نوع مقاله : مقاله پژوهشی

نویسندگان

1 گروه بیوتکنولوژی، پژوهشگاه علوم و تکنولوژی پیشرفته و علوم محیطی، دانشگاه تحصیلات تکمیلی صنعتی و فناوری پیشرفته

2 گروه بیوتکنولوژی ، پژوهشگاه علوم وتکنولوژی پیشرفته و علوم محیطی ،دانشگاه تحصیلات تکمیلی صنعتی و فناوری پیشرفته کرمان

چکیده

TGFβ1 ، یک پروتئین تنظیمی چندکاره است که در طیف وسیعی از فعالیت‌های بیولوژیکی مداخله می‌نماید. این پروتئین، ابتدا به صورت یک فرم پیش ساز غیرفعال، حاوی 390 اسید آمینه سنتز می‌شود که قبل از اتصال به گیرنده‌های TGFβ1، تحت تاًثیر برش پروتئولیتیکی، فرم بالغ TGFβ1 از پروپپتید آن جدا می‌گردد. فرم بالغ این پروتئین شامل 112 اسید آمینه از انتهای C ترمینال فرم غیرفعال آن است. در این مطالعه، در ابتدا توانایی دو سویه‌ی GV3101 و GV3101 (pMP90RK) آگروباکتریوم برای ترانسفورماسیون گیاه Nicotiana benthamiana با ناقل بیان pTRAkc-ERH، به وسیله‌ی ساخت سازه کنترل pTRAkc/ CJG138 (حاوی GFP)، بررسی گردید و نتایج حاصل با تکنیک وسترن بلات و تصویربرداری کانفوکال ارزیابی شد. سپس، به منظور بیان موقت پروتئین TGF β1 از فرم پیش ساز آن در گیاه توتون، سازه‌های نوترکیب pTRAkc/ DCF6 و pTRAkc/ DCF7، به ترتیب دارای توالی نگهدارنده شبکه آندوپلاسمی (SEKEDL) و فاقد این توالی طراحی و ساخته شدند. این سازه‌ها به تنهایی و در ترکیب با سازه‌ی نوترکیب دیگری که حاوی ژن رمز کننده‌ی پروتئاز فورین بود، به گیاهان توتون مایه‌زنی شدند. نتایج حاصل نشان داد که هر دو سازه با موفقیت در گیاه توتون بیان می‌شوند. هرچند پردازش کارآمدتر فرم پیش ساز پروتئین TGF β1 در گیاهان مایه‌زنی شده با سازه‌ی pTRAkc/ DCF7، نشان می‌دهد که تجمع فرم پیش ساز این پروتئین در شبکه آندوپلاسمی از پردازش آن جلوگیری می‌کند. همچنین، در این تحقیق مشخص شد که برش پروتئولیتیکی شبیه به پروتئاز فورین، بین TGFβ1 بالغ و پروپپتید آن، در N. benthamiana اتفاق نمی‌افتد.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Expression of recombinant TGF β1 protein in tobacco plant and investigation of the effect of Furin protease on processing of the latent form of this protein

نویسندگان [English]

  • sara kharazmi 1
  • amin baghizadeh 1
  • masood torkzadeh-mahani 2

1 Department of Biotechnology, Institute of Science and High Technology and Environmental Sciences, Graduate University of Advanced Technology

2 Department of Biotechnology, Institute of Science and High Technology and Environmental Sciences, Graduate University of Advanced Technology

چکیده [English]

TGF β1 is a multifunctional protein that is involved in several biological processes. This protein is initially synthesized as 390 amino acids biologically inactive latent precursor that prior to binding to the TGF β receptors; undergo proteolytic cleavage, to separate mature form of TGF-β1 from its propeptide. The mature form of this protein comprise of the C-terminal 112 amino acids from its precursor. In this study, the potential of two agrobacterium GV3101 and GV3101 (pMP90RK) strains were first investigated for the transformation of Nicotiana benthamiana with pTRAkc-ERH expression vector by creating the pTRAkc/CJG138 (including GFP) as a control construct. The results were analyzed by western blot technique and confocal imaging. Then, in order to transient expression of TGF β1 from its precursor sequence in the tobacco plant, recombinant pTRAkc/ DCF6 and pTRAkc/ DCF7 constructs (containing endoplasmic reticulum retention signal (SEKEDL) and the lacking of this sequence, respectively) were designed and generated. Tobacco plants agro-infiltrated with these constructs alone or in combination with another recombinant construct; harbouring the coding sequence for Furin protease. Results showed that the both of these constructs were successfully expressed in tobacco plants. However, more efficient processing of TGF β1 precursor in infiltrated plants with pTRAkc/ DCF7 construct show that the accumulation of TGF β1 precursor in endoplasmic reticulum prevent to its processing. In addition, in this research was revealed that a Furin-like cleavage between the mature TGF β1 and its propeptide does not occur in N. benthamiana.

کلیدواژه‌ها [English]

  • Furin protease
  • TGF β1 recombinant protein
  • TGF β1 latent processing
  • tobacco plant

بیان پروتئین نوترکیب TGF β1 در گیاه توتون و بررسی تأثیر پروتئاز فورین در پردازش فرم نهفته‌ی این پروتئین

سارا خوارزمی، امین باقی زاده* و مسعود ترکزاده ماهانی

ایران، کرمان، دانشگاه تحصیلات تکمیلی صنعتی و فناوری پیشرفته، پژوهشگاه علوم و تکنولوژی پیشرفته و علوم محیطی، گروه بیوتکنولوژی

تاریخ دریافت:3/8/96                   تاریخ پذیرش: 10/4/97

چکیده

TGFβ1 ، یک پروتئین تنظیمی چندکاره است که در طیف وسیعی از فعالیت‌های بیولوژیکی مداخله می‌نماید. این پروتئین، ابتدا به صورت یک فرم پیش ساز غیرفعال، حاوی 390 اسید آمینه سنتز می‌شود که قبل از اتصال به گیرنده‌های TGFβ1، تحت تاًثیر برش پروتئولیتیکی، فرم بالغ TGFβ1 از پروپپتید آن جدا می‌گردد. فرم بالغ این پروتئین شامل 112 اسید آمینه از انتهای C ترمینال فرم غیرفعال آن است. در این مطالعه، در ابتدا توانایی دو سویه‌ی GV3101 و GV3101 (pMP90RK) آگروباکتریوم برای ترانسفورماسیون گیاه Nicotiana benthamiana با ناقل بیان pTRAkc-ERH، به وسیله‌ی ساخت سازه کنترل pTRAkc/ CJG138 (حاوی GFP)، بررسی گردید و نتایج حاصل با تکنیک وسترن بلات و تصویربرداری کانفوکال ارزیابی شد. سپس، به منظور بیان موقت پروتئین TGF β1 از فرم پیش ساز آن در گیاه توتون، سازه‌های نوترکیب pTRAkc/ DCF6 و pTRAkc/ DCF7، به ترتیب دارای توالی نگهدارنده شبکه آندوپلاسمی (SEKEDL) و فاقد این توالی طراحی و ساخته شدند. این سازه‌ها به تنهایی و در ترکیب با سازه‌ی نوترکیب دیگری که حاوی ژن رمز کننده‌ی پروتئاز فورین بود، به گیاهان توتون مایه‌زنی شدند. نتایج حاصل نشان داد که هر دو سازه با موفقیت در گیاه توتون بیان می‌شوند. هرچند پردازش کارآمدتر فرم پیش ساز پروتئین TGF β1 در گیاهان مایه‌زنی شده با سازه‌ی pTRAkc/ DCF7، نشان می‌دهد که تجمع فرم پیش ساز این پروتئین در شبکه آندوپلاسمی از پردازش آن جلوگیری می‌کند. همچنین، در این تحقیق مشخص شد که برش پروتئولیتیکی شبیه به پروتئاز فورین، بین TGFβ1 بالغ و پروپپتید آن، در N. benthamiana اتفاق نمی‌افتد. 

واژه‌های کلیدی: پروتئاز فورین، پروتئین نوترکیب TGF β1، پردازش فرم نهفته‌ی TGF β1، گیاه توتون

* نویسنده مسئول، تلفن: 09131414156، پست الکترونیکی: [email protected]

مقدمه

 

TGF β  (Transforming growth factor β) یک خانواده از سایتوکین‌های مهم است و متعلق به ابرخانواده بزرگ TGF β  (TGF β superfamily) می‌باشد. این سایتوکین در پستانداران دارای سه ایزوفورم TGF β1، TGF β2 و TGF β3 است که از طریق دو گیرنده‌ی غشایی I و II پیام خود را به داخل سلول ارسال می‌کند (4, 7). ایزوفورم TGF β1، یک پروتئین تنظیمی چند کاره است که در طیف وسیعی از فعالیت‌های بیولوژیکی مانند تحریک و مهار رشد و تمایز سلولی، پیشرفت سیکل سلولی، رشد سلولهای سرطانی و مهار آنها نقش مهمی را ایفا می کند (6). این پروتئین، در ابتدا به صورت یک فرم پیش ساز غیرفعال، حاوی 390 اسید آمینه سنتز می‌شود که از دو بخش سیگنال پپتید (29 اسید آمینه از انتهای N ترمینال) و توالی پروپپتید- TGF β1 ( Pro-TGF β1) تشکیل شده است. این پروتئین قبل از اینکه بوسیله سلول‌ها ترشح شود، تحت تاًثیر چندین مرحله‌ی پردازش درون سلولی قرار می‌گیرد. مهمترین مرحله‌ی پردازش، شکاف پروتئولیتیکی حاصل از فعالیت اندوپپتیداز فورین در توالی پروپپتید است که سبب برش توالی پروتئینی در اسید آمینه‌ی 278 گردیده و منجر به رهاسازی توالی‌های LAP  (Latency-associated protein) و فرم بالغ TGF β1 می‌شود. فرم بالغ این پروتئین شامل 112 اسید آمینه از انتهای C ترمینال توالی پیش ساز (فرم غیرفعال) آن است که یک پروتئین هومودایمر با وزن مولکولی 25 کیلو دالتون را ایجاد می‌کند. این پروتئین شامل 9 اسید آمینه‌ سیستئین می‌باشد که یکی از آنها، زیر واحدهای مونومر این پروتئین را به یکدیگر متصل می‌‌نماید (3, 11, 12). به علت دخالت این پروتئین در فرآیندهای بیولوژیکی متفاوت و کاربرد کلینیکی آن در تست کردن روش‌های درمانی، تا کنون تلاش‌های زیادی برای تولید پروتئین نوترکیب TGF β1 در سیستم‌های بیانی مختلف صورت گرفته است اما به دلیل پیچیده بودن ساختار این پروتئین و روش‌های خالص سازی آن، دست یافتن به مقادیر زیاد این پروتئین نوترکیب رضایت بخش نبوده است (10, 18, 19). در دو دهه‌ی گذشته، استفاده از گیاهان برای تولید پروتئین‌های نوترکیب مورد توجه محققان قرار گرفته است. توانایی گیاهان در انجام تغییرات پس از ترجمه‌ی پروتئین، همانند N گلیکوزیلاسیون و تشکیل باندهای دی سولفیدی، تولید ارزان پروتئین نوترکیب در مقیاس بالا و کاهش خطر آلودگی پروتئین نوترکیب با پاتوژن‌های انسانی، آنها را به عنوان کارخانه‌ی مناسبی جهت تولید فاکتورهای رشد تبدبل نموده است (18). در این مطالعه، توانایی گیاه N. benthamiana در بیان و پردازش پروتئین نوترکیب TGF β1 از توالی رمز کننده فرم غیر فعال این پروتئین مورد بررسی قرار گرفت و نیز تاًثیر بیان همزمان پروتئاز فورین در پردازش پروتئین TGF β1 حفظ شده در شبکه آندوپلاسمی و پروتئین ترشح شده ارزیابی گردید.

مواد و روشها

طراحی و ساخت سازه‌های نوترکیب: به منظور بیان موقت پروتئین TGF β1 در گیاه توتون، از توالی رمز کننده‌ی فرم پیش ساز این پروتئین و ناقل بیان pTRAkc-ERH (Fraunhofer Institute, Germany)  استفاده شد و سازه‌های نوترکیب DCF6، DCF7 و DCF17  مطابق زیر طراحی و ساخته شدند. همچنین سازه‌های نوترکیب DCI5 (حاوی توالی رمز کننده پروتئاز فورین) و CJG138 (حاوی ژن GFP) به شرح زیر ساخته شدند.

طراحی سازه‌ی نوترکیب DCF6 و ساخت سازه‌ی بیانی pTRAkc/ DCF6: جهت طراحی سازه‌ی DCF6، در ابتدا توالی سیگنال ترشحی (29 اسیدآمینه) از انتهای آمینی توالی رمز کننده‌ی فرم پیش ساز پروتئین TGF β1 NM_000660.5, NP_000651.3)) حذف شد. سپس توالی باقیمانده (LAP-TGF β1)، در پایین دست سیگنال LPH موجود در ناقل بیان pTRAkc-ERH که خود در هدایت پروتئین نوترکیب به سمت شبکه آندوپلاسمی در مسیر ترشحی داخل سلول، نقش مهمی را ایفاء می‌کند قرار داده شد. برای قرارگیری پروتئین TGF β1 در شبکه آندوپلاسمی، از توالی سیگنال SEKDEL در انتهای کربوکسیل سازه‌ی نوترکیب DCF6، استفاده شد. همچنین به منظور شناسایی پروتئین نوترکیب بیان شده، توالی  tag His در انتهای آمینی توالی رمزکننده‌ی فرم پیش ساز پروتئین TGF β1، قرار داده شد (شکل 1). تکثیر قطعه­ی 1170 جفت بازی سازه‌ی DCF6، با استفاده از آغازگر رفتDCF6F و آغازگرهای برگشتDCF6R1 و DCF6R2 (جدول 1) انجام شد. در واکنش PCR، از یک سازه‌ی نوترکیب حاوی توالی‌های رمز کننده‌ی فرم پیش ساز پروتئین TGF β1 و  His tagبه عنوان الگو استفاده گردید. سپس محصول PCR برش داده شده با آنزیم DpnI ، با روش SLIC (Sequence and ligation independent cloning) به درون ناقل بیان pTRAkc-ERH (هضم شده با آنزیم‌های NcoI و XhoI) همسانه سازی شد.

طراحی سازه‌ی نوترکیب DCF7 و ساخت سازه‌ی بیانی pTRAkc/ DCF7: سازه‌ی نوترکیب DCF7 مشابه سازه‌ی DCF6 طراحی شد، با این تفاوت که در سازه‌ی DCF7، توالی SEKDEL از انتهای کربوکسیل سازه‌ی مورد نظر حذف گردید (شکل 1). به منظور ساخت سازه‌ی pTRAkc/ DCF7، قطعه­ی 1152 جفت بازی سازه‌ی DCF7 با استفاده از آغازگرهای DCF6F و DCF7R (جدول 1) تکثیر گردید و پس از هضم با آنزیم DpnI،با روش SLIC به درون ناقل بیان pTRAkc-ERH (هضم شده با آنزیم‌های NcoI و XhoI) همسانه سازی شد.

طراحی سازه‌ی نوترکیب DCI5 و ساخت سازه‌ی بیانی pTRAkc/ DCI5: به منظور طراحی سازه‌ی نوترکیب DCI5، در ابتدا توالی سیگنال پپتید (24 اسیدآمینه) از انتهای آمینی توالی رمز کننده‌ی پروتئاز فورین (794 اسید آمینه ،X17094.1) حذف شد و توالی باقیمانده در پایین دست سیگنال LPH موجود در ناقل بیان pTRAkc-ERH قرار داده شد. همچنین توالی‌های  His tag و SEKDEL، به ترتیب در پایین دست توالی رمز کننده پروتئاز فورین قرار گرفتند (شکل 1). جهت ساخت سازه‌ی pTRAkc/ DCI5، در ابتدا قطعه‌ی 2335 جفت بازی DCI5، با استفاده از آغازگر رفتDCI5F و آغازگر برگشتDCI5R(جدول 1) تکثیر گردید (از پلاسمید حاوی توالی رمزکننده‌ی پروتئاز فورین، خریداری شده از کمپانی addgene، به عنوان الگو در انجام واکنش PCR استفاده شد). سپس قطعه‌ی تکثیر شده به درون سایت NcoI و NotI ناقل pTRAkc-ERH، همسانه‌سازی گردید.

طراحی سازه‌ی نوترکیب DCF17 و ساخت سازه‌ی بیانی pTRAkc/ DCF17: در طراحی این سازه، توالی رمزکننده‌ی فرم پیش‌ساز پروتئین TGF β1 در پایین دست توالی رمز کننده‌ی پروتئاز فورین، قرار داده شد و یک سایت قابل شناسایی فورین  (Furin recognition site)(FRS) (R-H-R-R)، در محل اتصال این دو توالی تعبیه شد. لازم به ذکر است، توالی سیگنال پروتئاز فورین در این سازه حذف شد و توالی رمز کننده‌ی پروتئاز فورین در پایین دست سیگنال LPH قرار داده شد. به منظور نگهداری پروتئین TGF β1 و پروتئاز فورین در شبکه آندوپلاسمی، دو  توالی سیگنال SEKDEL به ترتیب در انتهای کربوکسیل توالی رمز کننده‌ی فورین و انتهای کربوکسیل سازه‌ی نوترکیب DCF17 و قبل از توالی  His tag قرار داده شد (شکل 1). به منظور ساخت سازه‌ی pTRAkc/ DCF17، در ابتدا قطعه‌ی 1178 جفت بازی از انتهای کربوکسیل سازه DCF17 (بجز توالی فورین)، با استفاده از آغازگرهای رفتDCF17F1 و DCF17F2 و آغازگر برگشتDCF17R  (جدول 1) تکثیر شد و پس از هضم با آنزیم DpnI،با روش SLIC به درون ناقل بیان نوترکیب pTRAkc/ DCI5 (هضم شده با آنزیم NotI) همسانه‌سازی گردید.

طراحی سازه‌ی نوترکیب CJG138و ساخت سازه‌ی بیانی pTRAkc/ CJG138: در این سازه توالی رمز کننده‌ی ژن GFP در پایین دست سیگنال LPH  و بالا دست توالی SEKDEL قرار داده شد (شکل 1). برای ساخت سازه‌ی بیانی pTRAkc/ CJG138، قطعه‌ی 787 جفت بازی سازه CJG138، با استفاده از آغازگر فوردارد CJG138F و آغازگرهای برگشتCJG138R1 و CJG138R2 جدول 1) تکثیر گردید  و پس از هضم با آنزیم DpnI،با روش SLIC به درون ناقل pTRAkc-ERH (هضم شده با آنزیم‌های NcoI و XhoI) همسانه سازی شد.

در نهایت پلاسمیدهای نوترکیب حاصل، با روش شوک حرارتی به درون سلول‌های مستعد E. Coli (NEB Turbo) ترانسفورم شدند و کلون‌های صحیح (حاوی سازه‌‌های مورد نظر) با روش تعیین ترادف تأیید گردیدند.

ترانسفورماسیون گیاهان توتون با آگروباکتریوم حاوی سازه‌های نوترکیب: سازه‌های نوترکیب تأیید شده، به طور جداگانه به درون دو سویه‌ی GV3101 و GV3101 (pMP90RK) آگروباکتریوم ترانسفورم شدند و پس از تهیه سوسپانسیون باکتری، برای مایه زنی گیاه N. benthamiana  با روش آگرواینفیلتریشن، استفاده گردیدند(1). نمونه برداری از گیاهان مایه زنی شده 3، 5 و 7 روز پس از آگرواینفیلتریشن انجام شد. استخراج پروتئین، بلافاصله بعد از برداشت نمونه‌های برگی انجام شد.

 

 

شکل 1- شکل شماتیک سازه‌های بیانی.

جدول 1- نام و خصوصیات آغازگرهای مورد استفاده در واکنش زنجیره ای پلیمراز

Sequences from 5’ to 3’

Constructs

Size (nt)

Annealing Temperature)°C(

Primers

GGCACTGCAGGTGTTCACTCCCACCATCACCACCATCACC

ATCAC2CTGAG                                                                            

DCF6

50

62

DCF6F

CTAGAGCTCATCTTTCTCA1GAAGAGCACTTGCAGCTCCGC

ACGATC        

DCF6

46

62

DCF6R1

TCTAGAGGATCCGAGCTCGAGCTAGAGCTCATCTTTCTCA1GAAGAGCACTTGC                                                    

DCF6

53

62

DCF6R2

TCTAGAGGATCCGAGCTCGAGCTAAGAGCACTTGCAGCTCCGCACGATC

DCF7

49

62

DCF7R

GCTCACATGTCACAGGGCCAGAAGGTCTTCACCAACACGTGGG

DCI5

43

62

DCI5F

AAGTCGCGGCCGCGAGGGCGCTCTGGTCTTTGATAAAGGCGGTCC

DCI5

45

62

DCI5R

CTCGCGGCCGCTTCAGAAAAGGACGAATTG1 CGGCACAGA

AGG3CTGAGCACAAGCAAGACCATCGACATGGAACTGG

DCF17

76

62

DCF17F1

GACCAGAGCGCCCTCGCGGCCGCTTCAGAAAAGGACG

DCF17

37

62

DCF17F2

TGGTGATGGTGATGAGCGGCCGCGGATCCACGCGGAACCAGAGAGCACTTGC

DCF17

52

62

DCF17R

GGCACTGCAGGTGTTCACTCCATGGCTATGGTGTCCAAAGGCGAAGAACTG

CJG138

51

62

CJG138F

CTAGAGCTCATCTTTCTCAGA1TTTGTACAGTTCATCCATGC

CCAGGGTAATACCAGC 

CJG138

57

62

CJG138R1

CTC TAG AGG ATC CGA GCT CGA GCT AGA GCT CAT CTT TCT CAG

CJG138

42

62

CJG138R2

در جدول 1، توالی SEKDEL با شماره 1، توالی His tag با شماره 2  و سایت قابل شناسایی فورین (FRS) با شماره 3 مشخص شده است.


در فاصله‌ی زمانی برداشت تا انجام استخراج پروتئین، نمونه‌های برگ بر روی یخ قرار داده شدند. این آزمایش در دو تکرار انجام شد و از آگروباکتریوم حاوی ژن رمزکننده‌ی بازدارنده خاموشی p19، برای جلوگیری از فرآیند خاموشی ژن پس از نسخه برداری (PTGS) (Post transcriptional gene silencing) استفاده گردید. پروتئین مهارکننده‌ی خاموشی p19، با مهار آغازکننده‌های PTGS مانند (ds)RNAها و (si)RNA‌ها، از شروع فرآیند خاموشی جلوگیری می‌کند (17). پس از تهیه سوسپانسیون باکتری، این آگروباکتریوم به نسبت مساوی 1:1 یا 1:1:1، با سویه‌های آگروباکتریوم حاوی سازه‌های نوترکیب مخلوط گردید و به گیاهان توتون مایه‌زنی شد.

استخراج پروتئین نوترکیب از برگ‌ گیاهان مایه‌زنی شده: در ابتدا 1 تا 2/1 گرم از بافت برگ نمونه های جمع آوری شده در ازت مایع پودر گردید و با 3-2 میلی‌لیتر بافر استخراج (NaCl 8 g/L, KCL 0.2 g/L, Na2HPO4 1.44 g/L, KH2PO4 0.24 g/L, pH 7.4.) مخلوط شد. عصاره‌ی گیاه از یک توری عبور داده شد و سوسپانسیون حاصل با سرعت 13000 دور در دقیقه، در دمای C4، به مدت 15 دقیقه سانتریفیوژ گردید. عصاره‌ی خام استخراج شده از گیاه، حاوی پروتئین محلول کل (Total soluble proteins) بود که در آزمایشات بعدی به منظور بررسی بیان پروتئین نوترکیب استفاده شد.   

آنالیز بیان پروتئین نوترکیب با استفاده از تکنیک وسترن بلات:

پس از انجام الکتروفورز، باند‌های پروتئین از ژل به غشاء PVDF منتقل شدند و  بررسی بیان پروتئین نوترکیب TGF β1، با استفاده از آنتی بادیهای Anti-His6-Peroxidase antibody (Roche) و Polyclonal rabbit anti-TGFbeta1 Ab (Santa Cruz) انجام شد. همچنین از آنتی بادی anti-GFP برای آنالیز بیان پروتئین GFP استفاده گردید. در نهایت، پروتئین‌های مورد نظر به صورت باندهای آبی رنگ (حاصل از فعالیت HRP متصل به آنتی بادی، در حضور سوبسترایTMB (3,3’,5,5’-Tetramethylbenzidine)) بر روی غشاء PVDF، ظاهر شدند.

بررسی بیان پروتئین GFP با استفاده از میکروسکوپ کانفوکال:

سه روز پس از مایه زنی گیاه توتون با آگروباکتریوم حاوی pTRAkc/ CJG138، قطعه‌ی برگی کوچکی از برگ‌های آگرواینفیلتریت شده جدا گردید و بیان پروتئین GFP در برگ، با استفاده از میکروسکوپ کانفوکال بررسی گردید.

نتایج

بررسی بیان پروتئین نوترکیب TGF β1 در  گیاهان  مایه

زنی شده با سویه‌ی GV3101 حاوی سازه‌های نوترکیب:

به منظور بررسی توانایی گیاه توتون (N. benthamiana) در بیان پروتئین TGF β1 و پردازش این پروتئین از توالی رمز کننده‌ی فرم پیش‌ساز آن، سازه‌های بیان pTRAkc/ DCF6 و pTRAkc/ DCF7 به طور جداگانه، به درون سویه‌ی GV3101 آگروباکتریوم ترانسفورم شدند. سپس به همراه آگروباکتریوم حاوی ژن رمزکننده‌ی بازدارنده خاموشی p19، به درون برگ‌های گیاه توتون مایه‌زنی گردیدند. بیان پروتئین مورد نظر، 3، 5 و 7 روز پس از مایه زنی به وسیله‌ی وسترن بلات ارزیابی گردید. نتایج وسترن بلات با دو آنتی بادی Anti-His (شکل 2) وanti-TGF β1  (نتایج نشان داده نشده است) از پروتئین استخراج شده از برگهای مایه زنی شده، به ظاهر نشان داد که این سازه‌ها قادر به بیان پروتئین TGF β1 در گیاه توتون نمی‌باشند (باندهای پروتئینی ضعیف مشاهده شده در شکل 2، مربوط به پروتئین مورد نظر نیست). همچنین نتایج حاصل از آلودگی همزمان گیاه توتون با هر یک از سازه‌های مذکور به همراه سویه‌ی GV3101 حاوی پروتئاز فورین نشان داد که پروتئاز فورین، تاًثیری در بیان و پردازش پروتئین TGF β1 ندارد. نتایج مشابهی نیز از بیان سازه pTRAkc/ DCF17 در گیاهان مایه زنی شده با سویه‌ی GV3101 آگروباکتریوم حاصل گردید. با توجه به نتایج حاصل، دو فرضیه مطرح شد: 1) سویه‌ی GV3101 آگروباکتریوم (حاوی ناقل‌های نوترکیب pTRAkc) قادر به ترانسفورماسیون کارآمد گیاه توتون نمی‌باشد 2) ترانسفورماسیون گیاه توتون به خوبی انجام شده است اما سازه‌های نوترکیب، قادر به بیان پروتئین TGF β1، در گیاه توتون نیستند. از این رو، به منظور بررسی توانایی سویه‌ی GV3101 آگروباکتریوم در ترانسفورماسیون توتون، سازه بیانی pTRAkc/ CJG 138، حاوی ژن رمزکننده‌ی GFP، به درون این سویه‌ منتقل گردید و به برگ توتون مایه‌زنی شد. اگرچه نتایج وسترن بلات، با استفاده از آنتی بادی anti-GFP، باند ضعیفی را در محدوده‌ی مورد نظر (kDa 32) نشان داد (شکل 3)، اما حضور پروتئین GFP در سلول‌های برگ، با میکروسکوپ فلورسنت قابل مشاهده نبود. در مجموع، بر اساس نتایج حاصل می‌توان اظهار داشت که احتمالاً سویه‌ی مذکور، قادر به ترانسفورماسیون کارآمد گیاه توتون نمی‌باشد.

 

 

شکل 2- نتایج حاصل از آنالیز وسترن بلات (آنتی‌بادی anti-His) از پروتئین استخراج شده از گیاهان مایه‌زنی شده با سویه GV3101 (حاوی سازه‌های نوترکیب) 3، 5 و 7 روز پس از مایه‌زنی

 

 

 

شکل 3- نتایج حاصل از آنالیز وسترن بلات (آنتی‌بادی anti-GFP) از  پروتئین استخراج شده از گیاهان مایه‌زنی شده با سویه GV3101 حاوی سازه‌ی بیانی CJG 138

بررسی بیان پروتئین نوترکیب TGF β1 در گیاهان مایه زنی شده با سویه‌ی GV3101 (pMP90RK) حاوی سازه‌های نوترکیب: در آزمایش دیگری، سازه‌های نوترکیب مذکور، به درون سویه‌ی GV3101 (pMP90RK) آگروباکتریوم منتقل شدند و برای مایه زنی گیاه توتون استفاده گردیدند. نتایج وسترن بلات حاصل از نمونه‌ پروتئینی به دست آمده از گیاه مایه‌زنی شده با سویه‌ی GV3101 (pMP90RK)، حاوی pTRAkc/ CJG 138 (کنترل)، نشان داد که پروتئین GFP، 3 روز پس از مایه‎زنی، در گیاه توتون بیان می‌شود (شکل 44A-). همچنین تصویر برداری کانفوکال از نمونه‌ی برگی گیاه مزبور، تجمع سطح بالای پروتئین GFP را در شبکه آندوپلاسمی نشان داد (شکل 4-B). قرار گیری پروتئین GFP در شبکه آندوپلاسمی، به دلیل حضور توالی SEKDEL در انتهای کربوکسیل توالی رمزکننده‌ی GFP می‌باشد. بیان موفق GFP در نمونه‌های مایه‌زنی شده با سویه‌ی نوترکیب GV3101 (pMP90RK)، نشان داد که این سویه‌ی آگروباکتریوم برای ترانسفورم کارآمد گیاه توتون با ناقل بیان pTRAkc مناسب می‌باشد. از این رو سازه‌های pTRAkc/ DCF6، pTRAkc/ DCF7، pTRAkc/ DCF17 و pTRAkc/ DCI5 به درون سویه‌ی GV3101 (pMP90RK) ترانسفورم شدند و بیان پروتئین TGF β1، 3 روز پس از مایه‌زنی، در گیاهان مایه‌زنی شده با سازه‌های DCF6، DCF7،  DCF6 + DCI5،  DCF7 + DCI5 و DCF17 به وسیله‌ی وسترن بلات (آنتی بادی Anti-His) ارزیابی گردید. همانطور که در شکل 5 دیده می‌شود، در نمونه‌ حاصل از گیاهان مایه‌زنی شده با سازه DCF6، یک باند در محدوده‌ی تقریباً 70 کیلو دالتون مشاهده می‌شود. این باند احتمالاً مربوط به ساختار TGF β1 LAP/ است که از فولدینگ صحیحی برخوردار نمی‌باشد. به طور کلی، انجام اصلاحات پس از ترجمه در ساختار TGF β1 LAP/، یک فرآیند پیچیده است که در چندین مرحله کنترل می‌شود. ترشح دایمرهای فعال TGF β1، در مرحله‌ی اول مستلزم دایمر شدن پروپپتید TGF β1 LAP/ در شبکه آندوپلاسمی است (9). همچنین این ساختار در سه اسید آمینه در موقعیت‌های 82، 136 و 176 N گلیکوزیله می‌شود (2, 16). نگهداری این ساختار (نهفته) در شبکه آندوپلاسمی و دستگاه سیس-گلژی، سبب می‌شود که ترشح آن به درون شبکه ترانس-گلژی به آهستگی انجام شود و فقط پروتئین‌هایی به ترانس-گلژی ترشح شوند که به درستی گلیکوزیله شده‌اند (5, 14). بنابراین مشاهده باند تقریباً 70 کیلو دالتونی، در گیاهان آلوده شده با سازه‌ی DCF6، احتمالاً نشان دهنده‌ی پروپپتید TGF β1 LAP/ است که به درستی گلیکوزیله نشده است و به دلیل حضور توالی SEKDEL در انتهای کربوکسیل این سازه به درون شبکه آندوپلاسمی برگشت داده شده است. زمانیکه سازه‌ی DCF6  به همراه پروتئاز فورین به گیاه توتون مایه‌زنی شد، در نتایج وسترن بلات علاوه بر باند حدوداً 70 کیلو دالتونی، دو باند در محدوده‌های 55 و  35 کیلو دالتون مشاهده گردید که به ترتیب مربوط به TGF β1 LAP/ و LAP بود (شکل 5). مشاهده این باندها نشان داد که احتمالاً بخشی از پروپپتید بیان شده، به درستی گلیکوزیله می‌شود و به درون شبکه ترانس-گلژی منتقل می‌شود، جائیکه تحت تاثیر پروتئاز فورین، LAP از TGF β1 جدا گردیده است، اما همچنان  با برهمکنش‌های غیرکووالانسی به یکدیگر متصل هستند. این در حالی است که نتایج حاصل از مایه‌زنی گیاهان با سازه‌ی DCF7 به تنهایی، در مقایسه با سازه‌ی DCF6، علاوه بر باند تقریباً 70 کیلو دالتونی، باند 55 کیلو دالتونی مربوط به پروپپتید TGF β1 LAP/  را نشان داد (شکل 5). حضور باند 55 کیلو دالتونی، در نتایج وسترن بلات نشان می‌دهد که به دلیل فقدان توالی سیگنال SEKDEL، در سازه‌ی DCF7، مقدار بیشتری از پروپپتید بیان شده از این سازه، به درستی گلیکوزیله شده است و در مسیر ترشح وارد شبکه ترانس گلژی می‌شود، اما در آنجا به تنهایی قادر به پردازش و تولید فرم بالغ TGF β1 نمی‌باشد.

 

 

شکل 4- نتایج حاصل از آنالیز وسترن بلات با استفاده از آنتی‌بادی anti-GFP (A)، و تصویر برداری میکروسکوپ کانفوکال (B) از نمونه‌های برگی گیاه توتون مایه‌زنی شده با سویه‌ی GV3101 (pMP90RK) (حاوی سازه‌ی نوترکیب CJG 138) 3 روز پس از مایه‌زنی. 1: پروتئین GFP در شبکه آندوپلاسمی، 2: اتوفلورسانس کلروفیل به رنگ قرمز، 3: عکس برداری با نور سفید (Bright field)، 4 و 5: مشابه موارد 1، 2 و 3، اما با بزرگنمایی بیشتر

 

شکل 5: نتایج حاصل از آنالیز وسترن بلات با استفاده از آنتی‌بادی anti-His از نمونه‌های پروتئین استخراج شده از گیاهان مایه‌زنی شده با سویه GV3101::pMP90RK (حاوی سازه‌های‌ نوترکیب)، 3 روز پس از مایه‌زنی.

 

 

در صورتیکه، آلودگی همزمان گیاه توتون با هر دو سازه‌ی بیان DCF7 و پروتئاز فورین، منجر به آزاد شدن فرم بالغ TGF β1، از پروپپتید آن گردیده است که به صورت دو باند 55 کیلو دالتون /TGF β1) LAP ( و 35 کیلو دالتون (LAP) در نتایج وسترن بلات مشاهده ‌می‌شود (شکل 5).

بررسی تاًثیر پروتئاز فورین در پردازش فرم نهفته‌ی پروتئین TGF β1: نتایج وسترن بلات، حاصل از آلودگی همزمان گیاهان توتون با سازه‌های حاوی فرم پیش ساز پروتئین TGF β1 ( DCF6 و DCF7) به همراه سازه‌ی DCI5 (حاوی توالی رمز کننده‌ی پروتئاز فورین)، در مقایسه با گیاهان آلوده شده در غیاب این پروتئاز، نشان داد که پردازش فرم نهفته TGF β1 در گیاه توتون، تنها در صورت بیان پروتئاز فورین امکان پذیر می‌باشد. بنابراین، این نتایج نشان می‌دهند که فعالیت پروتئازی، شبیه به پروتئاز فورین در گیاه N. benthamiana وجود ندارد. لازم به ذکر است در این آزمایشات به منظور اطمینان از بیان پروتئاز فورین، یک گیاه توتون تنها با آگروباکتریوم حاوی سازه‌ی DCI5 مایه‌زنی شد و بیان این پروتئین با تکنیک وسترن بلات ارزیابی گردید. پروتئین بیان شده به صورت یک باند حدوداً 98 کیلو دالتونی در نتایج وسترن بلات مشاهده گردید (شکل 5). به علاوه، به منظور بررسی امکان بیان همزمان پروپپتید TGF β1 LAP/ و پروتئاز فورین از یک سازه‌ی نوترکیب در گیاه توتون و نیز بررسی توانایی این سازه در پردازش فرم نهفته پروتئین TGF β1، سازه‌ی pTRAkc/ DCF17 به درون آگروباکتریوم ترانسفورم شد و پروتئین استخراج شده از گیاهان مایه‌زنی شده، به وسیله‌ی وسترن بلات ارزیابی گردید. اما نتایج حاصل از بیان این سازه، رضایت بخش نبود (شکل 5).

بحث

در میان سیستم‌های بیان یوکاریوتی، گیاهان به دلیل دارا بودن محیط سلولی مناسب برای انجام تغییرات پس از ترجمه و توانایی ایجاد فولدینگ صحیح در محصول پروتئینی، حائز اهمیت هستند. از میان ایزوفرم‌های مختلف پروتئین TGF β،  تا کنون، تنها بیان ایزوفورم TGF β3 در کلروپلاست گیاه N. tabacum گزارش شده است. هرچند، پروتئین بیان شده در این سیستم، از فولدینگ صحیحی برخوردار نبوده است (8). همچنین، همزمان با انجام تحقیق حاضر، Wilber و همکاران در سال 2016 ، بیان پروتئین TGF β1 فعال را از توالی رمز کننده‌ی فرم پیش ساز آن، در گیاه توتون گزارش نمودند (18).

در تحقیق حاضر، توانایی گیاه N. benthamiana در بیان موقت پروتئین TGF β1 با استفاده از ناقل بیان pTRAkc-ERH  مورد بررسی قرار گرفت و پردازش این پروتئین از توالی رمز کننده‌ی فرم پیش‌ساز آن، با مقایسه‌ی پروتئین تجمع یافته در شبکه آندوپلاسمی و پروتئین ترشح شده، در حضور و غیاب پروتئاز فورین ارزیابی گردید. نتایج حاصل نشان ‌داد که فعالیت پروتئازی شبیه به پروتئاز فورین در گیاه N. benthamiana وجود ندارد. این نتایج مشابه نتایج Wilber و همکاران بود. آنها نشان دادند که برش پروتئولیتیکی، حاصل از فعالیت پروتئاز فورین، در این گیاه اتفاق نمی‌افتد (18). مطالعات انجام شده نشان می‌دهند که پروتئاز فورین انسانی، یک پروتئین غشایی است که در ابتدا به صورت یک فرم پیش‌ساز (104 کیلو دالتون) سنتز می‌شود و سپس با شکاف پروپپتید، در نتیجه‌ی یک فرایند اتوکاتالیتیکی داخل مولکولی، در شبکه آندوپلاسمی به فرم بالغ (98 کیلو دالتون) تبدیل می‌شود. ایجاد این شکاف در پروپپتید، برای خارج شدن فورین از شبکه آندوپلاسمی لازم است. اگرچه این شکاف برای فعال‌سازی فورین ضروری است اما کافی نیست و همچنان پروپپتید به فرم بالغ متصل است. جدا شدن پروپپتید از فرم فعال این پروتئین، با ایجاد شکاف دوم در محیط اسیدی شبکه ترانس گلژی صورت می‌گیرد و سبب رها شدن فرم فعال فورین می‌گردد. مشخص شده است که با نگه داشتن فورین در شبکه آندوپلاسمی به وسیله‌ی توالی KDEL، فورین قادر به ایجاد شکاف در پروپپتید سابستریت‌ها نمی‌باشد و احتمالاً تنها در شبکه ترانس گلژی دارای فعالیت می‌باشد (13, 15). با توجه به مطالب ذکر شده و نتایج به دست آمده، ‌می‌توان اظهار داشت که مسیر پردازش فورین در گیاه مشابه انسان است و از آنجائیکه در انتهای کربوکسیل توالی رمز کننده‌ی فورین، در سازه‌ی DCI5، توالی SEKDEL قرار داده شده بود، کارآیی پردازش فورین بیان شده، کاهش یافته و تنها بخشی از آن که به شبکه ترانس گلژی وارد شده است، به درستی پردازش گردیده و قادر به شکاف LAP از TGF β1 است. مقایسه‌ی نتایج حاصل از گیاهان آلوده شده با سازه‌های DCF6 + DCI5 و DCF7 + DCI5 نیز نشان داد که نگهداری پروتئین-TGF β1  LAP در شبکه آندوپلاسمی سبب کاهش پردازش فرم پیش‌ساز پروتئین TGF β1 می‌گردد. احتمالاً با حفظ فرم پیش‌ساز پروتئین در شبکه آندوپلاسمی، این پروتئین قادر نمی‌باشد به درون شبکه ترانس-گلژی، جائیکه پروتئاز فورین دارای فعالیت است، منتقل شود و تنها بخشی از پروتئین که وارد شبکه ترانس-گلژی شده است، به درستی پردازش می‌گردد.

در بخش دیگری از این تحقیق، توانایی بیان همزمان TGF β1 LAP/ و پروتئاز فورین از یک سازه‌ی نوترکیب در گیاه توتون به وسیله‌ی ساخت سازه‌ی DCF17 بررسی گردید. اما به دلیل طراحی نادرست این سازه، نتایج حاصل از بیان آن رضایت بخش نبود. علاوه بر اینکه، توالی KDEL موجود در انتهای کربوکسیل توالی‌های فورین و فرم پیش‌ساز پروتئین TGF β1، از پردازش صحیح پروتئاز فورین و پروتئین TGF β1 در این سازه جلوگیری نموده است، مطالعات انجام شده روی ساختار پروتئاز فورین نشان داد که این پروتئاز یک پروتئین غشایی است که از طریق دمین‌های سیتوپلاسمیک (Cytoplasmic domain) و ترانس ممبرین (Transmembrane domain) به غشاء شبکه ترانس گلژی متصل شده و در آنجا قرار می‌گیرد و به فرم فعال پروتئاز تبدیل می‌شود. این دمین‌ها در انتهای کربوکسیل توالی رمز کننده‌ی پروتئاز فورین قرار دارند در حالیکه دمین کاتالیتیک (Catalytic domain) و سایت فعال‌سازی آن در انتهای آمینی قرار گرفته است (13). بنابراین از آنجائیکه در سازه‌‌ی نوترکیب ساخته شده، توالی رمز کننده‌ی فرم پیش‌ساز پروتئین TGF β1 در انتهای کربوکسیل پروتئاز فورین قرار گرفته است، احتمالاً از دسترس دومین کاتالیتیک این پروتئاز، خارج بوده و پروتئاز فورین قادر به انجام فعالیت پروتئولیتیکی، در سایت قابل شناسایی نبوده و در نتیجه نتایج رضایت بخشی از بیان پروتئین TGF β1 به وسیله‌ی این سازه در گیاه توتون حاصل نگردید.

سپاسگزاری

این  پروژه  با  حمایت  مالی  وزارت  علوم،  تحقیقات  و

 فناوری در قالب یک دوره تحقیقاتی کوتاه مدت در دانشگاه LMU مونیخ، آزمایشگاه دکتر Serena Schwenkert و شرکت Crelux انجام شد. ناقل بیان این پروژه از آزمایشگاه پروفسور Rainer Fischer، از موسسه تحقیقاتی Fraunhofer تهیه گردید. بدین وسیله از تمامی این عزیزان نهایت سپاس و قدردانی به عمل می‌آید. 

1. Boes, A., Reimann, A., Twyman, R. M., Fischer, R., Schillberg, S., Spiegel, H. (2016). A plant-based transient expression system for the rapid production of malaria vaccine candidates. Vaccine Design: Methods and Protocols, Volume 2: Vaccines for Veterinary Diseases: 597-619.
2.   Brunner, A.M., Lioubin, M.N., Marquardt, H., Malacko, A.R., Wang, W.C., Shapiro, R.A., Neubauer, M., Cook, J., Madisen, L., Purchio, A.F. (1992). Site-directed mutagenesis of glycosylation sites in the transforming growth factor-beta 1 (TGF beta 1) and TGF beta 2 (414) precursors and of cysteine residues within mature TGF beta 1: effects on secretion and bioactivity. Molecular endocrinology (Baltimore, Md.), 6(10): 1691-1700.
3.   Cerletti, N. (2000). Process for the production biologically active dimeric protein. Google Patents.
4.   Daopin, S., Piez, K.A., Ogawa, Y., Davies, D.R. (1992).  Crystal structure of transforming growth factor-beta 2: an unusual fold for the superfamily. Science, 257(5068): 369-373.
5.   Dubois, C.M., Laprise, M.H., Blanchette, F., Gentry, L.E., Leduc, R. (1995). Processing of transforming growth factor beta 1 precursor by human furin convertase. The Journal of biological chemistry, 270(18): 10618-10624.
6.   Elliott, R.L., Blobe, G.C. (2005). Role of transforming growth factor Beta in human cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology, 23(9): 2078-2093.
7.   Frank, S., Madlener, M., Werner, S. (1996). Transforming growth factors beta1, beta2, and beta3 and their receptors are differentially regulated during normal and impaired wound healing. The Journal of biological chemistry, 271(17): 10188-10193.
8.   Gisby, M.F., Mellors, P., Madesis, P., Ellin, M., Laverty, H., O'Kane, S., Ferguson, M.W., Day, A. (2011). A synthetic gene increases TGFbeta3 accumulation by 75-fold in tobacco chloroplasts enabling rapid purification and folding into a biologically active molecule. Plant Biotechnology Journal, 9(5): 618-628.
9.   Gray, A.M., Mason, A.J. (1990). Requirement for activin A and transforming growth      factor-Pl pro-regions in homodimer assembly, Science, 247: 1328-1330.
10. Kim, Y.V., Gasparian, M.E., Bocharov, E.V., Chertkova, R.V., Tkach, E.N., Dolgikh, D.A., Kirpichnikov, M.P. (2015). New Strategy for High-Level Expression and Purification of Biologically Active Monomeric TGF-β1/C77S in Escherichia coli. Molecular biotechnology, 57(2): 160-171.
11. Martelossi Cebinelli, G.C., Paiva Trugilo, K., Badaro Garcia, S., Brajao de Oliveira, K. (2016). TGF-beta1 functional polymorphisms: a review. European cytokine network, 27(4): 81-89.
12. Munger, J.S., Harpel, J.G., Gleizes, P.E., Mazzieri, R., Nunes, I., Rifkin, D.B. (1997). Latent transforming growth factor-β: structural features and mechanisms of activation. Kidney international, 51(5): 1376-1382.
13. Nakayama, K. (1997). Furin: a mammalian subtilisin/Kex2p-like endoprotease involved in processing of a wide variety of precursor proteins. The Biochemical journal, 327: 625-635.
14. Oida, T., Weiner, H.L. (2010). Overexpression of TGF-ss 1 gene induces cell surface localized glucose-regulated protein 78-associated latency-associated peptide/TGF-ss. Journal of immunology (Baltimore, Md. : 1950), 185(6): 3529-3535.
15. Rehemtulla, A., Dorner, A.J., Kaufman, R.J. (1992). Regulation of PACE propeptide-processing activity: requirement for a post-endoplasmic reticulum compartment and autoproteolytic activation. Proceedings of the National Academy of Sciences of the United States of America, 89: 8235-8239.
16. Sha, X., Brunner, A.M., Purchio, A.F., Gentry, L.E. (1989). Transforming growth factor beta 1: importance of glycosylation and acidic proteases for processing and secretion. Molecular endocrinology (Baltimore, Md.), 3(7): 1090-1098.
17. Voinnet, O., Rivas, S., Mestre, P., Baulcombe, D. (2003). An enhanced transient expression system in plants based on suppression of gene silencing by the p19 protein of tomato bushy stunt virus. Plant Journal, 33: 949-56.
18. Wilbers, R.H., Westerhof, L.B., Raaij, D.R., Adrichem, M., Prakasa, A.D., Lozano‐Torres, J.L., Bakker, J., Smant, G., Schots, A. (2016). Co‐expression of the protease furin in Nicotiana benthamiana leads to efficient processing of latent transforming growth factor‐β1 into a biologically active protein. Plant biotechnology journal, 14(8): 1695-1704.
19. Zou, Z., Sun, P.D. (2004). Overexpression of human transforming growth factor-β1 using a recombinant CHO cell expression system. Protein expression and purification, 37(2): 265-272.