant Protection Dep., Faculty of Agriculture., University of Zabol. Zabol, IR. of Iran

5 َAssistant prof. Biology Dep., Faculty of Science., Yazd University. Yazd, IR. of Iran

چکیده [English]

Aspergillusniger is one of the microorganisms that produce the pectinase enzymes group of the at high levels. In this fungus, PgaA genes code Glycoside hydrolase family 28 that secrete polygalacturonase enzymes. Green algae (Chlorophyceae) and blue-green algae (Myxophyceae) having pectin, cellulose and hemicellulose compounds such as xylan, arabinoxylan in their structure could act as a precursor to the production of cellulase, xylanase and pectinase enzymes in fungi. In this work, the effect of green algae extract ; Spirogyra sp. at 500 and 1000 mg/mL concentration on the rate of pectinase enzyme secretion and the relative expression of PgaA gene at 4 and 8 day after adding algae extract to culture medium was evaluated using qRT-PCR analysis. . The highest level of enzyme secretion was observed at 8th days after algae extract adding to culture medium at 1000 mg/mL concentration( 4.28 U/ml). Gene expression analysis of PgaA gene showed that the highest expression level was relted to 4th days time interval after adding alge extract at 1000 mg.mL (10/142). According to positive effect of spirogyra algae compounds on expression level of PgaA gene responsible to pectinase production and increase of enzyme secretion, it is concluded that microalgaes could be used as important sources of enzyme production from favorable fungi and could be useful in biotechnological industry

کلیدواژه‌ها [English]

  • Gene expression
  • Green algae
  • pectinase
  • PgaA gene
  • real-time PCR

تاثیر عصاره جلبک سبز Spirogyra sp. بر میزان ترشح آنزیم پکتیناز و سطح بیان ژن PgaA در قارچ Aspergillus niger

امیر مسعود حیدری نژاد1، ناصر پنجه که1، سید کاظم صباغ2*، محمد سالاری1 و محمدرضا سرافراز اردکانی2

1 زابل، دانشگاه زابل، دانشکده کشاورزی، گروه گیاهپزشکی

2 یزد، دانشگاه یزد، دانشکده علوم، گروه زیست شناسی

تاریخ دریافت: 21/7/97                تاریخ پذیرش: 25/10/97

چکیده

قارچ Aspergillus nigerمیکروارگانیسمی است که آنزیم های گروه پکتیناز را در سطوح بالایی تولید می کند. در این قارچ ژن های PgaA خانواده شماره 28 گلیکوزید هیدروزلازها که آنزیم های پلی گالاکتوروناز ترشح می کنند را کد می کنند. جلبک های سبز و جلبک های سبز-آبی با داشتن ترکیبات پکتینی، سلولزی و همی سلولزی زایلان، آرابینوزایلان و غیره در ساختار خود می توانند به عنوان پیش ماده برای تولید آنزیم های سلولاز، زایلاناز و پکتیناز در قارچ ها عمل نمایند. در این پژوهش تاثیر غلظت های 500 و 1000 میکروگرم در میلی لیتر عصاره جلبک سبز Spirogyra sp. بر میزان ترشح آنزیم پکتیناز و همچنین سطح بیان ژن PgaA در بازه های زمانی چهار و هشت روز پس از افزودن عصاره جلبک به محیط کشت، با استفاده ازتکنیک Quantitative Real-time PCR ارزیابی گردید. بیشترین میزان ترشح آنزیم در روز هشتم پس از اضافه کردن عصاره جلبک با غلظت 100 میلی گرم در میلی لیتر به محیط کشت مشاهده شد (28/4 واحد بر میلی لیتر). آنالیز بیان ژن PgaA نشان داد که بیشترین میزان سطح بیان ژن مربوط به بازه زمانی 4 روز بعد از افزودن عصاره جلبک به محیط کشت با غلظت 1000 میکرو گرم در میلی لیتر بوده است. با توجه به تاثیر مثبت ترکیبات جلبک اسپیژوژیر بر میزان بیان ژن رمز کننده آنزیم های پکتیناز و افزایش ترشح آنزیم، چنین نتیجه گیری می شود که ریزجلبک ها می توانند منابع بسیار مناسبی جهت تولید آنزیم از قارچ های مستعد باشند و در صنایع بیوتکنولوژی مورد استفاده قرار گیرند.

واژه‌های کلیدی: اسپیروژیر، آنزیم پلی گالاکتوروناز، بیان ژن، تکنیک Real-time PCR، جلبک سبز.

* نویسنده مسئول، تلفن: 03531232257 پست الکترونیکی: [email protected]

مقدمه

 

آنزیم پکتیناز یک آنزیم پکتولیتیکی است که ماده پکتین را که یک سوبسترای پلی ساکاریدی تشکیل دهنده دیواره سلول گیاهان است می شکند. پکتینازها از مهمترین گروه های آنزیمی هستند که به طور گسترده ای در باکتری ها و قارچ ها توزیع شده و سه گروه مهم آن ها شامل پلی گالاکتورونازها (PG)، پکتین استرازها (PE) و پکتین لیازها (PL) می باشند (1). یکی از اولین موارد استفاده از آنزیم پکتیناز (جدا شده از قارچ ها) در صنایع غذایی، مربوط به شفاف سازی و بالا بردن کیفیت آبمیوه ها می باشد (2). آنزیم های تجاری پکتین لیازی در صنعت آبمیوه از تقاضای بالایی برخوردار هستند. پکتیناز کاربردهای بسیار زیادی در صنایع استخراج آبمیوه، استخراج روغن، تیمار کردن ضایعات آبی، غذای دام، خالص سازی ویروس های گیاهی استفاده در صنعت کاغذ سازی، تخمیر چای و قهوه و نرم کردن فیبر های گیاهی دارد (2). قارچ
Aspergillus niger یکی از میکروارگانیسم هایی است که سطح بالایی از آنزیم های گروه پکتیناز را تولید می کند (3). با کشت قارچ ها در محیط کشت مناسب و اضافه کردن مواد حاوی پکتین به محیط، تولید این آنزیم ها القاء می شود. سپس با انجام فیلتراسیون این آنزیم ها را جداسازی می کنند (4). خانواده گلیکوزید هیدرولازها گروه گسترده ای از آنزیم ها هستند که پیوند گلیکوزیدی بین دو یا تعداد بیشتری از کربوهیدرات ها را تجزیه می کنند (5). قارچ Aspergillus nigerقادر خواهد بود در محیط های محرک، با افزایش بیان ژن Alkaline Protease  (APga)  منجر به تولید و افزایش آنزیم پلی گالاکتوروناز (EC 3.2.1.15) از خانواده شماره 28 گلیکوزید هیدروزلازها شود (6). بهینه سازی شرایط تخمیر و ترکیب مواد غذایی محیط کشت قارچ Aspergillus oryzae نشان داده است که ترکیباتی نظیر سویا، قند، اوره، آب و سولفات منیزیوم در دمای 33 درجه سانتی گراد، رطوبت 67% و اسیدیته 9/5 قادر به تحریک قارچ در افزایش میزان آنزیم های سلولاز و پکتیناز شده است (7). استفاده از تفاله انگور در تحریک قارچ Aspergillus awamoriدر تولید آنزیم های زایلاز و پلی گالاکتوناز نشان داده است که محیط جامد و اندازه ذرات در مراحل تخمیر و تولید آنزیم خللی ایجاد نمی کند (8). جلبک های سبز (Chlorophyta) و جلبک های سبز-آبی (Cyanophyta) با داشتن ترکیبات پکتینی، سلولزی و همی سلولزی زایلان، آرابینوزایلان و غیره در ساختار خود می توانند محرک های خوبی به عنوان پیش ماده برای تحریک بیان ژن رمز کننده و تولید آنزیم های سلولاز، زایلاناز و پکتیناز در قارچ ها باشند (9). جلبک سبز رشتهSpirogyra sp. (Zygnematophyceae)دارای ریسه های سبز رنگ، غیر منشعب و مرکب از ردیفی از سلول های دارای 1 تا 16 کلروپلاست مارپیچی می باشند که به صورت آزاد و شناور در روی سطح آب های شیرین رشد می کنند (10). مطالعات ثابت کرده است که استفاده از زیست توده جلبک Spirogyraو قارچ Aspergillus niger بعنوان جاذب زیستی (Biosorption) در جذب رنگ های باقی مانده در پسآب های نساجی موثر است (11). دیواره سلولی این جلبک دو لایه است که لایه بیرون پکتینی و لایه درونی غنی از ترکیبات سلولزی می باشد پکتین در خارجی ترین لایه دیواره سلولی حل می شود و به ریسه ها حالت لغزنده و لزج می دهد (12). با توجه به وضعیت ساختاری دیواره این جلبک و پتانسیل بالای قارچ Aspergillus nigerدر تولید آنزیم پکتیناز، .در این تحقیق اثر عصاره آبی جلبک اسپیروژیر بر روی برخی از خصوصیات بیوشیمیایی و مولکولی قارچ Aspergillus nigerدر سطح بیان ژنPgaAبا روش بیان ژن در زمان واقعی ومیزان تغییرات در تولید آنزیم پکتیناز مورد بررسی قرار گرفت.

مواد و روشها

انتخاب و شناسایی قارچ: جدایه مورد مطالعه از مجموعه قارچی گروه گیاهپزشکی دانشگاه فردوسی مشهد تهیه شد. شناسایی قارچ مورد نظر به کمک مشاهده های میکروسکوپی و مطالعه ویژگی های ریخت شناسی اندامی نظیر هاگ، هاگ بر، انشعابات اولیه و ثانویه هاگبرها انجام شد (شکل 2). همچنین بمنظور شناسایی مولکولی قارچ، استخراج DNA کل از توده میسلیومی 5 روزه قارچ در محیط کشت PDB به روش CTAB انجام شد (14). از جفت آغازگر رفت و برگشت ITS1-ITS4 (جدول 1) مربوط به ناحیه بین ژنی DNA ریبوزومی برای تایید مولکولی جدایه قارچ با روش واکنش زنجیره پلیمراز استفاده گردید. پس از بهینه سازی باند حاصل از تکثیر قطعه هدف بر روی ژل آگارز 1 درصد، نمونه جهت تعیین توالی به شرکت Bioneer کره ارسال شد.

نمونه گیری و شناسایی جلبک Spirogyra: نمونه جلبک سبز رشته ای از آب چشمه های شیرین شهر طبس جمع آوری شد و در محیط کشت مایع Bold's Basal MediumBBM, Merck) کشت، خالص سازی و نگهداری شد. با استفاده از مطالعات میکروسکوپی و بررسی خصوصیات کلروپلاستی (کلروپلاست نواری و مارپیچی) نمونه جلبک مورد بررسی Spirogyra sp. تشخیص داده شد (شکل 2).

تهیه عصاره جلبکی: به منظور تهیه عصاره جلبک ، نمونه جلبک سبز بر اساس روش شوچنکو و همکاران (15) در محیط غنی غذایی مایع BBM و روی شیکر در شرایط دمایی و تناوب نوری مناسب کشت داده شد و پس از رشد، نمونه ها از محیط کشت تخلیص و در آون خشک شدند. مقدار 50 گرم از بافت خشک جلبک جهت استخراج عصاره آبی بوسیله دستگاه سوکسله مورد استفاده قرار گرفت (16). پس از پایان عصاره گیری، مقدار 1/. گرم از عصاره استحصال شده جلبک در 100 میلی لیتر آب حل شده و از رقیق سازی عصاره پایه جلبکی با غلظت 1000 میکرو گرم در میلی لیتر تهیه و تا زمان استفاده در یخچال در دمای 4 درجه سانتی گراد نگهداری شد.

طراحی آغازگر در ناحیه ژن PgaA: به منظور طراحی آغازگر مناسب در ناحیه ژن هدف توالی های مربوط به رونوشت ژن PgaA کد کننده آنزیم های اندوپلی گالاکتوروناز از گونه A .nigerاز وبگاه NCBIدریافت شد. هم ردیفی توالی ها و انتخاب نواحی محافظت شده با ساخت توالی مورد توافق (Consensus sequence) به کمک نرم افزار Bioedit صورت گرفت. درنهایت طراحی آغازگر مناسب در نواحی بین دو اگزون (Exon-exon junction) (دارای یک ناحیه اینترونی به طول 53 جفت باز) در رونوشت ژن PgaA، به کمک نرم افزارهای بیوانفورماتیکی Oligo7 (17)، Primer premier 5 (18) و وبگاه آنلاین Primer 3 انجام شد.

 

جدول 1- مشخصات آغازگرهای مورد استفاده در این مطالعه

دمای اتصال آغازگر

طول محصولPCR

توالی برگشت

توالی رفت

نام آغازگر

58

269***-322**

TCCATCCCACTCCTCGTAC

TGCCAAGCCTTTGTTCTG

PgaA*

56

600

TCCTCCGCTTATTGATATGC

TCCGTAGGTGAACCTGCGG

ITS1-4

59

170

GAAGAAGGAGCAAGAGCAGT

GGTCTGGAGAGCGGTGGTAT

Actin

* Designed in this study- ** For DNA- *** For mRNA


القای ترشح و سنجش آنزیم پکتیناز: به منظور سنجش میزان ترشح آنزیم پکتیناز، محیط کشت مایع حاوی (NH4)2SO4، KH2PO4، K2HPO4  (6 گرم) و MgSO4(1 گرم) در حجم 1000 میلی لیتر تهیه و سپس در ظروف شیشه ای به میزان 50 میلی لیتر تقسیم شد. عصاره جلبکی 1 درصد به عنوان پیش ماده و منبع کربن به محیط اضافه و نمونه های قارچی کشت و در انکوباتور شیکردار (80 rpm) به مدت 8 روز در دمای 25 درجه سانتی گراد قرار داده شدند. بعد از طی گذشت بازه های زمان های 4 و 8 روز پس از کشت قارچ در محیط القاء کننده حاوی عصاره جلبک، محیط کشت بوسیله فیلتر میکروپور صاف و تخلیص گردید. از مایع آبی به عنوان عصاره آنزیمی در سنجش فعالیت آنزیمی و از هیف قارچی برای استخراج RNA استفاده گردید. سنجش آنزیم پکتیناز به روش کلوریمتریک میلر و معرف دی نیتروسالیسیلیک اسید حاوی20 میلی لیتر NaOH 2 مولار، 1 گرم پودر نیتروسالیسیلیک اسید (DNS)، 30 گرم سدیم پتاسیم تارتارات در 100 میلی لیتر انجام شد. مقدار 30 میکرولیتر نمونه عصاره آنزیمی در 3 میلی لیتر بافر سدیم استات (pH: 6) رقیق شد و پس از 10 دقیقه نگهداری در دمای 40 درجه ساتیگراد، 1 میلی لیتر معرف DNS به نمونه ها اضافه و 5 دقیقه در دمای 90 درجه سانتی گراد قرار داده شدند. سپس جذب نوری محلول واکنش با استفاده از دستگاه طیف سنج نوری (AnalytikaJena, Germany) در طول‍موج 540 نانومتر اندازه گیری شد. آزمون محاسبه سطوح آنزیمی در سه تکرار انجام شد. هر واحد فعالیت پکتیناز به عنوان مقدار آنزیمی که 1 ماکرومول گلوکوز در هر دقیقه آزاد می کند، تعیین می شود.

استخراج RNA، ساخت cDNA و بررسی سطح بیان ژن PgaA : استخراج RNA از توده های قارچی حاصل برای تهیه عصاره آنزیمی با استفاده از بافرRNX-Plus  (19) و Triozol مطابق با روش سیمس و همکاران انجام شد (20). به منظور حذف آلودگی­های احتمالی   RNA بوسیله DNA از کیت RNase-free( Fermentase) استفاده گردید. از آنزیم DNaseI (SinaClon, Iran) برای حذف مولکولهایDNA باقیماده در محلول استفاده گردید.

سنتز cDNA با استفاده از کیت تجاری AccuPowerRCycleScript RT PreMix (dN6) kit انجام شد. به منظور بررسی سطح بیان و میزان تغییرات ژن PgaA در تیمارهای بکار رفته، از تکنیک آنالیز بیان ژن در زمان واقعی ((Quantitative Real-time  PCR با استفاده از دستگاه Applied Biosystems® StepOnePlus™ Real-Time PCR  استفاده شد (21). اجزای واکنش شامل 50 نانوگرم cDNA، 5/0 میکرولیتر از آغازگرهای رفت و برگشت، 5/7 میکرولیتر RealQ Plus 2x Master Mix بود که با آب مقطر دوبار تقطیر حجم نهایی محلول واکنش به 15 میکرولیتر تنظیم گردید. از توالی آغازگر ژن بتا اکتین (Beta-Actin) به عنوان ژن مرجع استفاده شد (جدول 1).

آنالیز داده‌ها: پس از اتمام تکثیر DNA مکمل و ترسیم منحنی ذوب نمونه (Melting curve analysis) توسط نرم افزاز، آنالیز نتایج حاصل از واکنش Real Time- PCR با استفاده از فرمول  (ΔΔCT) 2 محاسبه شد (22). تغییرات Ct (Cycle threshold; Ct) هر نمونه در هر بازه زمانی با نمونه کنترل و ژن مرجع طبق فرمول زیر به دست آمد.

∆Ct target = Ct control – Ct treatment

∆C reference= Ct control -Ct treatment

∆∆Ct= ∆Ct reference - ∆Ct target

Ratio=2-∆∆Ct

ترسیم نمودارها با استفاده از نرم افزارGraphpad Prism 7 و تحلیل آماری داده‌ها به وسیله نرم افزار IBM SPSS Statistics 22 انجام شد.

نتایج

جهت شناسایی قارچ A. niger ابتدا DNA ژنومی قارچ با استفاده از کیت مربوطه استخراج شد. کیفیت استخراج با استفاده از ردیابی باند حاصل بر روی ژل آگارز 1 درصد با عکس برداری توسط دستگاه Gel Doc تایید شد (شکل 1-الف). ناحیه بین ژنی رمز کننده RNA ریبوزومی جهت شناسایی مولکولی قارچ آسپرژیلوس نیجر استفاده گردید. مشاهده باند حاصل از قطعه تکثیری در واکنش زنجیره ای پلیمراز روی ژل آگارز 1 درصد، نشان از تکثیر صحیح و عاری از خطای قطعه مورد نظر می باشد (شکل 1- ب). پس از دریافت نتایج حاصل از تعیین توالی، خروجی حاصل از بلاست آرایش نوکلئوتیدی دریافتی، شباهت 100درصدی را به قارچ A. nigerنشان داد. توالی بین ژنی مطالعه شده در بانک ژن (National Center for Biotechnology Information-NCBI) ثبت شده است (MH635417).

نتایج آزمون طیف سنجی به منظور مطالعه بیوشیمیایی میزان تغییرات آنزیم پکتیناز در اثر کاربرد عصاره جلبک با غلظت‌های مختلف در دو بازه زمانی نشان داد که بیشترین سطح ترشح آنزیمی در محیط کشت مایع در تیمار 1000 میکرو گرم در میلی لیتر از عصاره جلبک در بازه زمانی هشت روز بعد از القا به وسیله عصاره جلبک به میزان 28/4 واحد بر میلی لیتر می باشد که در مقایسه با نمونه شاهد به میزان 3 واحد بر میلی لیتر در سطح یک درصد تفاوت معنی داری داشت. همچنین ترشح آنزیم پکتیناز در روز چهارم پس ازکشت در تیمار 1000 میکروگرم در میلی لیتر عصاره جلبکی به میزان 94/2 واحد بود که نسبت به نمونه شاهد به میزان 6/0 واحد در سطح یک درصد تفاوت معنی دار داشت. ترشح آنزیم پکتیناز توسط قارچ A. nigerدر محیط کشت حاوی عصاره 500 میکروگرم در میلی لیتر از عصاره جلبک Spirogyra sp. در روز چهارم به میزان 56/1 واحد بر میلی لیتر، با نمونه شاهد در سطح یک درصد و روز هشتم به میزان 29/3 واحد بر میلی لیتر با نمونه شاهد فقط در سطح پنج درصد تفاوت معنی دار داشت. (شکل 3).

پس از بررسی کیفیت RNA استخراج شده توسط ژل آگارز 1 درصد (شکل 1- پ) و ساخت DNA مکمل، واکنش زنجیره پلیمراز در زمان واقعی انجام شد. نتایج بررسی تغییرات بیان رونوشت شاهد در روز چهارم پس از کشت در نمونه کشت شده حاوی عصاره با غلظت 1000 میکروگرم در میلی لیترجلبک سبز Spirogyra  بوده است.

 

 

 

شکل 1- نتایج بررسی کیفیت قطعات استحراج و تکثیر شده روی ژل آگارز 1 درصد. (الف) باند حاصل از قطعات DNA ژنومی قارچ A. niger. (ب). باند حاصل از تکثیر ناحیه بین ژنی rDNA (ITS1-ITS4) در محدود نزدیک به 600 جفت باز (پ). بررسی کیفیت RNA استخراجی از نمونه های قارچی. وجود چهار قطعه باند از نواحی rRNA نشان از کیفیت مناسب استخراج RNA دارد.

 

 

شکل 2- (a) تصویر ماکروسکوپی توده رشته ای جلبک Spirogyra sp.. (b). تصویر درشت نمایی شده میکروسکوپ نوری از ریسه جلبک Spirogyra همراه با کلروپلاست مارپیچی (c). تصویر ماکروسکوپی از هیف و اسپورهای قارچ A. niger روی محیط کشت PDA. (d). تصویر درشت نمایی شده میکروسکوپ نوری قارچ A. niger.

 

 

شکل 3- میزان فعالیت آنزیم پکتیازی قارچ A. niger در روز های چهارم و هشتم در محیط کشت حاوی دو غلظت مختلف عصاره جلبک سبز Spirogyra sp.. (*) معنی دار در سطح پنج درصد. (**) معنی دار در سطح یک درصد.

 

شکل 4- تغییرات بیان ژن رمز کننده آنزیم پلی گالاکتوروناز در قارچ Aspergillus nigerدر محیط کشت حاوی دو غلطت متفاوت عصاره جلبکی Spirogyra sp. در بازه های زمانی 4 و 8 روز پس از کشت نسبت به نمونه شاهد

ژن رمز کننده آنزیم پلی گالاکتوروناز ((PgaA با استفاده روش بیان ژن در زمان واقعی نشان داد که افزایش بیان این ژن 142/10 برابر بیشتر از نمونه شاهد در محیط کشت پایه بود (جدول 2). همچنین در روز چهارم افزایش بیان ژن هدف در نمونه حاوی عصاره جلبکی با غلظت 500 میکروگرم در میلی لیتر نسبت به نمونه شاهد 295/2 برابر افزایش یافته است. بررسی نتایج بیان نسبی ژن هدف در روز هشتم پس از کشت نیز نشان داد که در نمونه قارچی حاوی عصاره500 میکروگرم در میلی لیترو 1000 میکروگرم در میلی لیتر عصاره جلبکی، سطح رونوشت این ژن به ترتیب به میزان 012/2 و 957/4 برابر بیشتراز نمونه شاهد بوده است (جدول 2). بطور کلی میزان تغییرات بیان ژن PgaA در روز چهارم نسبت به روز هشتم پس از کشت به میزان قابل توجهی بیشتر بوده است (شکل 4). مقایسه نتایج حاصل از سنجش سطح آنزیمی گروه پکتیاز و تغییرات بیان ژن رمز کننده آنزیم پلی گالاکتوروناز ارتباط و همبستگی نزدیکی را با هم نشان داد. در روز چهارم پس از کشت نمونه های تیمار شده با پیش ماده عصاره جلبکی در هر دو غلظت، نسبت به نمونه شاهد افزایش معناداری نشان داد (شکل 3).

بحث

جلبکها منشا سرشاری از هیدروکربن‌ها و مواد ژلاتینی بوده که در صنایع مختلف نظیر پزشکی، داروسازی و کشاورزی حائز اهمیت بوده و استفاده از ریز جلبک‌ها در مهندسی ژنتیک و بیوتکنولوژی در حال افزایش می باشد. استفاده از جلبکها به عنوان عوامل مفید در تولید سوخت های زیستی نظیر گاز هیدروژن (25)، و تولید انواع الکل‌ها و بیودیزل‌ها (25، 7،1) مورد آزمایش و تایید قرارگرفته است.گونه های متعلق به جنس Aspergillus توانایی هیدرولیز ترکیبات سلولزی و پکتینی را از مواد اولیه سازنده آن‌ها از طریق ترشح آنزیم‌های مختلف دارا می باشند. استفاده از مواد محرک قارچ نظیر تفاله های انواع میوه ها در ترشح آنزیم‌هایی مانند سلولاز، پکتیناز و همی سلولاز نشان داده است که با بهینه سازی شرایط رشدی قارچ مقادیر قابل توجهی از آنزیم‌های یاد شده تولید می گردد (36). با توجه به مطالعات کتابشناسی انجام شده اطلاعات کافی در ارتباط با نقش جلبک ها به عنوان منابع سرشاری از هیدرات‌های کربن در تحریک قارچ‌ها به تولید آنزیم های یاد شده وجود ندارد. با توجه به غنای موجود در ترکیبات تشکیل دهنده عصاره شامل، هیدروکربن‌ها، اسیدهای آمینه و پروتئین‌ها، ترکیبات ترپنوئیدی و عناصر ماکرو و میکرو، عصاره جلبک‌ها می تواند به عنوان یک ماده محرک بر رشد قارچ و بالطبع آن تولید آنزیم‌های مورد نیاز قارچ جهت هیدرولیز این ترکیبات فراهم آورد (5). مطالعات پیشین تاثیر نوع منبع کربنی و محرک های طبیعی پکتین نظیر سبوس گندم، میوه سیب، توت فرنگی و پرتقال و در میزان ترشح آنزیم های قارچی اثبات کرده است (23، 24). همچنین بهینه سازی شرایط رشدی قارچAspergillus giganteusبرای بهره وری هر بیشتر در تولید حداکثری آنزیم نشان داده است که در اسیدیته 5/4 و در دمای 30 درجه سانتی گراد بیشترین مقدار تولید آنزیم بعد از 5 روز به ثبت رسید (26). در این مطالعه با تنظیم چنین شرایطی به ویژه شرایط دمایی میزان بیان آنزیم و همچنین تاثیر عصاره در ایجاد تغییرات ژنتیکی در سطح بیان ژن در سطح قابل قبولی افزایش یافت. اثر غلظت به همراه دما بر میزان تولید آنزیم توسط دو گونه A. flavipes FP‐500 و A. terreus FP‐370 نشان داد که افزایش میزان غلظت منبع کربن قابل دسترس برای قارچ در اقزایش تولید آنزیم نقش مستقیم و اثر معنی داری دارد (22) که با نتایج این تحقیق مطابقت دارد. آنالیز بیان ژن PgaA در دو بازه زمانی با دو غلظت متفاوت عصاره نیز نشان از ارتباط مستقیم بین غلظت و زمان تاثیر و افزایش بیان ژن دارد بطوریکه در نمونه هایی که دو غلظت مختلف پیش ماده اضافه شده اند، نسبت به نمونه کنترل افزایش داشت. با افزایش میزان دو برابری غلظت عصاره از 500 به 1000 میکروگرم در میلی لیتر، سطح رونوشت ژن رمز کننده آنزیم پلی گالاکتوروزناز در روز هشتم تقریبا بین 2-5 برابر افزایش داشت (جدول 2).

 

جدول2- محاسبه ct میانگین هر نمونه و مقایسه نسبی میانگین بیان ژن PgaA نسبت به نمونه شاهد

Genes

Sample

Mean C(t)

Expression

PgaA*

Control+Day 4

32.158

1

PgaA

500PPM+Day 4

31.19

2.595

PgaA

1000PPM+Day 4

29.906

10.142

PgaA

Control+Day 8

29.674

1

PgaA

500PPM+Day 8

28.566

2.012

PgaA

1000PPM+Day 8

26.856

4.957

*Target Gene

 

کاهش روند افزایش بیان ژن با افزایش غلظت در بازه زمانی 8 روز پس کشت نشان از تاثیر اولیه عصاره در تحریک قارچ به تولید آنزیم دارد و احتمال اینکه بعد از گذشت زمان ترکیب عصاره اثر سمیت بر روی قارچ داشته باشند زیاد می باشد. با بررسی میزان بیان این ژن در بازه های زمانی بیشتر می توان این مورد را اثبات نمود ولی در این تحقیق هدف تعیین اثر پذیری قارچ از عصاره جلبک با استفاده از نشانگر مولکولی بود که به تائید رسید. مطالعه کلوزت و همکاران (2004) با تلقیح عصاره جلبک سبز Ulva sp.به گیاه یونجه به عنوان القاگر و مشاهده نتایج آزمون نوردرن بلات نشان داد، پاسخ های دفاعی گیاه باعث افزایش بیان ژن PR10 بدون بروز پاسخ نکروتیک در گیاه شده است (28). افزایش میزان مقاومت گیاه به بیماری می‌تواند نتیجه تحریک قارچ به تولید آنزیم پکتیناز باشد که باعث خودکشی قارچ در گیاه و در نتیجه مقاومت گیاه در اثر کاهش جمعیت بیمارگر می شود. کاربرد این ترکیبات با اثر تحریک به سلولاز در قارچ‌های بیمارگر می تواند منجر به افزایش بیماری در گیاه شود زیرا توانایی قارچ را در هیدرولیز دیواره سلولزی گیاه بیشتر می نماید.

در مطالعه حاضر نتایج سنجش آنزیمی در محیط کشت قارچ پس از هشت روز نیز نشان داد که سطح پایه ترشح آنزیم در نمونه شاهد در این بازه زمانی تا میزان 3 واحد بر میلی لیتر رسید که در مقایسه با روز چهارم 4/2 واحد بیشتر بوده است. این افزایش می تواند به دلیل تکامل ریسه های قارچی در این بازه و تحریک بیشتر جهت تولید متابولیت های ثانویه باشد. در محیط های کشت تیمار شده با هر دو غلظت عصاره جلبکی در هر روز چهارم میزان سطوح آنزیمی به طور معناداری بیشتر از نمونه پایه بود. اگرچه این افزایش تولید آنزیم توسط قارچ در روز هشتم نیز مشاهده شد، اما در این بازه زمانی به دلیل افزایش طبیعی در ترشح آنزیم در نمونه شاهد، این میزان افزایش، در محیط کشت حاوی عصاره 500 میکروگرم در میلی لیتر عصاره جلبکی در سطح یک درصد معنی دار نبود (شکل 3). جایاراج و همکاران (2008) با تیمار گیاه هویج توسط عصاره جلبک قهوه ای Ascophyllum nodosum و آلوده سازی گیاه با قارچ Alternaria radiciana و Botrytis cinerea نشان دادند که گیاهان تیمار شده پس از 10 روز مقاومت بیشتری در برابر پاتوژن های بیماری زا نسبت به نمونه شاهد و گیاه تیمار شده با سالسیلیک اسید داشته است و میزان ترشح آنزیم های پراکسیداز، پلی فنل اکسیداز، فنیل آلانین آمونیالیاز، کیتیناز و بتاگلوکاناز در نمونه تیمار شده با جلبک قهوه ای نسبت به نمونه شاهد بیشتر بوده است. همچنین سطح بیان ژن های مرتبط با بیماری زایی PR1، PR5، و NPR1 نسبت به نمونه های کنترل منفی و تیمار شده با سالیسیلیک اسید افزایش یافت (29). گویکوچا و همکاران (2004) با پرورش گیاه فلفل با استفاده از محیط کشت تقویت شده با COA H شامل سالیسیلیک اسید، نمک های آمونیومی محلول و عصاره علف دریایی (جلبک قهوه ای) نشان دادند، گیاهان تیمار شده نسبت به نمونه های شاهد پس از تلقیح با قارچ dahliae Verticilliumبا افزایش سطح ترکیبات فنلی در روز هفتم با کاهش شاخص توسعه بیماری، افزایش تحمل و مقاومت را داشتند (30). نتایج این پژوهش نشان داد که ترکیبات پکتینی و سلولزی ساختاری در دیواره جلبک سبز اسپیروژیر در صورتی که در دسترس قارچ آسپرژیلوس قرار گیرند، با فعال سازی سیستم سیگنال دهی بیان ژن های رمز کننده تجزیه کننده این مواد، ترشح این آنزیم ها را تحت تاثیر قرار دهد (30). با توجه به کاهش بیماریزایی قارچ های بیمارگر در گیاهان در هنگام افزودن عصاره جلبکی، این ایده به ذهن پرورانده می شود که افزودن عصاره جلبک باعث تحریک قارچ در گیاه به تولید آنزیم های غیر ضروری برای بیماریزایی شده و این امر تمرکز قارچ برای تولید آنزیم خاص در بیماریزایی بهم می زند و باعث بهبود گیاه می شود در حالیکه هیچ مقاومتی صورت نگرفته و فقط توانایی قارچ بر اثر دریافت مواد محرک خارجی کاهش یافته است. البته افزایش آنزیم های آنتی اکسیدانتی که در واکنش های فوق حساسیت گیاهان به بیمارگرهای اختصاصی نقش دارند می تواند این فرضیه را حداقل برای گیاهان نسبتا متحمل به بیماری تضعیف نماید. ترکیبات پکتینازی تولید شده توسط قارچ های آسپرژیلوس به شکل گسترده ای در صنایع غذایی و کاغذی مورد استفاده قرار می گیرد. از طرفی مشخص شده است که دیواره سلولی جلبک رشته ای اسپیروژیر از دولایه تشکیل شده که بخش درونی را عمدتا ترکیبات سلولزی و لایه بیرونی را ترکیبات پکتینی تشکیل می‌دهند (31). با توجه به خاصیت بالای این جلبک در تحریک قارچ بعنوان یک میکروارگانیسم زنده و با توجه به مطالعات جدید در ارتباط با نقش آنتی اکسیدانتی جلبکها (40)، مطالعه بیشتر در تعیین اثر بخشی این جلبک در مهار رشد سلولهای سرطانی می تواند جالب باشد. استفاده از تکنیکهای مهندسی ژنتیک نظیر استفاده از جهش یافته های برتر در قارچ Trichoderma ressei نشان داده است که این تکنیک باعث تولید جدایه های کارآمد قارچ در تولید آنزیم پکتیناز شده است (41) که استفاده از این جلبک نیز می تواند در کنار تولید جهش یافته ها کارایی قارچ آسپرژیلوس را در تولید آنزیم افزایش دهد.

نتیجه گیری

سطوح ترشح آنزیم های قارچی به طور طبیعی با افزایش زمان تا رشد کامل اندام های رویشی افزایش می یابد، نتایج حاصل از این پژوهش نشان داد که ترکیبات پکتینی جلبک سبز اسپیروژیر می تواند میزان ترشح آنزیم های گروه پلی گالاکتوروناز را به ویژه در روزهای ابتدایی رشد قارچ، به طور معنی داری افزایش دهد. امید است بتوان از ترکیبات تجاری جلبک های سبز به عنوان یک پیش ماده فعال در صنعت، جهت بهره وری بیشتر تولید این گروه از آنزیم ها در قارچ Aspergillus niger و سایر میکروارگانیسم های تولید کننده این دسته از آنزیم ها استفاده شود.

1-Bhagavathy, S., Sumathi, P. and Bell, I.J.S. 2011. Green algae Chlorococcum humicola-a new source of bioactive compounds with antimicrobial activity. Asian Pacific Journal of Tropical Biomedicine 1(1): S1-S7.
2-Bloom, J.D., Meyer, M.M., Meinhold, P., Otey, C.R., MacMillan, D and Arnold, F.H. 2005. Evolving strategies for enzyme engineering. Current Opinion in Structural Biology 15: 447-452.
3-Botella C., Diaz A., De Ory I., Webb C. and Blandino A. 2007. Xylanase and pectinase production by Asprgillusawamori on grape pomeca in solid state fermentation. Process Biochemistry 42: 98- 101.
4- Cheng, Z., Chen, D., Wang, Q., Xian, L., Lu B. and Wei Y. 2017. Identification of an acidic endo-polygalacturonase from Penicillium oxalicum CZ1028 and its broad use in major tropical and subtropical fruit juices production. Journal of Bioscience and Bioengineering 123: 665-672.
5- Chojnacka, K., Kim, S. 2015. Introduction of Marine Algae Extracts. In:Marine Algae Extracts: Processes, Products, and Applications (1st edition). Wiley-VCH Verlag Publisher, Korea:1-13.
6- Cluzet, S., Torregrosa, C., Jacquet, C., Lafitte, C., Fournier, J., Mercier, L., Salamagne, S., Briand, X., Esquerre Tugaye, M.T. and Dumas, B. 2004. Gene expression profiling and protection of Medicago truncatula against a fungal infection in response to an elicitor from green algae Ulva spp. Plant, Cell & Environment 27: 917-928.
7- Demirbas, Ayhan (2010). "Use of algae as biofuel sources." Energy Conversion and Management 51(12): 2738-2749.
8-Denman, S., and McSweeney, C. 2005. Quantitative (real-time) PCR. Methods in Gut Microbial Ecology for Ruminants 105-115.
9- Esawy, M.A., Gamal, A.A., Kamel, Z., Ismail, A.M. S. and Abdel-Fattah, A.F. 2013. Evaluation of free and immobilized Aspergillus niger NRC1ami pectinase applicable in industrial processes. Carbohydrate Polymers 92: 1463-1469
10- Favela-Torres, E., Volke-Sepulveda, T. and Vinigra-Gonzalez, G. 2006. Production of hydrolytic depolymerising pectinases. Food Technology and Biotechnology 44: 222-227.
11- Gawel, N.J. and Jarret, R.L. 1991. A modified CTAB DNA extraction procedure for Musa and Ipomoea. Plant Molecular Biology Reporter 9: 262-266.
12- Goicoechea, N., Aguirreolea, J. and Garcıa-Mina, J. M. 2004. Alleviation of verticillium wilts in pepper (Capsicum annuum L.) by using the organic amendment COA H of natural origin. Scientia horticulturae 101: 23-37.
13- Hannan, A., Bajwa, R. and Latif, Z. 2009. Status of Aspergillus niger strains for pectinases production potential. Pakistan Journal Phytopathology 21(1): 77-82.
14- Heerd, D., Yegin, S., Tari, C. and Fernandez-Lahore, M. 2012. Pectinase enzyme-complex production by Aspergillus spp. in solid-state fermentation: a comparative study. Food and Bioproducts Processing 90(2): 102-110.
15- Heinze, S., Mechelke, M., Kornberger, P., Liebl, W., Schwarz, W. H. and Zverlov, V. V. 2017. Identification of endoxylanaseXynE from Clostridium thermocellum as the first xylanase of glycoside hydrolase family GH141. Scientific Reports 7.
16- Hoa, B. T. and Hung, P.V. 2013. Optimization of nutritional composition and fermentation conditions for cellulase and pectinase production by Aspergillus oryzae using response surface methodology. International Food Research Journal 20(6): 3269-3279
17- Jayaraj, J., Wan, A., Rahman, M. and Punja, Z.K. 2008. Seaweed extract reduces foliar fungal diseases on carrot. Crop Protection27: 1360-1366.
18- Khalaf, M.A. 2008. Biosorption of reactive dye from textile wastewater by non-viable biomass of Aspergillus niger and Spirogyra sp. Bioresource Technology99(14): 6631-6634.
19- Lee, Y.C., Chang, S.P., Lee, C.S. and Kao, N.H., 2013. Influence of pigment extraction on Pb (II) biosorption of Cladophora and Spirogyra algae powder. Advanced Materials Research 610:3591-3598.
20- Lombard, V., GolacondaRamulu, H., Drula, E., Coutinho, P.M. and Henrissat, B. 2013. The carbohydrate-active enzymes database (CAZy) in 2013. Nucleic Acids Research 42(1);490-495.
21- Malvessi, E. and Silveira, M.M.D., 2004. Influence of medium composition and pH on the production of polygalacturonases by Aspergillusoryzae. Brazilian Archives of Biology and Technology 47(5), pp.693-702.
22- MartínezTrujillo, A., ArreguínRangel, L., García Rivero, M. and Aguilar Sorio, G., 2011. Use of fruit residues for pectinase production by Aspergillus flavipes FP‐500 and Aspergillus terreus FP‐370. Letters in Applied Microbiology, 53(2): 202-209.
23- Martos, M., Baumann, A., Cruz, N., Hours, R. and Garro, O., 2012. Partial characterization of enzymatic activities produced by a wild strain of A. niger. The Journal of Microbiology, Biotechnology and Food Sciences 2(3):917.
24- Ramezani, A., Niazi, A., Abolimoghadam, A.A., Babgohari, M.Z., Deihimi, T., Ebrahimi, M. and Ebrahimie, E. 2013. Quantitative expression analysis of TaSOS1 and TaSOS4 genes in cultivated and wild wheat plants under salt stress. Molecular Biotechnology 53: 189-197.
25- Onu, JC. 2015. Production of Bio Fuel Using Green Algea. Journal of Clean Energy Technologies 5: 135- 139.
26- Pedrolli, D.B., Gomes, E., Monti, R. and Carmona, E.C. 2008. Studies on productivity and characterization of polygalacturonase from Aspergillus giganteus submerged culture using citrus pectin and orange waste. Applied Biochemistry and Biotechnology, 144(2):191-200.
27- Pittman, J.K., Dean, A.P. and Osundeko, O., 2011. The potential of sustainable algal biofuel production using wastewater resources. Bioresource Technology, 102(1) pp.17-25.
28- Ramluckan, K., Moodley, K.G. and Bux, F. 2014. An evaluation of the efficacy of using selected solvents for the extraction of lipids from algal biomass by the soxhlet extraction method. Fuel 116: 103-108.
29- Rychlik W .2007. OLIGO 7 primer analysis software. PCR Primer Design, 35-59
30- Sahoo, D. and Seckbach, J. 2015. The Algae World. (Vol. 26). Dordrecht: Springer.
31- Sandri, I.G., Lorenzoni, C.M. T., Fontana, R.C., and Silveira, M.M. 2013. Use of pectinases produced by a new strain of Aspergillus niger for the enzymatic treatment of apple and blueberry juice. LWT-Food Science and Technology 51: 469-475.
32- Semenova, M.V., Grishutin, S.G., Gusakov, A.V., Okunev, O.N. and Sinitsyn, A.P. 2003. Isolation and properties of pectinases from the fungus Aspergillus japonicus. Biochemistry 68: 559-569.
33- Shevchenko, N.M., Burtseva, Y.V., Zvyagintseva, T.N., Makar, T.N., Sergeeva, O.S., Zakharenko, A.M. and Van Huyen, P. 2009. Polysaccharides and sterols from green algae Caulerpa lentillifera and C. sertularioides. Chemistry of Natural Compounds 45: 1-5.
34- Siddiqui,M.A., Pande, V., and Arif, M. 2012. Production, purification, and characterization of polygalacturonase from Rhizomucorpus illus isolated from decomposting orange peels. Enzyme Research 2012.
35- Simms, D., Cizdziel, P.E. and Chomczynski, P., 1993. TRIzol: A new reagent for optimal single-step isolation of RNA. Focus 15(4): 532-535
36- Van den Brink, J. and de Vries, R.P. 2011. Fungal enzyme sets for plant polysaccharide degradation. Applied Microbiology and Biotechnology 91(6): 64-77.
37- Wubben, J.P., ten Have, A., van Kan, J.A. and Visser, J., 2000. Regulation of endopolygalacturonase gene expression in Botrytis cinerea by galacturonic acid, ambient pH and carbon catabolite repression. Current Genetics37:152-157.
38- Yuan J. S., Reed A., Chen F. and Stewart Jr C. N. 2006. Statistical analysis of real time PCR data, MBC Bioanformatic 7: 85.
39- Zhang, XY. and Gao YN. 2004. To design PCR primers with Oligo 6 and Primer Premier 5 [J]. Bioinformatics 4, 003
40- Kiana Pirian, K. and Piri, KH. 2018. Evaluation of antioxidant and a-amylase inhibitory activity of two species Sargassum angostifolium and Palisada perforate. Journal of Molecular and Cellular Research 31(2): 256-267
42- Nazari, R. and Moazemi, N.  2013. Preparation of mutants of Trichoderma reesei PTCC 5142 with increased production of cellulase. Journal of Molecular and Cellular Research 26(3): 393-400