نوع مقاله : مقاله پژوهشی

نویسندگان

1 دانشگاه تبریز

2 ایران، ارومیه، دانشگاه ارومیه، دانشکده کشاورزی و منابع طبیعی، گروه مهندسی تولید و ژنتیک گیاهی

3 بخش تحقیقات اصلاح و تهیه نهال و بذر، مرکز تحقیقات و آموزش کشاورزی و منابع طبیعی استان آذربایجان غربی، سازمان تحقیقات، آموزش و ترویج کشاورزی، ارمیه – ایران

چکیده

شناسایی نشانگرهای چند شکل مرتبط با صفات کمی امکان استفاده موثر از تنوع موجود در بانک‌های ژنی را فراهم می‌سازد. در این مطالعه به منظور شناسایی نشانگرهای مرتبط با 20 صفت زراعی-موروفولوژیک در کتان زراعی (Linum usitatissimum L.) از هفت آغازگرIRAP (Inter-retrotransposon amplified polymorphism) و 13 آغازگر REMAP (Retrotransposon-microsatellite amplified polymorphism) و تجزیه ارتباط به روش مدل خطی مخلوط (Mixed linear model) استفاده شد. صفات زراعی-موروفولوژیک مورد مطالعه شامل ارتفاع بوته، وزن ساقه اصلی، وزن شاخه فرعی، تعداد شاخه‌های اولیه، تعداد شاخه‌های ثانویه، تعداد کپسول ساقه اصلی، تعداد کپسول ساقه فرعی، وزن کپسول ساقه اصلی، وزن کپسول ساقه فرعی، وزن برگ، وزن هزار دانه، عملکرد دانه، عملکرد بیولوژیک، شاخص برداشت، درجه روز از کاشت تا سبز شدن، درجه روز از کاشت تا گلدهی، درجه روز از کاشت تا کپسول‌دهی، درصد روغن، درصد پروتئین و درصد نیتروژن بود. مطالعه ساختار جمعیت به روش بیزین (Bayesian)، بیانگر وجود دو زیر گروه احتمالی (2K=) در جمعیت مورد مطالعه بود. میانگین شاخص تثبیت یا Fst (Fixation index) در دو گروه نسبتا بالا بود که بیانگر تمایز قابل توجه بین دو گروه می‌باشد. بر اساس مدل خطی مخلوط، 21 مکان مرتبط با صفات (P≤0.01) شناسایی شد. صفت وزن برگ بیشترین تعداد مکان پیوسته را دارا بود. نشانگر LTR1833-LTR1868-3 با نواحی ژنومی کنترل‌کننده صفات شاخص برداشت، درصد پروتئین و درصد نیتروژن پیوسته بود. نتایج مطالعه حاضر می‌تواند به عنوان نقطه شروعی جهت استفاده از گزینش به کمک نشانگر در برنامه‌های اصلاحی کتان مفید باشد.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Association analysis for yield and plant characteristics in Iranian flax genotypes (Linum usitatissimum L.) using IRAP and REMAP markers

نویسندگان [English]

  • Hossein Abbasi Holasou 1
  • Babak Abdollahi Mandoulakani 2
  • Abdollah Hassanzadeh Ghorttapeh 3

1 University of Tabriz

2 Dept. of Plant Production and Genetics, Faculty of Agriculture and Natural Resources, Urmia University, Urmia, I.R. of Iran.

3 Seed and Plant Improvement Department, West Azerbaijan Agricultural, and Natural Resources Research and Education Center, AREEO, Urmia, Iran

چکیده [English]

The identification of polymorphic markers associated with various quantitative traits allows us to test their performance for the exploitation of the extensive quantitative variation maintained in gene banks. In the current investigation, 7 IRAP and 13 REMAP primers and mixed linear model (MLM)-based association analysis was used to identify molecular markers associated with 20 agro-morphological traits in cultivated flax (Linum usitatissimum L.). Agro-morphological traits studied, were plant height, primary stem weight, secondary stem weight, number of primary branches, number of secondary branches, number of capsules per primary stem, number of capsules per secondary stem, weight of primary stem capsules, weight of secondary stem capsules, leaf weight, thousand seed weight, grain yield, biological yield, harvest index, days to growing, days to flowering, days to capsuling, oil, protein, and nitrogen percentages. Analysis of population structure revealed two possible subgroups (K=2) in the studied population. Fst mean values of the groups were relatively high, indicating remarkable differentiation among the groups. Association analysis using mixed linear model (MLM) identified 21 loci significantly (p < 0.01) associated with agro-morphological traits. The maximum number of associated loci was identified for leaf weight. LTR1833-LTR1868-3 marker was associated with harvest index, protein and nitrogen percentage. The results of the current study could be as a starting point for using MAS in flax breeding programs.

کلیدواژه‌ها [English]

  • Bayesian analysis
  • Population structure
  • Seed yield
  • Flax
  • Mixed linear model

تجزیه ارتباط عملکرد و برخی صفات گیاهی در ژنوتیپهای کتان ایرانی با استفاده از نشانگرهای IRAP و REMAP

حسین عباسی هولاسو1، بابک عبدالهی مندولکانی2* و عبدالله حسن­زاده قورت تپه3

1 ایران، تبریز، دانشگاه تبریز، دانشکده کشاورزی، گروه به­نژادی و بیوتکنولوژی گیاهی

2 ایران، ارومیه، دانشگاه ارومیه، دانشکده کشاورزی و منابع طبیعی، گروه مهندسی تولید و ژنتیک گیاهی

3 ایران، ارومیه، آموزش و ترویج کشاورزی، سازمان تحقیقات، مرکز تحقیقات و آموزش کشاورزی و منابع طبیعی استان آذربایجان غربی، بخش تحقیقات اصلاح و تهیه نهال و بذر

تاریخ دریافت: 12/2/97             تاریخ پذیرش: 25/10/97

چکیده

شناسایی نشانگرهای چند شکل مرتبط با صفات کمی امکان استفاده مؤثر از تنوع موجود در بانکهای ژنی را فراهم می­سازد. در این مطالعه به منظور شناسایی نشانگرهای مرتبط با 20 صفت زراعی-موروفولوژیک در کتان زراعی (Linum usitatissimum L.) از هفت آغازگرIRAP  (Inter-retrotransposon amplified polymorphism) و 13 آغازگر REMAP (Retrotransposon-microsatellite amplified polymorphism) و تجزیه ارتباط به روش مدل خطی مخلوط (Mixed linear model) استفاده شد. صفات زراعی-موروفولوژیک مورد مطالعه شامل ارتفاع بوته، وزن ساقه اصلی، وزن شاخه فرعی، تعداد شاخه­های اولیه، تعداد شاخه­های ثانویه، تعداد کپسول ساقه اصلی، تعداد کپسول ساقه فرعی، وزن کپسول ساقه اصلی، وزن کپسول ساقه فرعی، وزن برگ، وزن هزار دانه، عملکرد دانه، عملکرد بیولوژیک، شاخص برداشت، درجه روز از کاشت تا سبز شدن، درجه روز از کاشت تا گلدهی، درجه روز از کاشت تا کپسول­دهی، درصد روغن، درصد پروتئین و درصد نیتروژن بود. مطالعه ساختار جمعیت به روش بیزین (Bayesian)، بیانگر وجود دو زیر گروه احتمالی (2K=) در جمعیت مورد مطالعه بود. میانگین شاخص تثبیت یا Fst (Fixation index) در دو گروه نسبتاً بالا بود که بیانگر تمایز قابل توجه بین دو گروه می­باشد. بر اساس مدل خطی مخلوط، 21 مکان مرتبط با صفات (P≤0.01) شناسایی شد. صفت وزن برگ بیشترین تعداد مکان پیوسته را دارا بود. نشانگر LTR1833-LTR1868-3 با نواحی ژنومی کنترل­کننده صفات شاخص برداشت، درصد پروتئین و درصد نیتروژن پیوسته بود. نتایج مطالعه حاضر می­تواند به عنوان نقطه شروعی جهت استفاده از گزینش به کمک نشانگر در برنامه­های اصلاحی کتان مفید باشد.

واژه­های کلیدی: تجزیه بیزین، ساختار جمعیت، عملکرد دانه، کتان، مدل خطی مخلوط

* نویسنده مسئول، تلفن: 09122386990، پست الکترونیکی: [email protected]

مقدمه

 

کتان (Linum usitatissimum L., 2n= 2x=30) یکی از گونه­های ارزشمند جنس لینوم (Linum) است که منبع غنی از اسیدهای چرب ضروری به ویژه اسیدهای چرب امگا 3 و امگا 6 می­باشد. گیاه کتان خودگشن و اندازه ژنوم آن حدود Mb370 می­باشد (23) و علی رغم اهمیت زیاد آن، در کشور ایران کمتر مورد توجه قرار گرفته است. در مقابل، به دلیل ارزش اقتصادی زیاد بذر آن در جوامع محلی، رویشگاههای این گونه مورد برداشتهای شدید قرار گرفته و سالهای سال در معرض فرسایش شدید ژنتیکی است. روشهای اصلاحی مرسوم، پایه­ و اساس بهبود ژنتیکی کتان شده و ارقام جدیدی با مقاومت پایدار به بیماریها، سازگاری زراعی و پایداری عملکرد بالا تولید شده است. با این وجود، پایه ژنتیکی محدودی جهت توسعه ارقام زراعی کتان مورد استفاده قرار گرفته است (9). دسترسی محدود به گونه­هایی با تنوع جدید در این گیاه، کمبود سیستمهای مؤثر جهت تولید واریته­های هیبرید و ابزار ژنومیکی محدود برای اصلاح مولکولی کتان از جمله مواردی است که مانع تولید ارقامی با عملکرد بالا و کیفیت بهتر صفات کیفی در این گیاه شده است (10 و 13).

در کتان عملکرد دانه و اجزاء عملکرد همانند وزن هزار دانه، تعداد دانه در کپسول، و تعداد کپسول در بوته جزء صفات مهم، پیچیده و کمی محسوب می­شوند و توسط تعداد زیادی ژن کنترل می­شوند. فهم اساس ژنتیکی صفات مرتبط با عملکرد از ارزش کاربردی برای اصلاح­گران داراست زیرا چنین اطلاعاتی در طراحی استراتژیهای اصلاحی کمک شایانی خواهد کرد (30). صفات زراعی دیگری همچون زمان گلدهی، ارتفاع گیاه و تعداد شاخه ممکن است به صورت غیر مستقیم توسط مکانیسمهای فیزیولوژیکی متنوعی بر عملکرد اثر بگذارند (18). تخمین مکانهای ژنتیکی کنترل­کننده صفات کمی (QTL) از جمله عملکرد و اجزای آن و دیگر ویژگیهای زراعی در کتان از اهمیت ویژه­ای برای انتخاب به کمک نشانگر (MAS) برخوردار است (30). با استفاده از انتخاب به کمک نشانگر می­توان کارآیی اصلاح صفات مهمی مانند محتوای روغن و عملکرد را در کتان بهبود بخشید (29). با وجود این، انتخاب به کمک نشانگر نیازمند توسعه ابزار ژنومیکی همانند نقشه ژنتیکی و نشانگرهای مولکولی پیوسته با صفات می­باشد (9 و 10).

یکی از برنامه­های کاربردی در مطالعه صفات کمی در دهه اخیر، مکان­یابی ژنهای کنترل­کننده صفات کمی (QTL mapping) است. به طور کلی روشهای مورد استفاده در شناسایی و مکان­یابی جایگاه صفات کمی به دو گروه اصلی نقشه­ یابی پیوستگی (Linkage mapping) و نقشه­یابی ارتباطی (Association mapping) یا نقشه­یابی عدم تعادل لینکاژی (Linkage disequilibrium mapping) تقسیم می­شوند. اگرچه نقشه­یابی ژنهای کنترل­کننده صفات کمی بر اساس تجزیه پیوستگی برای شناسایی مناطق ژنومی تأثیرگذار روی ساختار کتان مؤثر است (29) ولی محدودیتهایی مانند تعداد کم نوترکیبی و در نتیجه پیوستگی ضعیف بین نشانگر و صفت در جمعیتهای دو والدی، و در دسترس نبودن جمعیتهای نقشه­یابی و احتیاج به زمان زیاد برای تولید آنها، وضوح ژنتیکی نسبتاً پایینی را در این روش فراهم می­کند (37). امروزه برای غلبه بر این مشکلات از روش تجزیه یا مکان­یابی ارتباطی به عنوان روش تلفیقی جهت شناسایی ارتباطات بین نشانگر و صفت استفاده می­شود که به طور گسترده­ای در ژنتیک انسانی و جانوری که در آنها ایجاد جمعیتهای در حال تفرق بزرگ غیر ممکن می­باشد استفاده می­شود (17). در تجزیه ارتباط، رابطه بین ژنوتیپ و فنوتیپ گیاه مستقیماً برای شناسایی نواحی کروموزومی دخیل در کنترل صفت با استفاده از عدم تعادل پیوستگی موجود در جمعیتهای طبیعی و مجموعه­های ژرم­پلاسم بررسی می­شود (7). در اینگونه مطالعات به دلیل اینکه از جوامع طبیعی استفاده می­شود­ اولا تنوع ژنتیکی وسیع­تری نسبت به جمعیتهای حاصل از تلاقی دو والدی مورد بهره­برداری قرار می­گیرد، ثانیا از آنجایی که در این نوع نقشه­یابی تمام رویدادهای میوزی که در طول تاریخچه تکاملی گیاه انباشته شده است در نظر گرفته می­شود دقت نقشه­یابی بالاتر است (31).

در پژوهشی سوتو-سردا و همکاران ( b2014) برای شناسایی QTL­های مؤثر در محتوای روغن و اسیدهای چرب کتان، جمعیتی شامل 390 ژنوتیپ کتان کانادایی را با استفاده از 464 نشانگر SSR در سه سال و در شش محیط مورد بررسی قرار دادند. در این تحقیق  نه QTL برای صفت محتوای روغن شناسایی شد، که 58 درصد از اللهای QTL در ارقام کانادایی اختصاصی بودند (29). در مطالعه­ای دیگر تجزیه ارتباط نه صفت زراعی با 112 نشانگر SSR در 532 ژنوتیپ کتان کانادایی نشان داد که برخی از نشانگرها با بیش از یک صفت در ارتباط هستند (30). گلشن و همکاران (1396) به منظور مطالعه ارتباط 13 آغازگر چند شکل RAPD (آغازگرهای سری OPA، OPB و OPD) با 13 صفت مورفولوژیکی کتان زراعی از تجزیه رگرسیون گام به گام استفاده نمودند. نتایج آنها نشان داد که هر یک از نشانگرهای  OPA-06 و OPB-05 با هشت صفت مورد بررسی رابطه معنی داری دارند و ضریب تبیین مربوط به این دو نشانگر در حدود 98/0 بود. سایر صفات نیز با حداقل یک و حداکثر پنج نشانگر ( ضریب تبیین حدود 45/0 الی 99/0) ارتباط معنی داری نشان دادند (3).

علی­رغم اهمیت اقتصادی کتان در ایران، در زمینه شناسایی و مکان­یابی ژنهای کنترل­کننده صفات مهم در این گیاه تحقیقات زیادی صورت نگرفته است. هدف از این تحقیق، تجزیه ارتباط برای صفات زراعی-مورفولوژیک در کتان زراعی با استفاده از نشانگرهای رتروترنسپوزنی IRAP و REMAP می­باشد. شناسایی مکانهای ژنی کنترل­کننده صفات می­تواند به اصلاح­گران در پیشبرد مؤثر برنامه­های گزینشی در اصلاح ارقام با پتانسیل عملکرد بالا کمک شایانی نماید.

مواد و روشها

مواد گیاهی و ارزیابی فنوتیپی: در این مطالعه 80 فرد متعلق به 9 جمعیت کتان زراعی (جدول 1) بر پایه طرح بلوکهای کامل تصادفی در مزرعه تحقیقاتی مرکز تحقیقات کشاورزی و منابع طبیعی آذربایجان غربی در 3 تکرار روی خطوطی به طول دو متر کشت شده و 20 صفت زراعی-موروفولوژیک یادداشت گردید. صفات مورد مطالعه شامل ارتفاع بوته (سانتیمتر)، وزن ساقه اصلی (گرم)، وزن شاخه فرعی (گرم)، تعداد شاخه­های اولیه، تعداد شاخه­های ثانویه، تعداد کپسول ساقه اصلی، تعداد کپسول ساقه فرعی، وزن کپسول ساقه اصلی (گرم)، وزن کپسول ساقه فرعی (گرم)، وزن برگ (گرم)، وزن هزار دانه (گرم)، عملکرد (کیلوگرم/هکتار)، عملکرد بیولوژیکی (کیلوگرم در هکتار)، شاخص برداشت، روز از کاشت تا سبز شدن، روز از کاشت تا گلدهی، روز از کاشت تا کپسول­دهی، درصد روغن، درصد پروتئین و درصد نیتروژن بود (30).

 

جدول 1- محل جمع­آوری، کد جمعیتها، تعداد افراد هر جمعیت و اطلاعات جغرافیایی جمعیتهای کتان مورد استفاده در این مطالعه

کد جمعیتها

محل جمع­آوری

تعداد افراد هر جمعیت

طول جغرافیایی

عرض جغرافیایی

ارتفاع از سطح دریا

TN97-33

زابل

10

ʹ1 °31

ʹ30 °61

483

TN97-55

بناب

10

ʹ20 °37

ʹ3 °46

1288

TN97-92

شاهیندژ

10

ʹ40 °36

ʹ34 °46

1370

TN97-106

مشکین­شهر

10

ʹ23 °38

ʹ40 °47

1422

TN97-246

اراک

8

ʹ5 °34

ʹ41 °49

1748

TN97-273

اصفهان

9

ʹ39 °32

ʹ40 °51

1579

TN97-27442

زنجان

9

ʹ40 °36

ʹ28 °48

1644

TN97-27819

اردبیل

7

ʹ15 °38

ʹ16 °48

1349

TN97-907A

کرج

7

ʹ50 °35

ʹ56 °50

1301

 


ارزیابی ژنتیکی: DNA ژنومی نمونه­های گیاهی به روش CTAB (15) در پژوهشکده زیست فناوری دانشگاه ارومیه استخراج شد. کیفیت و کمیت DNA استخراج شده با استفاده از ژل آگارز یک درصد و اسپکتوفتومتری (Bio-Photometer 6131, Eppendorf, Germany) ارزیابی شد. 10 آغازگر IRAP و 84 آغازگر REMAP (26) جهت ارزیابی چندشکلی ادغامی و ثبت ژنوتیپ در افراد مورد مطالعه استفاده شد (جدول 2). تکثیر قطعات DNA در یک واکنش 20 میکرولیتری حاوی بافر PCR ده برابر، 2/0 میکرومولار dNTP، 5/1 میلی مولار MgCl2، 10 پیکومول آغازگر، 5/0 واحد آنزیم Taq polymerase و 20 نانوگرم DNA ژنومی در دستگاه ترموسایکلر اپندورف صورت گرفت. الگوی دمایی واکنشهای PCR شامل واسرشت سازی اولیه در 94 درجه سانتی­گراد به مدت 4 دقیقه، سپس 35 چرخه شامل 45 ثانیه در 94 درجه سانتی­گراد، 40 ثانیه در 55 درجه سانتی­گراد، دو دقیقه در 72 درجه سانتی­گراد و تکثیر نهایی در 72 درجه سانتی­گراد به مدت 5 دقیقه انجام شد. الکتروفورز محصولات PCR در ژل آگارز 8/1 درصد و بافر TBE نیم برابر در ولتاژ 80 به مدت 3 ساعت انجام شد. برای رنگ­آمیزی ژلها از اتیدیوم بروماید استفاده شد.

 

جدول 2-توالی آغازگرهای مورد استفاده در این مطالعه (اسمایکل و همکاران، 2011) (26)

توالی  (5'-3')

آغازگر

توالی (5'-3')

آغازگر

ACACACACACACACACACT

UBC443

CTTGCTGGAAAGTGTGTGAGAGG

LTR1833

CTCTCTCTCTCTCTCTT

UBC815

GCATCAGCCTGGACCAGTCCTCGTCC

LTR1854

ACACACACACACACACT

UBC825

CACTTCAAATTTTGGCAGCAGCGGATC

LTR1868

ACACACACACACACACC

UBC826

ATTCTCGTCCGCTGCGCCCCTACA

LTR1886

CACACACACACACACARG

UBC848

GTGTGTGTGTGTCC

A13

ACACACACACACACACYT

UBC855

GAGAGAGAGAGACC

UBC425

R : پورین A/G)) ،   : Yپریمیدین  (C/T)

R: purine (A/G), Y: pyrimidine (C/T)


تجزیه­های آماری: باندهای حاصل از هر دو نشانگر به صورت یک (حضور) و صفر (عدم حضور) امتیازدهی و ماتریس حاصل برای بررسی ساختار جمعیت استفاده شد. ساختار جمعیت و تعداد زیرجمعیتهای احتمالی بر اساس داده­های حاصل از تلفیق دو نشانگر با استفاده از نرم­افزار STRUCTURE 2.3.4 و مدل بیزین (21) در حالت Admixture با 50000 بار Burn-in و 50000 بار تکرار ماتریس سهم عضویت (Q) برآورد شد. همچنین میانگین شاخص تثبیت (Fst) برای زیرگروههای احتمالی نیز با استفاده از همین نرم­افزار برآورد گردید. عدد K بهینه (تعداد زیرجمعیتهای احتمالی) بر اساس روش Delta K (12) با استفاده از نرم­افزار STRUCTURE HARVESTER (11) تعیین شد. ماتریس روابط خویشاوندی افراد (ماتریس Kinship) و تجزیه ارتباط به روش مدل خطی مخلوط (MLM) با نرم­افزار TASSEL 3 انجام گرفت (5) و نشانگرهای پیوسته با صفات مورد بررسی در سطح معنی­دار یک درصد مشخص شد. در مدل MLM علاوه بر ساختار جمعیت (ماتریس Q)، روابط خویشاوندی بین افراد جمعیت (ماتریس K) نیز در تجزیه ارتباط به عنوان متغیر کمکی در نظر گرفته می­شود و بنابراین ارتباطات و پیوستگیهای کاذب بین نشانگر و صفت به حداقل می­رسد (34 و 36).

نتایج

ساختار ژنتیکی جمعیت: چهار آغازگر منفرد، سه ترکیب آغازگری IRAP و 13 ترکیب آغازگری REMAP الگوی باندی چندشکل و قابل امتیازدهی تولید کردند (شکل 1). در کل 210 مکان تکثیر شد که از این تعداد، 119 مکان (67/56 درصد) چند شکل بودند. مهمترین محدودیت جهت استفاده از تجزیه ارتباط در گیاهان زراعی، ناشناخته بودن ساختار جمعیت و اختلاط جمعیت به علت فاکتورهایی همانند اهلی­کردن و سازگاری جمعیت می­باشد (32). در بررسی ساختار جمعیت بر اساس مقادیر LnP (D) و Delta K (ΔK)، دو زیر جمعیت (شکل 2) در بین 80 فرد مشخص و مقدار 2K= مناسب­ترین عدد برای محاسبه متوسط شاخص تثبیت برای هر گروه برآورد شد. در بارپلات ارائه ­شده، محور افقی مربوط به افراد و محور عمودی سهم تعلق افراد به هر گروه را نشان می­دهد (شکل 3). همچنین در این پلات هر گروه با رنگی متمایز مشخص شده است که دو رنگ مجزا از هم برای هر فرد نشان دهنده تعلق آن فرد به یکی از دو گروه یا هر دو گروه می­باشد. متوسط شاخص تثبیت برای گروههای احتمالی I و II به ترتیب 25/0 و 12/0 بود. در هر دو گروه مقادیر متوسط Fst نسبتاً بالا بود که نشان­دهنده متمایز بودن ژنوتیپهای مورد مطالعه در دو گروه احتمالی است. ماتریس سهم عضویت افراد در این دو گروه (جدول 3) نیز نشان داد که ژنوتیپها با ضرایب بالایی به یک گروه تعلق دارند.

جدول 3- ماتریس سهم عضویت جمعیتهای کتان در هر کلاستر بر اساس محاسبات نرم­افزار Structure 2.3.1 در 2K=

جمعیت

گروه

 

1

2

زابل

75/0

25/0

بناب

94/0

06/0

شاهیندژ

88/0

12/0

مشکین­شهر

80/0

20/0

اراک 

86/0

14/0

اصفهان

86/0

14/0

زنجان

87/0

13/0

اردبیل

78/0

23/0

کرج

63/0

37/0

 

 

 

شکل 1- الگوی باندی مربوط به آغازگر منفرد LTR1854، M: نشانگر وزن مولکولی بر حسب bp، اندازه باندها بر حسب جفت باز می­باشد، 10 نمونه اول از سمت چپ مربوط به جمعیت شاهیندژ و 10 نمونه دوم مربوط به جمعیت زابل می­باشد.

 

شکل 2- نمودارهای دو سویه برای تعیین تعداد مناسب زیر جمعیت در ژنوتیپهای کتان زراعی مورد مطالعه (2(K= بر اساس نشانگرهای رتروترنسپوزونی IRAP و REMAP با استفاده از نرم­افزار Structure 2.3.1

 

شکل 3- تجزیه کلاستر مبتنی بر مدل بیزین (Bayesian) برای 80 فرد کتان مورد مطالعه بر اساس 20 آغازگر IRAP و REMAP (2(K=. هر رنگ یک زیر جمعیت یا کلاستر را نشان می­دهد. اعداد روی محور افقی و عمودی به ترتیب شماره افراد و ضریب تعلق هر فرد به هر کلاستر را نشان می­دهد.


تجزیه ارتباط: در این مطالعه برای شناسایی نشانگرهای پیوسته با صفات مورد مطالعه و حذف پیوستگیهای دروغین نشانگر-صفت از روش MLM استفاده شد. از 210 نشانگر تکثیری، 21 نشانگر (13 نشانگر REMAP و هشت نشانگر IRAP) با 11 صفت پیوستگی معنی داری (P≤0.01) نشان دادند (جدول 4).

 

جدول 4- نشانگرهای پیوسته با صفات مورد مطالعه در 80 فرد کتان

صفت

مکان

نوع مارکر

P-value

R2

وزن برگ

LTR1868-UBC848-4

REMAP

009/0

095/0

LTR1868-UBC848-6

REMAP

009/0

097/0

LTR1886-A13-8

REMAP

001/0

133/0

LTR1886-A13-11

REMAP

0002/0

183/0

شاخص برداشت

LTR1833-LTR1868-3

IRAP

006/

100/0

LTR1854-LTR1868-9

IRAP

004/0

117/0

LTR1868-A13-9

REMAP

007/0

095/0

درجه روز تا گلدهی

LTR1886-UBC425-5

REMAP

003/0

111/0

LTR1854-UBC848-4

REMAP

005/0

102/0

LTR1854-A13-4

REMAP

0008/0

151/0

درصد پروتئین (%)

LTR1833-LTR1868-3

IRAP

006/0

100/0

 

LTR1868-UBC826-10

REMAP

003/0

116/0

درصد نیتروژن (%)

LTR1833-LTR1868-3

IRAP

006/0

100/0

 

LTR1868-UBC826-10

REMAP

003/0

116/0

وزن کپسول ساقه اصلی

LTR1868-LTR1886-7

IRAP

007/0

097/0

LTR1854-UBC443-4

REMAP

00005/0

237/0

عملکرد بیولوژیکی

LTR1854-4

IRAP

007/0

098/0

وزن شاخه فرعی

LTR1854-LTR1868-13

IRAP

008/0

090/0

تعداد کپسول ساقه اصلی

LTR1854-UBC443-3

REMAP

005/0

106/0

وزن کپسول ساقه فرعی

LTR1886-3

IRAP

007/0

096/0

درجه روز تا کپسول­دهی

LTR1854-UBC443-5

REMAP

0001/0

208/0

 

مقدار شاخص R2 (ضریب تغییرات فنوتیپی توجیه شده) از 090/0 (LTR1854-LTR1868-13) تا 23/0 (LTR1854-UBC443-4) متغیر بود. مقدار احتمال (P-value) از 0000509/0 (LTR1854-UBC443) تا 009/0 (LTR1868-UBC848-4 و LTR1868-UBC848-6) متغیر بود. تعداد چهار مکان پیوسته با صفت وزن برگ، سه مکان پیوسته با شاخص برداشت، سه مکان پیوسته با درجه روز تا گلدهی، دو مکان پیوسته با وزن کپسول ساقه اصلی، دو مکان پیوسته با درصد پروتئین، دو مکان پیوسته با درصد نیتروژن، یک مکان پیوسته با عملکرد بیولوژیکی، یک مکان پیوسته با وزن شاخه فرعی، یک مکان پیوسته با تعداد کپسول ساقه اصلی، یک مکان پیوسته با وزن کپسول ساقه فرعی و یک مکان پیوسته با درجه روز تا کپسول­دهی شناسایی شد.

بحث

با توجه به اینکه در تجزیه ارتباط و شناسایی نشانگرهای مرتبط با صفات، یکی از ارکان اساسی بررسی ساختار جمعیت است، بنابراین ابتدا ساختار جمعیت مورد مطالعه با استفاده از هفت آغازگر IRAP و 13 آغازگر REMAP مورد بررسی قرار گرفت. این آغازگرها در کل 119 مکان ژنومی را تکثیر نمودند که 67/56 درصد مکانهای تکثیری دارای چندشکلی بودند. چندشکلی نسبتاً بالای حاصل در پژوهش حاضر را می­توان به فعالیت بالای رتروترنسپوزونها در ژنوم کتان و درج آنها در نواحی یوکروماتینی و ژنی و وسعت مناطق جغرافیایی نمونه­برداری شده نسبت داد (26). اسمایکل  و همکاران (2011) با استفاده از روش iPBS حدود 90 خانواده رتروترنسپوزونی LTR دار کتان (L. usitatissimum) شناسایی و گزارش نمودند که این رتروترنسپوزون­ها در گونه­های مختلف جنس لینوم (Linum) فعال بوده و چندشکلی قابل توجهی نشان می­دهند و می­توان از آنها به عنوان نشانگرهای مولکولی در این جنس استفاده نمود (26). در مطالعه ملنیکوا و همکاران (2014)، از بین آغازگرهای مورد مطالعه دو آغازگر LTR1845 و LTR1899 با فعالیت ادغامی بالا به عنوان آغازگرهای منحصر به فرد شناخته شده و برای بررسی تنوع ژنتیکی واریته­های کتان مورد استفاده قرار گرفتند (20).

ساختار ژنتیکی جمعیت نشان­دهنده اثر متقابل بین گونه­ها با توجه به تاریخ تکامل طولانی مدت، جهش و نوترکیبی، رانده­شدگی ژنتیکی، سیستم تولید مثلی، جریان ژنی و انتخاب طبیعی می­باشد (25). بنابراین ارزیابی ساختار ژنتیکی پیش نیاز حفاظت و استفاده کارآمد از ژرم­پلاسم در دسترس برای برنامه­های اصلاحی می­باشد (19). همچنین در مطالعات تجزیه ارتباط در حالت ایده­آل نباید ساختاری در جمعیت مورد مطالعه وجود داشته باشد، یعنی جمعیت نباید خود به لحاظ ساختاری به زیر گروهها تقسیم شود، زیرا وجود ساختار در جمعیت می­تواند عامل بازدارنده در جهت دستیابی به نتایج قابل اعتماد باشد. در صورتی­که اثر ساختار جمعیت و روابط خویشاوندی در تجزیه ارتباط در نظر گرفته نشوند، احتمال حصول نتایج مثبت کاذب در مطالعه وجود خواهد داشت (6). بنابراین آگاهی از ساختار جمعیت به عنوان یک پیش­نیاز در نقشه­یابی ارتباطی می­تواند به منظور اجتناب از ارتباطات دروغین بین نشانگرها و صفات استفاده شود (22). به همین منظور، در این تحقیق ساختار ژنتیکی جمعیت و تعداد مناسب زیر جمعیتها بر اساس روش بیزین در نرم­افزار Structure برآورد شد تا به عنوان کوواریت در تجزیه ارتباط در نظر گرفته شود. بر اساس نتایج حاصل، دو زیرجمعیت احتمالی در ژرم­پلاسم مورد مطالعه شناسایی شد (شکل 2) که به عنوان K بهینه در تخمین ساختار جمعیت و ماتریس سهم عضویت افراد در هر کلاستر (ماتریس Q) در نظر گرفته شد. در گروه اول متوسط شاخص تثبیت بیش از 21/0 بود که نشان­دهنده تمایز نسبتاً بالا و جریان ژنی نسبتاً پایین بین جمعیتها می­باشد (8).

نقشه­یابی ارتباطی به منظور تشخیص و شناسایی ارتباط بین نشانگر-صفت نیازمند وجود تنوع ژنتیکی و فنوتیپی بالا در جمعیت مورد مطالعه می­باشد (37). وجود ساختار و روابط خویشاوندی در جمعیت مورد مطالعه منجر به ایجاد ارتباط کاذب نشانگر-صفت در نقشه­یابی ارتباطی می­شود (2). مدلهای مختلفی برای کاهش نتایج مثبت کاذب در تجزیه ارتباط مورد استفاده قرار می­گیرد که از آن جمله می­توان به ماتریس K در داخل مدل K و ماتریس Q در داخل مدل Q اشاره نمود. مدل دیگر Q+K می­باشد که ترکیبی از دو مدل قبلی است و تأثیر آن در کاهش نتایج مثبت کاذب بیشتر از دو مدل Q و K می­باشد (33).

در مدل خطی عمومی (GLM) تنها ساختار جمعیت، ولی در مدل خطی مخلوط (MLM) علاوه بر ماتریس ساختار جمعیت (ماتریس Q)، ماتریس روابط خویشاوندی (ماتریس K) بین افراد جمعیت نیز در تجزیه ارتباط به­عنوان کوواریت در نظر گرفته می­شوند و بنابراین ارتباطات و پیوستگیهای دروغین بین نشانگر و صفت به حداقل می­رسد. همچنین میزان تأثیر نشانگرها به وسیله ضریب Benferroni تصحیح گردید که این تصحیح نیز باعث کاهش ارتباطات دروغین نشانگر صفت می­شود (35). با کاربرد مدل MLM در کتان نیز، بهبود معنی­داری در کاهش نتایج مثبت دروغین در بررسی صفاتی مانند وزن هزار دانه، ارتفاع گیاه، شروع گلدهی، پایان گلدهی و شاخه­دهی گیاه در مقایسه با مدلهای خطی منفرد K یا Q نشان داده شده است (30). سوتو-سردا و همکاران (2013) در مکان­یابی ارتباطی در ژرم­پلاسم کتان روغنی و فیبری اظهار داشتند که استفاده از مدل MLM به کاهش نتایج مثبت دروغین (ارتباطات کاذب نشانگر-صفت) و اریبی کمتر نتایج کمک زیادی می­کند (27). عبدالهی مندولکانی و عزیزی (1393) برای شناسایی نشانگرهای مرتبط با صفات مورفولوژیک در یونجه از تجزیه ارتباط مبتنی بر نشانگرهای ISSR استفاده نمودند و بیان کردند که این روش برای شناسایی مکانهای آگاهی بخش مرتبط با صفات مورفولوژیک مفید و مطمئن بوده و نشانگرهای حاصل از این مطالعات می­تواند در برنامه­های گزینش به کمک نشانگر و تهیه جمعیتهای نقشه­یابی استفاده شوند (1). هوشیاردل و همکاران (1394) جهت شناسایی مکانهای ژنی کنترل­کننده زمان گلدهی در جمعیت ژنتیکی شامل 100 فرد F2 حاصل از تلاقی ژنوتیپ توتون شرقی SPT406 (والد پدری) و Basma seres 31 (والد مادری) با استفاده از روشهای مکان­یابی فاصله­ای ساده و مرکب به ترتیب 9 و 2 QTL برای صفت مورد مطالعه شناسایی کردند (4). در مطالعه حاضر از روش MLM جهت شناسایی مکانهای پیوسته با ژنهای کنترل­کننده صفات زراعی-مورفولوژیک استفاده شد که در نهایت 21 مکان پیوسته با 20 صفت شناسایی شد. سوتو-سردا و همکاران ( a2014) با استفاده از نشانگرهای SSR، نه نشانگر را در Pale flax و پنج نشانگر را در کتان زراعی شناسایی نمودند که رابطه معنی­داری با صفات مختلف زراعی-مورفولوژیک نشان می­دادند (28). بیشترین تعداد مکان پیوسته (چهار مکان) برای صفت وزن برگ و کمترین تعداد (یک مکان) برای صفات عملکرد بیولوژیکی، وزن شاخه فرعی، تعداد کپسول ساقه اصلی، وزن کپسول ساقه فرعی و درجه روز تا کپسول­دهی شناسایی شد (جدول 4). نتایج حاصله با نتایج سوتو-سردا و همکاران ( c2014) که وزن هزار دانه (با پنج مکان) بیشترین تعداد مکان پیوسته را به خود اختصاص داد مغایر بود (30). این تفاوت ممکن است به دلیل نوع نشانگرهای مورد استفاده و اندازه جمعیت در هر تحقیق باشد. مکان LTR1854-UBC443-4 (مرتبط با صفت وزن کپسول ساقه اصلی) بیشترین مقدار ضریب تغییرات فنوتیپی توجیه شده (R2) را داشت. از این رو می­توان گفت که 23 درصد از تنوع فنوتیپی صفت وزن کپسول ساقه اصلی توسط این مکان توجیه می­شود. کم بودن مقدار ضریب تبیین (R2) برای اکثر نشانگرهای مرتبط مؤید ماهیت توارث کمی و چندژنی صفات مورد ارزیابی می­باشد و نشان­دهنده توجیه بخش کمی از تغییرات این صفات از طریق مکانهای ژنی شناسایی شده و بنابراین تأثیر بیشتر اثر محیط روی تغییرات این صفات می­باشد. در این تحقیق، برای برخی از صفات مکانهای مشترک شناسایی شد. به عنوان مثال مکان LTR1833-LTR1868-3 با سه صفات زراعی-مورفولوژیک مورد مطالعه پیوستگی نشان داد (جدول 4). شناسایی مکانهای مشترک می­تواند ناشی از اثرات پلیوتروپی و یا پیوستگی نواحی ژنومی دخیل در کنترل این صفات باشد (16). وجود چنین حالتی کارآیی گزینش بر اساس نشانگر را افزایش داده و موجب می­شود به دنبال اصلاح یک صفت در یک گیاه، احتمال افزایش یا کاهش ارزش صفات همبسته دیگر نیز وجود داشته باشد (14). بهبود عملکرد کتان از طریق اجزاء عملکرد و صفات وابسته همانند زمان گلدهی می­تواند مفید باشد. از طرف دیگر عملکرد بذر به عنوان صفت اقتصادی مهم در این گیاه به شمار می­آید که عوامل زیادی همچون ژنوتیپ و محیط روی آن تأثیر می­گذارند (30). بنابراین از مکانهای LTR1833-LTR1868-3، LTR1854-LTR1868-9، LTR1868-A13-9، LTR1868-LTR1886-7، LTR1854-UBC-4 و LTR1854 -4 در صورت تأیید می­توان برای گزینش افراد جهت افزایش شاخص برداشت، وزن کپسول ساقه اصلی و عملکرد بیولوژیکی و در نتیجه افزایش عملکرد بذر و عملکرد روغن کتان بهره جست. عملکرد روغن از ترکیب عملکرد بذر و مقدار روغن به دست می­آید. بنابراین کاهش عملکرد دانه باعث کاهش عملکرد روغن می­شود (30). نتایج این تحقیق می­تواند در انتخاب غیر مستقیم صفات از طریق نشانگرهای مرتبط و پیوسته با آنها مفید ­باشد. البته برای اطمینان از وجود ارتباط پیوستگی بین نشانگرها و صفات مختلف زراعی-مورفولوژیک نیاز به تهیه جمعیتهای تفرق مانند F2، RIL و DH می­باشد تا بر اساس این جمعیتها نقشه­های پیوستگی تهیه و سپس محل مکانهای کنترل­کننده این صفات روی کروموزومها مشخص شود (24). نتایج مطالعه حاضر بیانگر کارآیی مدل MLM در شناسایی نشانگرهای پیوسته با صفات مهم مرتبط با عملکرد دانه در ژنوتیپهای کتان زراعی می­باشد. البته بهتر است جهت افزایش کارآیی شناسایی نشانگرهای مرتبط، از نشانگرهای بیشتر و مؤثرتر مانند نشانگرهای SNP و SSR در مطالعات تجزیه ارتباط استفاده شود. همچنین لازم است نشانگرهای شناسایی شده در چنین مطالعاتی در جمعیتهای بزرگ با تنوع ژنتیکی بالا مورد بررسی قرار گیرند تا از ارتباط آنها با صفات مورد مطالعه اطمینان حاصل شود و بدین ترتیب کارآیی کاربرد این نشانگرها در برنامه­های به­نژادی کتان زراعی افزایش یابد.

1-عبدالهی مندولکانی، ب. و عزیزی، ح. 1393. شناسایی نشانگرهای ISSR پیوسته با صفات مورفولوژیک در جمعیت­های یونجه زراعی (Medicago sativa L.). مجله پژوهشهای سلولی و مولکولی. 27(2):260-268.
2-عطایی، ر.، محمدی، و.، طالعی، ع. و نقوی، م.ر. 1392. نقشه­یابی ارتباطی صفات ریشه در جو. مجله علوم گیاهان زراعی ایران. 44 (2): 357-347.
3-گلشن، م.، رحمانی، ف. و عباسی هولاسو، ح. 1396. شناسایی نشانگر RAPD پیوسته با صفات مورفولوژیک و تعیین ساختار جمعیت در ارقام کتان زراعی (Linum usitassimum L.). پژوهشنامه اصلاح گیاهان زراعی. 21(9): 165-156.
4-هوشیاردل، ف.، درویش­زاده، ر. و حاتمی ملکی، ح. 1394. شناسایی مکان­های ژنی کنترل­کننده زمان گلدهی توتون تیپ شرقی. مجله پژوهشهای سلولی و مولکولی. 28(3): 438-447.
 
5-Bradbury, P.J., Zhang, Z., Kroon, D.E., Casstevens, T.M., Ramdoss, Y. and Buckler, E.S. 2007. TASSEL: software for association mapping of complex traits in diverse samples. Bioinformatics, 23: 2633-2635.
6-Breseghello, F. and Sorrells, M.E. 2006. Association mapping of kernel size and milling quality in wheat (Triticum aestivum L.) cultivars. Genetics, 172: 1165-1177.
7-Buckler, E.S. and Thornsberry, J.M. 2002. Plant molecular diversity and applications to genomics. Current Opinion in Plant Biology, 5: 107-111.
8-Carvalho, A., Guedes-Pinto, H. and Lima Brito, J.E. 2011. Genetic diversity in old Portuguese durum wheat cultivars assessed by retrotransposon-based markers. Plant Molecular Biology Reporter, 30: 578-589.
9-Cloutier, S., Niu, Z., Datla, R. and Duguid, S. 2009. Development and analysis of EST-SSRs for flax (Linum usitatissimum L.). Theoretical and Applied Genetics, 119: 53–63.
10-Cloutier, S., Miranda, E., Ward, K., Radovanovic, N., Reimer, E., Walichnowski, A., Datla, R., Rowland, G., Duguid, S. and Ragupathy, R. 2012. Simple sequence repeat marker development from bacterial artificial chromosome end sequences and expressed sequence tags of flax (Linum usitatissimum L.). Theoretical and Applied Genetics, 125:685–694.
11-Earl, D.A., Louie, K.D., Bardeleben, C., Swift, C.C. and Jacobs, D.K, 2010. Rangewide microsatellite phylogeography of the endangered tidewater goby, Eucyclogobius newberryi (Teleostei: Gobiidae), a genetically subdivided coastal fish with limited marine dispersal. Conservation Genetics, 11: 103-114.
12-Evanno, G., Regnaut, S. and Goudet, J. 2005. Detecting the number of clusters of individuals using the software STRUCTURE: a simulation study. Molecular Ecology, 14: 2611-2620.
13-Green, A.G., Chen, Y., Singh, S.P. and Dribnenki, J.C.P. 2008. Flax. In: Kole C, Hall TC, eds. Compendium of Transgenic Crop Plants: Transgenic Oilseed Crops. Blackwell Publishing Ltd., Oxford. pp. 199–226.
14-Hittalmani, S., Huang, N., Courtois, B., Venuprasad, R., Shashidhar, H.E., Zhuang, J.Y., Zheng, K.L., Liu, G.F., Wang, G.C., Sidhu, J.S., Srivantaneeyakul, S., Singh, V.P., Bagali, P.G., Prasanna, H.C., McLaren, G. and Khush, G.S. 2003. Identification of QTL for growth and grain yield-related traits in rice across nine locations of Asia. Theoretical and Applied Genetics, 107: 679-90.
15-Hosseinzadeh Colagar A., Saadati, M., Zarea, M. and Ahmadi Talei, S. 2010. Genetic variation of the Iranian Sclerotinia sclerotiorum isolates by standardizing DNA polymorphic fragments. Biotechnology (-Pakistan), 9(1): 67-72.
16-Jun, T.H., Van, K., Kim, M.Y., Lee, H.S. and Walker, D.R. 2008. Association analysis using SSR markers to find QTL for seed protein content in soybean. Euphytica, 162: 179-191.
17-Karlsson, E.K., Baranowska, I., Wade, C.M., Hillbertz, N.H.C.S. and Zody, M.C. 2007. Efficient mapping of Mendelian traits in dogs through genome-wide association. Nature Genetics, 39: 1321-1328.
18-Li, Y., Smulders, M.J.M., Chang, R. and Qiu, L. 2011. Genetic diversity and association mapping in a collection of selected Chinese soybean accessions based on SSR marker analysis. Conservation Genetics, 12(5):1145–1157.
19-Li, M., Zhao, Z., Miao, X. and Zhou. J. 2014. Genetic diversity and population Structure of Siberia apricot (Prunus Siberia L.) in China. International Journal of Molecular Sciences, 15: 377-400.
20-Melnikova, N.V., Kudryavtseva, A.V., Zelenin, A.V., Lakunina, V.A., Yurkevich, O.Y., Speranskaya, A.N., Dmitriev, A.A., Krinitsina, A.A., Belenikim, M.S., Uroshlev, L.A., Snezhkina, A.V., Sadritdinova, A.F., Koroban, N.V., Amosova, A.V., Samatadze, T.E., Guzenko, E.V., Lemesh, V.A., Savilova, A.M., Rachinskaia, O.A., Kishlyan, N.V., Rozhmina, T.A., Bolsheva, N.L. and Muravenko, O.V. 2014. Retrotransposon-based molecular markers for analysis of genetic diversity within the genus Linum. BioMed Research International, 231589.
21-Pritchard, J.K., Stephanes, M., Rosenberg, N.A. and Donnelly, P. 2000. Association mapping in structured populations. American Journal of Human Genetics, 67: 170-181.
22-Pritchard, J.K. and Donnelly, P. 2001. Casecontrol studies of association in structured or admixed populations. Theoretical Population Biology, 60: 227-237.
23-Ragupathy, R., Rathinavelu, R. and Cloutier, S. 2011. Physical mapping and BAC-end sequence analysis provide initial insights into the flax (Linum usitatissimum L.) genome. BMC Genomics, 12(1):217. doi: 10.1186/1471-2164-12-217.
24-Russo, M.A., Ficco, D.B.M., Marone, D., De Vita, P., Vallega, V., Pasam, R.K., Sharma, R., Malosetti, M., van Eeuwijk, F.A. and Haseneyer, G. 2012. Genome-wide association studies for agronomical traits in a worldwide spring barley collection. BMC Plant Biology, 12: 16.
25-Schaal, B.A, Hayworth, D.A., Olsen, K.M., Rauscher, J.T. and Smith, W.A. 1998. Phylogeographic studies in plants: Problems and prospects. Molecular Ecology, 7(4): 465–474.
26-Smykal, P., Bacova-Kerteszova, N., Kalendar, R., Corander, J., Schlman, A.H. and Pavelek, M. 2011. Genetic diversity of cultivated flax (Linum usitatissimum L.) germplasm assessed by retrotransposon-based markers. Theoretical and Applied Genetics, 122: 1385-1397.
27-Soto-Cerda, B.J., Diederichsen, A., Ragupathy, R. and Cloutier, S. 2013. Genetic characterization of a core collection of flax (Linum usitatissimum L.) suitable for association mapping studies and evidence of divergent selection between fiber and linseed types. BMC Plant Biology, 13:78. https://doi.org/10.1186/1471-2229-13-78.
28-Soto-Cerda, B.J., Diederichsen, A., Duguid, S., Booker, H., Rowland, G. and Cloutier, S. 2014a. The potential of pale flax as a source of useful genetic variation for cultivated flax revealed through molecular diversity and association analysis. Molecular Breeding, 34(4): 2091-2107.
29-Soto-Cerda, B.J., Duguid, S., Booker, H., Rowland, G., Diederichsen, A. and Cloutier, S. 2014b. Association mapping of seed quality traits using the Canadian flax (Linum usitassimum L.) core collection. Theoretical and Applied Genetics, 127(4): 881-896.
30-Soto-Cerda, B.J., Duguid, S., Booker, H., Rowland, G., Diederichsen, A. and Cloutier, S. 2014c. Genomic regions underlying agronomic traits in linseed (Linum usitatissimum L.) as revealed by association mapping. Journal of Integrative Plant Biology, 56: 75-87.
31-Tommasini, L., Schnurbusch, T., Fossati, D., Mascher, F. and Keller., B. 2007. Association mapping of Stagonospora nodorum blotch resistance in modern European winter wheat varieties. Theoretical and Applied Genetics, 115: 697-708.
32-Wright, S.I. and Gaut, B.S. 2005. Molecular population genetics and the search for adaptive evolution in plants. Molecular Biology and Evolution, 22:506–519.
33-Yan, J., Shan, T., Warburton, M., Buckler, E., Mcmullen, M. and Crouch, J. 2009. Genetic characterization and linkage disequilibrium estimation of a global maize collection using SNP markers. PLoS ONE, 4: 8451.
34-Yu, J., Pressoir, G., Briggs, W.H., Vroh, B.I., Yamasaki, M. and Doebley, J.F. 2006. A unified mixed-model method for association mapping that accounts for multiple levels of relatedness. National Genetics, 38: 203–208.
35-Zhang, Z., Ersoz, E., Lai, C.Q., Todhunter, R.J., Tiwari, H.K., Gore, M.A., Bradbury, P.J., Yu, J., Arnett, D.K., Ordovas, J.M. and Buckler, E.S. 2010. Mixed linear model approach adapted for genomewide association studies. Nature Genetics, 24: 355-362.
36-Zhang, Q., Wu, C., Ren, F., Li, Y. and Zhang, C. 2012. Association analysis of important agronomical traits of maize inbred lines with SSRs. Australian Journal of Crop Science 6(6): 1131-1138.
37-Zhu, C.M., Gore, E., Buckler, S. and Yu, J. 2008. Status and prospects of association mapping in plants. The Plant Genome, 1: 5-20.