نوع مقاله : مقاله پژوهشی

نویسندگان

1 دانشگاه کردستان

2 دانشگاه کردستان، گروه بیوتکنولوژی کشاورزی

3 گروه فارماکوگنوزی و بیوتکنولوژی دارویی، دانشکده داروسازی، دانشگاه علوم پزشکی و خدمات بهداشتی درمانی همدان

چکیده

بومادران هزار برگ (Achillea millefolium subsp. millefolium) گیاهی خودگشن از خانواده گل‌ستاره‌ای‌ها است که انواع متعددی ازمتابولیت‌های ثانویه گیاهی از جمله ترپنوییدها و فنیل‌پروپانوییدها را تولید می‌کند. در این مطالعه الگوی بیان ژن های مهم دخیل در بیوسنتز ترپن ها و فنیل پروپانویید ها بررسی شد تا درک صحیحی از مکانیسم بیوسنتز آنها به دست بیاید. ژن‌های کدکننده 1-دی‌اکسی دی‌زایلوز-5-فسفات ردوکتوایزومراز (DXR) و ژرانیل دای فسفات سنتاز (GPPS) از ژن‌های مهم در بیوسنتز مونوترپن‌ها در مسیر 2-C-متیل‌اریتریتول4-فسفات (MEP) و ژن‌های فنیل‌آلانین‌آمونیا لیاز (PAL) و چالکون سنتاز (CHS) از ژن‌های مهم در بیوسنتز فنیل‌پروپانوییدها می‌باشد. در این تحقیق میزان بیان این ژن‌ها در مراحل مختلف نموی و تحت تیمار متیل‌جاسمونات در بافت‌های برگ و گل بررسی شدند. نتایج به دست آمده نشان دهنده بیان بیشتر این ژن‌ها در بافت گل و در گیاهان تیمار شده با متیل‌جاسمونات می‌باشد. همچنین میزان بیان این ژن ها با شدت های متفاوت تحت تاثیر مرحله نموی برگ قرار گرفتند.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Expression pattern analysis of some genes involved in the biosynthetic pathway of terpenoids and phenylpropanoids in tissues, developmental stages and under methyl jasmonate treatment in yarrow (Achillea millefolium subsp. millefolium)

نویسندگان [English]

  • Ihsan Fathi 1
  • Mohammad Majdi 2
  • Asad Maroufi 1
  • Dara Dastan 3

1 University of Kurdistan

2 University of Kurdistan

3 Department of Pharmacognosy and Pharmaceutical Biotechnology, Hamadan University of Medical Sciences, Hamadan

چکیده [English]

Medicinal plants of the Asteraceae family are important genetic resources due to their high echological flexibility in diverse climates,. Yarrow (Achillea millefolium subsp. millefolium) is a self-pollinated plant belongs to the Asteraceae which produce a wide varieties of plant secondary metabolites such as terpenoids and phenylpropanoids. In the present work, gene expression patterns of genes involved in the biosynthetic pathways of terpens and phenylpropanoids were studied to understand the regulatory mechanism behind them. 1-deoxy-D-xylose-5-phosphate reductoisomerase (DXR) and geranyldiphosphate synthase (GPPS) are important genes in the biosynthesis of monoterpenes in the 2-C-methylerythritol-4-phosphate (MEP) pathway. Phenylalanine ammonia lyase (PAL) and chalcone synthase (CHS) genes are important in the biosynthesis of phenylpropanoids. In the present study, semi quantitative RT-PCR of these genes was carried out in different developmental stages, also in response to methyl jasmonate treatment in leaves and flowers. Results showed that expression of these genes were higher in flowers and methyl jasmonate treated plants, also the expression of these genes affected by developmental stages of leaves but with different intensity.

کلیدواژه‌ها [English]

  • Gene expression
  • Elicitors
  • Secondary metabolites
  • Medicinal plant

بررسی بیان برخی ژنهای دخیل در مسیر بیوسنتزی ترپنویید‌ها و فنیل‌پروپانوییدها در بافتها، مراحل نموی و تحت تیمار متیل‌جاسمونات در بومادران (Achillea millefolium subsp. millefolium)

احسان فتحی1، محمد مجدی1*، اسعد معروفی1 و دارا دستان2

1 ایران، سنندج، دانشگاه کردستان، دانشکده کشاورزی، گروه زراعت و اصلاح نباتات

2 ایران، همدان، دانشگاه علوم پزشکی و خدمات بهداشتی درمانی همدان، دانشکده داروسازی، گروه فارماکوگنوزی و بیوتکنولوژی دارویی

تاریخ دریافت: 29/9/96                تاریخ پذیرش: 10/4/97

چکیده

بومادران هزار برگ (Achillea millefolium subsp. millefolium) گیاهی خودگشن از خانواده گل‌ستاره‌ایها است که انواع متعددی از متابولیتهای ثانویه گیاهی از جمله ترپنوییدها و فنیل‌پروپانوییدها را تولید می‌کند. در این مطالعه الگوی بیان ژنهای مهم دخیل در بیوسنتز ترپنها و فنیل پروپانویید ها بررسی شد تا درک صحیحی از مکانیسم بیوسنتز آنها به دست بیاید. ژنهای کدکننده 1-دی‌اکسی دی‌زایلوز-5-فسفات ردوکتوایزومراز (DXR) و ژرانیل دای فسفات سنتاز (GPPS) از ژنهای مهم در بیوسنتز مونوترپنها در مسیر 2-C-متیل­اریتریتول4-فسفات (MEP) و ژنهای فنیل‌آلانین‌آمونیا لیاز (PAL)  و چالکون سنتاز (CHS) از ژنهای مهم در بیوسنتز فنیل‌پروپانوییدها می‌باشند. در این تحقیق میزان بیان این ژنها در مراحل مختلف نموی و تحت تیمار متیل‌جاسمونات در بافتهای برگ و گل بررسی شد. نتایج به دست آمده  نشان دهنده بیان بیشتر این ژنها در بافت گل ودر گیاهان تیمار شده با متیل‌جاسمونات می‌باشد.  همچنین میزان بیان این ژنها با شدتهای متفاوت تحت تأثیر مرحله نموی برگ قرار گرفتند.

واژه­های کلیدی: بیان ژن،  الیسیتور، متابولیتهای ثانویه ،گیاه دارویی

* نویسنده مسئول، تلفن : ۰۸۷۳۳۶۶۴۶۰۰، پست الکترونیکی:[email protected]

مقدمه

 

امروزه استفاده از گیاهان دارویی بسیار رایج می‌باشد. گیاهان گروه بزرگ و متنوعی ازترکیبات آلی به­نام متابولیتهای ثانویه را تولید می­کنند که توسط انسان به عنوان ترکیب دارویی مصرف می­شوند (28). گیاهان دارویی خانواده گل‌ستاره‌ایها (Asteraceae) به دلیل انعطاف پذیری اکولوژیک زیاد در اقلیمهای متنوع، ذخایر ژنتیکی مهمی محسوب می­گردند بومادران هزار برگ (Achillea millefolium sub sp.millefolium) گیاهی دیپلویید (18=x2=n2) و خودگشن از خانواده گل‌ستاره‌ایها به فراوانی در مناطق اروپا، آسیا و شمال آمریکا رشد می­کند و در ایران دارای 19 گونه می­باشد، که 7 گونه آن بومی ایران می­باشد (1و10). این گیاه در ایران دارای دو زیرگونه شامل بومادران البرزی (Achillea millefolium sub sp. elbursensis) و بومادران هزار برگ (Achillea millefolium sub sp. millefolium) می­باشد که از لحاظ خصوصیات ظاهری بسیار شبیه به هم هستند. بومادران هزار ­برگ گیاهی پایا، ایستا به ارتفاع 50-30 سانتیمتر، دارای ساقه­هایی ساده و در بخش فوقانی منشعب و برگهایی پوشیده از کرکهای روی هم خوابیده با پیرامون پهن و دراز، گلدار و با گلهای سفید است (16 و 31).

بخشهای مورد استفاده این گیاه، سرشاخه­های گلدار آن است که طعم تلخ و بوی قوی دارد  و به دلیل وجود ترکیبات شیمیایی گوناگون، از جمله گیاهان دارویی است که در طب سنتی و طب مدرن استفاده­های گوناگونی برای آن ذکرشده است (11 و 18). از جمله موارد استفاده کلینیکی این گیاه می­توان به مواردی مانند توقف رشد و تخریب سلولهای سرطانی(18)، اثرضد درد و ضد التهابی (12 و 14) و اثر ضد دیابت (20) اشاره نمود. همچنین نتایج بررسیها نشان داده که ترکیبات ترپنی موجود در این گیاه دارای خاصیت ضد توموری و ضد سرطانی است (16) و از اسانس این گیاه در صنایع بهداشتی، آرایشی و عطر­سازی استفاده می شود (40). از مهم‌ترین ترکیبات فلاونوییدی موجود در این گیاه می­توان به کوئرستین (Quercetin)، اپیژنین (Apigenin)، لوتئولین (Luteolin) و وینسین (Vincin) اشاره کرد (36) که در انسان دارای اثر­های آنتی­اکسیدانی، ضد سرطانی و محافظت کننده از قلب می­باشد کوئرستین باعث کند شدن رشد برخی از سلولهای سرطانی شده و از سرطان روده جلوگیری می­کند (22 و 24).

متابولیتهای ثانویه بومادران بیشتر در کرکها، برگ، ساقه و به ویژه گلهای گیاه تولید می­شود، سرشاخه­های گلدار این گیاه سرشار از ترکیبات فلاونوییدی و ترپنی می­باشد (29).کمیت و کیفیت ترپنها و فلاونویید­های موجود در بومادران تحت شرایط متنوع اکولوژیکی و اقلیمی (29)، در مراحل مختلف رشدی (5) و در اندامهای مختلف (19) متفاوت می­باشد. گروهی از متابولیتهای ثانویه ترپنی از مسیر 2-سی متیل اریتریتول 4-فسفات (MEP) سنتز می­شوند (شکل1). در طی این مسیر که در پلاستید رخ می­دهد ابتدا پیروات (Pyruvate) و دی گلیسرآلدهید 3-فسفات (G3P) با یکدیگر ترکیب شده و پس از انجام واکنشهای بیوشیمیایی لازم دی اکسی زایلو 5-فسفات (DXP) به وجود می­آید که این ماده نیز تحت تأثیر آنزیم 1-دی‌اکسی دی‌زایلوز-5-فسفات ردوکتوایزومراز (DXR) باعث تبدیل دی اکسی زایلو 5-فسفات (DXP) به 2-سی متیل اریتریتول 4-فسفات(MEP) می­شود (32). ژن DXR به عنوان یک نقطه کنترلی مهم عمل می­کند، زیرا این اولین مرحله اصلی و متمایزکننده مسیر MEP می­باشد. پس از انجام واکنشهای دیگر ایزوپنتیل دی فسفات (IPP) و دی متیل آلیل دی فسفات (DMAPP) به وجود می­آیند که این دو ماده قابلیت تبدیل به یکدیگر را دارند. در ادامه با ترکیب شدن این دو ماده و تحت تأثیر ژرانیل دی فسفات سنتاز (GPPS)، ژرانیل دی فسفات (GPP) که پیش­ماده مونوترپنهاست به وجود می­آید. ژرانیل دی فسفات نیز تحت تأثیر آنزیمهای مونوترپن سنتازی مختلف به مونوترپنهای مختلف تبدیل می­شود (6).

 

 

شکل1- مسیر بیوسنتزی ترپنوییدها در گیاهان (41).

DXS; Deoxyxylose-5-phosphate synthase , DXR; 1-deoxy-D-xylose-5-phosphate reductoisomerase,

GPPS; Geranyl diphosphate synthase.

 

گروهی دیگر از متابولیتهای ثانویه فنیل­پروپانوییدها می­باشند که مولکولهای کوچک فنلی هستند که دارای یک حلقه فنیلی و یک زنجیره سه کربنی هستند. این ترکیبات از مسیر بزرگ فنیل­پروپانوییدی سنتز می­شوند (شکل1) و مسئول فراهم کردن پیش ماده­های لازم برای سنتز لیگنین، لیگنانها، فلاونوییدها و برخی ترکیبات دیگر می­باشند (37). بسیاری از آنها در دفاع علیه گیاه­خواران و عوامل بیماری­زا نقش دارند و یا در حفاظت مکانیکی، در جذب عوامل گرده افشان و پراکنده کردن میوه یا در کاهش رشد گیاهان رقیب دخالت دارند (39). مسیر بیوسنتزی فنیل پروپانوییدها مسئول فراهم کردن پیش ماده­های لازم برای فلاونوییدها و برخی ترکیبات دیگر است (شکل 2). مسیر اصلی بیوسنتز فنیل پروپانوییدها ازمسیر شیکیمیک اسید (Shikimic acid pathway) و مالونیک اسید (Malonic acid) شروع می­شود (34). فنیل­آلانین آمونیا لیاز PAL (Phenylalanine ammonia lyase) آنزیم حدواسط بین متابولیسم اولیه و ثانویه گیاه و اولین آنزیم کلیدی و تعیین کننده در ابتدای مسیر تولید فنیل پروپانوییدها است (4 و 17). آنزیم چالکون سنتاز CHS (Chalcon synthase) نیز به عنوان یک آنزیم کلیدی در مسیر بیوشیمیایی ترکیبات فلاونوییدی از اهمیت ویژه­ای برخوردار می باشد (9) که تولید فلاونوییدها را هدایت می‌کند و در بحث مهندسی ژنتیک و زیست تبدیلی ترکیبات فنیل پروپانوییدی مهم می‍باشد (2و30). آنزیم چالکون سنتاز در اکثر گیاهان، مانند بسیاری از دیگر آنزیمهای دخیل در مسیر متابولیسمهای ثانویه توسط خانواده­های کوچک ژنی رمزگشایی می­شود (21). هدف از این مطالعه بررسی الگوی بیان برخی ژنهای دخیل در بیوسنتز ترپنها و فنیل پروپانوییدها در بافتهای مختلف واجد مقادیر متفاوت از ترپنها و فنیل پروپانوییدها می باشد. همچنین بیان این ژنها در پاسخ به الیسیتور متیل جاسمونات به عنوان یکی از الیسیتورهای القا کننده واکنش دفاعی در گیاه بومادران بررسی شد.


 

شکل2- مسیر بیوسنتزی فنیل‌پروپانوییدها در گیاهان (13).

PAL; Phenylalanine ammonia lyase, C4H; Cinnamate 4-hydroxylase, 4CL; 4-Comarat coa ligase,

CHS; Chalcone synthase.


مواد و روشها

موادگیاهی، شرایط رشد و تیمار نمونه‌ها: ریزومهای گیاه دارویی بومادران هزاربرگ (Achillea millefolium subsp millefolium).  تهیه شده از باغ گیاهان دارویی همدان در گلخانه تحقیقاتی دانشکده کشاورزی دانشگاه کردستان در گلدانهای حاوی پرلیت پیت و خاک برگ رشد داده شدند. جهت تیمار نمونه­ها، محلول پاشی با متیل‌جاسمونات 1 میلی مولار (حل شده در آب مقطر) در مرحله گلدهی کامل استفاده شد و 24 ساعت بعد از محلول پاشی نمونه گیری انجام شد و برای تیمار برگها در مرحله نموی برگ کاملاً توسعه یافته محلول پاشی انجام شد. محلول پاشی فقط یک بار و تا خیس شدن کامل سطح گل یا برگ انجام شد. همچنین از برگها در مراحل مختلف نموی شامل برگ کوچک و توسعه نیافته، برگ جوان و برگ کاملاً توسعه یافته نمونه برداری انجام شد.

استخراج RNA: استخراج RNA به کمک روش Mazzara (27) با اندکی تغییر انجام شد. 1/0 گرم بافت گیاهی گل یا برگ داخل هاون به کمک ازت مایع پودر گردید سپس به میکروتیوب 2 میلی لیتری انتقال داده ­­­شد. 1میلی لیتر بافر استخراج (50 mM Tris-HCl (Ph 8), 5 mM EDTA, 150 mM LiCl, 5%SDS) به میکروتیوب اضافه شده و 30 ثانیه ورتکس ­شد. 1 میلی لیتر محلول فنل: کلروفرم: ایزوآمیل­الکل (25:24:1) به میکروتیوب اضافه شده و 2 دقیقه ورتکس شد و سپس به مدت 10 دقیقه در g16000  سانتریفیوژ  شد. فاز بالایی برداشته شد و به میکروتیوب جدید منتقل شد سپس مرحله قبل دوباره تکرار شد. مجددا فاز بالایی برداشته شده و به میکروتیوب جدید منتقل شده و هم حجم آن محلول کلروفرم: ایزوآمیل­الکل (24:1) اضافه شده و 2 دقیقه ورتکس شد سپس با شرایط بالا سانتریفیوژ شد. فاز بالایی برداشته شده و به میکروتیوب حاوی 50 میلی لیتر لیتیم­کلرید (8 مولار) منتقل شد و 12 ساعت در دمای 20- درجه سانتی گراد نگهداری شد. نمونه ها از دمای 20- درجه سانتی گراد برداشته شده و به مدت 20 دقیقه در g1300 سانتریفیوژ  شدند. در نهایت نمونه‌ها با الکل 75 درصد شستشو داده شده و در آب دپس(DEPC) حل شدند. کمیت و کیفیت RNA استخراج­ شده با دستگاه نانودراپ تعیین شد به طوری که میانگین غلظت RNA  استخراج شده750 نانوگرم بر میکرولیتر و نسبت طول موج 260 به 280  برای تمامی نمونه ها بین 6/1 تا 9/1 بود. برای ساخت cDNA از کیت RT-PCR شرکت ویوانتیس مطابق با دستورالعمل شرکت سازنده استفاده شد (Vivantis, Malaysia). به منظور بررسی صحت سنتز شدن cDNA، تمامی نمونه­ها با آغازگر ژن مرجع با استفاده از واکنش زنجیره پلی مراز تکثیر شدند.

طراحی آغازگر و واکنش زنجیره پلی مراز با رونوشت معکوس: طراحی آغازگرها به وسیله نرم افزار آنلاین (v. 0.4.0)Primer3  و با استفاده از توالیهای موجود برای ژنهای مورد نظر در پایگاه اطلاعاتی NCBI انجام شد (جدول 1). به منظور تکثیر ژنهای مورد نظر، واکنش  RT-PCR با استفاده از آغازگرهای ژن مورد نظر در دستگاه ترمال سیکلر BioradThermal cycler BioRad; USA)) انجام شد. لیست آغازگرهای استفاده شده برای واکنش زنجیره پلی مراز در دمای 58 درجه سانتی‌گراد در جدول (1) ارایه شده است.

 

جدول1- مشخصات مربوط به آغازگرهای مورد استفاده

آغازگر معکوس

آغازگر مستقیم

شماره دسترسی

ژن

ATACCCTTAAGCTTGCCTTCTG

AAGGTTATCAACGACAGGTTTG

KF286432

GAPDH

CTTGTTGAAAAGTGTGGCAGAG

TTGGTTGCTGAGCTAAAAGAAG

KU664603

DXR

GGGATCGGCTCTCTTAACC

GCTCGCCTTGATCTTTGAAC

KU664604

GPPS

GGACCTTTTTGGCTACTTGGC

GCAAGGAAAGCCCGAGTTTAC

KU664606

PAL

CGAGTGAATCAAGGTGAGTGTC

CCCGATTACTATTTTCGGATCAC

KU664607

CHS

 


محاسبه میزان نسبی بیان ژن: جهت کمی سازی عکسهای ژل، از نرم افزار GelQuantNET استفاده شد. برای نرمال سازی از ژن کنترل داخلی GAPDH(Glyceraldehyde-3-phosphate dehydrogenase) استفاده شد.  میزان نسبی بیان ژنها با توجه به نسبت بیان ژن هدف به بیان ژن مرجع با استفاده از 3 تکرار زیستی و 2 تکرار تکنیکی محاسبه شد.

آنالیزهای آماری: به منظور مقایسه بیان ژنها در مراحل مختلف نموی برگ و  همچنین در بافتهای مختلف تجزیه واریانس براساس طرح کاملاً تصادفی انجام شد و مقایسه میانگینها با آزمون دانکن به وسیله نرم افزار SPSS ver. 19 صورت پذیرفت.

نتایج

سنتز cDNA و انجام PCR با استفاده از آغازگرهای اختصاصی طراحی شده منجر به تکثیر قسمتی از ژنهای DXR (KU664603.1)، GPPS (KU664604.1)، PAL (KU664606.1) و CHS (KU664607.1) با طولهای به ترتیب  (bp474، bp653، bp761 و bp520) شد. این توالیها بعد از شناسایی جداسازی شده و در پایگاه اطلاعاتی NCBI ثبت گردید.

بیان ژنها در مراحل مختلف نموی برگ و گل: نتایج تجزیه واریانس به منظور بررسی بیان ژنهای DXR، GPPS، PALو CHSدر مراحل مختلف نموی شامل برگ توسعه نیافته، برگ جوان، برگ کاملاً گسترش یافته نشان داد که میزان بیان ژنها در مراحل مختلف نموی و بافتهای مختلف متفاوت است (05/0P<). میزان بیان این ژنها با توجه به شکل 3 در برگ جوان بیشتر از برگ کاملاً گسترش یافته و برگ توسعه نیافته می باشد احتمالاً در برگ جوان به دلیل تراکم بالای کرکهای غده‌ای بیان ژنهایی که در کرکهای غده‌ای بیان می‌شوند، بیشتر است (داده های منتشر نشده). طی مراحل مختلف نموی برگ، برگ جوان دارای تراکم بالاتری از کرکهای غده­ای نسبت به برگ توسعه نیافته و برگ کاملاً گسترش یافته در سطح خود بوده بنابرین به علت بیان بالا تر این ژنها در کرکهای غده­ای، بیان بیشتری را در این مرحله از خود نشان دادند (26). در بافت گل نیز نتایج مقایسه میانگینها با استفاده از روش دانکن نشان داد که  بیشترین  میزان بیان ژنهای DXR، GPPS، PALو CHS در گل و بعد از آن در مرحله رشدی برگ جوان می باشد (05/0P<). بیان بیشتر این ژنها در گل نسبت به برگ می­تواند ناشی از تراکم بیشتر کرکهای غده­ای در واحد سطح باشد، زیرا تراکم کرکهای غده­ای در گل نسبت به برگ بیشتر می­باشد.

 

 

شکل3- میزان بیان ژنهای مسیر ترپنویید و فنیل‌پروپانویید در مراحل مختلف نموی برگ و گل.

حروف متفاوت نشان دهنده اختلاف معنی دار به وسیله آزمون دانکن است  (P < 0.05) ±S.E.


میزان بیان ژنها تحت تیمار متیل جاسمونات در برگ و گل: نتایج تجزیه واریانس به منظور بررسی بیان ژنهای DXR، GPPS، PAL و CHSتحت تیمار متیل جاسمونات در برگ و گل مطابق شکل 4 نشان می دهد که  این ژنها تحت تیمارمتیل جاسمونات افزایش بیان معنی داری داشتند (05/0P<). به طوری که میزان افزایش بیان ژنهای DXR، GPPS، PAL و CHS به ترتیب در برگ حدود  12/2، 19/3، 31/2 و 87/1 برابر و در گل حدود  23/2، 94/2، 5/2 و 97/1 برابر بود (شکل‌ 4).

 

 

شکل 4- میزان بیان ژنهای مسیر ترپنوییدها و فنیل‌پروپانوییدها تحت تیمار متیل جاسمونات در بافت برگ کاملاً توسعه یافته و گل.

حروف متفاوت نشان دهنده اختلاف معنی دار به وسیله آزمون دانکن است  (P < 0.05) ±S.E.


بحث

نتایج حاصل از بررسی بیان ژنها در مراحل مختلف رشدی نشان می‌دهد که بیشترین میزان بیان ژنهای  1-دی‌اکسی دی‌زایلوز-5-فسفات ردوکتوایزومراز (DXR)، ژرانیل‌دی‌فسفات‌سنتاز (GPPS)، فنیل‌آلانین آمونیا لیاز (PAL) و چالکون‌سنتاز (CHS) در بافت گل و بعد از آن در برگهای جوان وجود دارد (شکل 3). همچنین مطابق شکل 3 نتایج بررسیها نشان داد که الگوی بیان ژن GPPSبیشتر از سه ژن دیگر است. بیان ژن GPPSدر هر چهار بافت گیاهی (گل، برگ کاملاً گسترش یافته، برگ جوان و برگ توسعه نیافته) نسبت به ژن DXR در مسیر MEP و نسبت به ژنهای PAL و CHS در مسیر بیوسنتزی فنیل‌پروپانوییدی بیشتر است همچنین بیان ژن PAL در مسیر فنیل ‌پروپانوییدی نسبت به CHS بیشتر است. احتمالاً در بافت گل به دلیل تراکم بالای کرکهای غده‌ای بیان ژنهایی که در کرکهای غده‌ای بیان می‌شوند، بیشتر است. بیان بیشتر این ژنها در گل نسبت به برگ می­تواند ناشی از تراکم بیشتر کرکهای غده­ای در واحد سطح باشد. زیرا تراکم کرکهای غده­ای در گل نسبت به برگ بیشتر می­باشد، همچنین در مراحل مختلف نموی، برگ جوان دارای تراکم بالاتری از کرکهای غده­ای نسبت به برگ توسعه نیافته و برگ کاملاً گسترش یافته در سطح خود بوده (شکل 3) بنابرین به علت بیان بالاتر این ژنها در کرکهای غده­ای، بیان بیشتری را در این مرحله از خود نشان دادند (25 و 43). مطالعات نشان داده که میزان ترپنها با تراکم کرکهای غده­ای یک رابطه مستقیم دارد و بافتهایی با تعداد کرکهای غده­ای بیشتر، مشتقات بیشتری از ترپنها موجود می­باشند (8 و 26). مطالعات انجام شده روی گیاه بابونه کبیر (Tanacetumparthenium) از خانواده گل ستاره‌ایها نشان می دهد که بیان ژن TpGAS از ژنهای دخیل در بیوسنتز پارتنولید ، بیان بیشتری را در برگهای جوان با تراکم بالاتر کرکهای غده­ای نسبت به برگ کاملاً گسترش یافته که تراکم کمتری از کرکهای غده ای را دارند نشان می­دهد و احتمالاً یک رابطه مثبت بین بیان ژن TpGAS با تراکم کرکهای غده­ای وجود دارد (25). در مطالعه­ای که در گیاه گل میمون (Antirrhinum majus) روی میزان بیان ژنهای مسیر MEP مرتبط با بیوسنتز ترپنها انجام شده بیشترین میزان بیان این ژنها در گلبرگها و برگهای بالایی مشاهده شده است (43). همچنین مطالعات نشان می­دهد که میزان بیان ژنهای مسیر بیوسنتزی فنیل‌پروپانوییدها به خصوص فعالیت آنزیم PALدر طی مراحل رشد رویشی و با افزایش رشد گیاه، افزایش می­یابد (38 و 45).

جاسمونیک ‌اسید ازجمله تنطیم‌کننده‌های رشد گیاهی محسوب می‌شود که نقش مهمی در سازوکار دفاعی گیاهان نسبت به تنشهای محیطی به‌خصوص القای ژنهای دفاعی در مواجهه با عوامل بیماری‌زا دارد. بررسی بیان این ژنها در اثر تیمار با متیل‌جاسمونات نشان داد که بیان نسبی ژنهای DXR، GPPS، PAL و CHS در اثر تیمار نسبت به گیاه شاهد به ترتیب در برگ حدود  12/2، 19/3، 31/2 و 87/1 برابر و در گل حدود  23/2، 94/2، 5/2 و 97/1 برابر افزایش یافته است (شکل 4). میزان بیان برای ژن GPPS پس از اعمال تیمار متیل جاسمونات نسبت به سه ژن دیگر بیشتر بود به طوری که میزان بیان ژن GPPSدر بافت برگ کاملاً توسعه یافته و گل نسبت به ژن DXR در مسیر MEP و نسبت به ژنهای PAL و CHS در مسیر فنیل‌پروپانوییدی بیشتر و در این مسیر نیز بیان ژن PAL نسبت به CHS بیشتر است. نتایج حاصل از اعمال تیمار متیل‌جاسمونات‌ نشان می­دهد که ژنهای مورد مطالعه در مسیر بیوسنتزی ترپنها و فنیل‌پروپانوییدها در این تحقیق در اثر تیمار متیل جاسمونات القاء می‌شوند که می­تواند به دلیل نقش آنها در مسیرانتقال پیام و مسیر دفاعی باشد. با توجه به این نتایج می‌توان تیمار متیل‌جاسمونات را برای افزایش بیان ژنها و آنزیمهای درگیر در مسیر بیوسنتزی ترپنها و فنیل‌پروپانوییدها و القای تغییر در ترکیبات این مسیرهای بیوسنتزی پیشنهاد کرد زیرا بر اساس مطالعات مختلف میزان تولید ترکیبات ترپنی و فنیل‌پروپانوییدی با میزان رونوشت ژنهای کلیدی دخیل در مسیر بیوسنتزی آنها ارتباط مستقیم دارد (26 و 44).

در تطابق با نتایج به دست آمده در این تحقیق، مطالعات نشان داده­اند هورمون ‌متیل جاسمونات باعث افزایش میزان متابولیتهای ثانویه در گیاهان می­گردد. در مطالعات انجام شده روی گیاه بارهنگ چینی (Salvia miltiorrhiza) روی متابولیت تانشینون که آنزیمهای مسیر MEP در بیوسنتز آن نقش دارند با استفاده از تیمار متیل جاسمونات افزایش 14 برابری برای ژن DXR گزارش شده است که در این مطالعه نیز افزایش بیان این ژن تحت تأثیر متیل جاسمونات مشاهده شده است (42). در مطالعه­ای که با استفاده از تیمار متیل‌جاسمونات بر گیاه جینسنگ هندی (Withania somnifera) انجام شد میزان بیان ژن DXR در بافت برگ پس از اعمال تیمار متیل جاسمونات افزایش یافت(15). در پژوهشی که روی گیاه پروانش (Catharanthus roseus) انجام شده استفاده از تیمار متیل جاسمونات باعث افزایش متابولیتهای ثانویه با تأثیر بر ژنهای ابتدای مسیر MEP از طریق فرآیند های سیگنالی شده و باعث افزایش بیان ژنهای دخیل در ساخت متابولیتهای ثانویه این مسیر می­گردد (33). همچنین در تحقیقات انجام شده روی گیاه صنوبر نروژی (Piceaabies) نشان داده شده که استفاده از تیمار متیل جاسمونات باعث افزایش مونوترپنوییدها برای مقابله با آفات و حشرات می‌گردد (28). بنابراین با توجه به نتایج به دست آمده به نظر می رسد که ژن DXR در مسیر بیوسنتزی ترپنها در بومادران نقش کلیدی را ایفاء می کند و به الیسیتور متیل جاسمونات پاسخ می دهد که می تواند ناشی از نقش دفاعی برخی ترکیبات تولید شده در این مسیر باشد.

نتایج به دست آمده در این تحقیق نشان داد که میزان بیان ژن GPPS نیز تحت تأثیر متیل جاسمونات قرار می گیرد. مطابق با این نتایج، تحقیقات نشان داده است که بیان نسبی ژن GPPS در سطح رونوشت در پاسخ به تیمار متیل‌جاسمونات در گیاه یونجه 5 ساعت بعد از اعمال تیمار افزایش می‌یابد (41). در تحقیقی که روی گیاه ریحان شیرین (Ocimum basilicum) انجام شد از متیل‌ جاسمونات به صورت محلول پاشی روی گیاهان استفاده شد و نتایج نشان داد که  کل محتوای فنلی بیوسنتز شده از مسیر فنیل‌پروپانوییدها از جمله ترپنوییدها به‌صورت قابل توجهی بعد از تیمار با متیل‌جاسمونات در مقایسه با گیاهان شاهد افزایش یافت. از آنجایی که ساخت سزکویی ترپن لاکتونها از واحدهای کوچک سازنده مونوترپن ساخته می شوند پس افزایش مونوترپنها تحت این تیمار می تواند باعث افزایش سزکویی ترپن لاکتونها نیز گردد (23). در تحقیقات انجام شده روی گیاه مارچوبه (Asparagus officinalis) کاربرد متیل جاسمونات باعث افزایش مقدار ترکیبات فنولی شده است (7). همچنین در مطالعات انجام شده تحت تیمار متیل جاسمونات در کشت سوسپانسیون ریشه جین سینگ (Panax ginseng) و شیرین بیان (Glycyrrhiza glabra L.) متیل جاسمونات باعث افزایش فعالیت آنزیم PAL شده است (3، 35 و 41). با توجه به نتایج به دست آمده در این تحقیق، بیان ژنهای دخیل در بیوسنتز ترپنها و فنیل پروپانوییدها در گیاه بومادران در بافتهای گل و برگ متفاوت بوده و این می تواند دلیلی بر وجود مقادیر متفاوت از ترکیبات ترپنی و فنیل پروپانوییدی در بافتهای مختلف باشد. همچنین تیمار متیل جاسمونات باعث افزایش بیان این ژنها شد که نشان دهنده نقش برخی ترکیبات مرتبط با این دو مسیر بیوسنتزی در واکنشهای دفاعی می باشد. همچنین با توجه به این نتایج استفاده از الیسیتورهای غیر زیستی مانند متیل جاسمونات می تواند راهکاری برای افزایش تولید این متابولیتها باشد.

1- ضابط،  م.، افشاری، ف.، 1394. تجزیه و تحلیل کاریوتیپی ژنوتیپ های بومادران با استفاده از روش های آماری چند متغیر. مجله پژوهش های سلولی و مولکولی (زیست شناسی ایران) . 28 (3): 383- 371 .
2- آشنگرف، م.،  نحوی، ا.، 1393. تولید زیستی وانیلین طبیعی از سوبستراهای فنیل پروپانوئیدی بوسیله زیست تبدیلی با استفاده از سلول های میکروبی. 27 (3) : 334-316.
 
3- Ali M.B., Hahn E.J. and Paek K.Y. (2007). Methyl jasmonate and salicylic acid induced oxidative stress and accumulation of phenolics in Panax ginseng bioreactor root suspension cultures. Molecules, 12: 607-621.
4- Anterola A.M., Jeon J.H., Davin L.B. (2002). Transcriptional control of monolignol biosynthesis in Pinus taeda. Journal of Biological Chemistry, 277(21): 18272- 18280.
5- Azizi M., Chizzola R., Ghani A. and Oroojalian F. (2010). Composition at different development stages of the essential oil of four Achillea species grown in Iran. Natural Product Communications, an International Journal for Communications and Reviews Covering all Aspects of Natural Products Research. 5(2): 175-350.
6- Banerjee A. and Sharkey T. D. (2014). Methylerythritol 4-phosphate (MEP) pathway metabolic regulation. Natural Product Reports, 31(8), 1043-1055.
7- Basilio Heredia J. and Cisneros- Zevallos, L. (2009). The effect of exogenous ethylene and methy jasmonate on the accumulation of phenolic antioxidants in selected whole and wounded fresh produce. Food Chemistry.115: 1500- 1508.
8- Bosabalidis A.M. and Kokkini, S. (1997). Infraspecific variation of leaf anatomy in Origanum vulgare grown wild in Greece. Botanical Journal of the Linnean Society, 123(4):353-362.
9- Bourgand F., Gravot A., Milesi S. and Gonteir, E. (2011). Production of plant secondary metabolites: a historical perpective. Plant Science, 161: 839-851.
10- Candan F., Unlu M., Tepe B., Daferera D.,Polissiou M., Sokmen A. (2003). Antioxidant andantimicrobial activity of the essential oil andmethanol extracts of Achillea millefolium subsp.millefolium. (Asteraceae). Journal of Ethnopharmacology. 87 (2-3):215-220.
11- Csupor-Löffler, B., Hajdú, Z., Zupkó, I., Réthy, B., Falkay, G. and Forgo, P. (2009).Antiproliferative effect of flavonoids and sesquiterpenoidsfrom Achillea millefolium s.l. on cultured human tumour cell lines. Phytotherapy Research2009;23(5):672-6.
12- Dalsenter P.R., Cavalcanti A.M., Andrade A.J., Araújo S.L. and Marques M.C. (2004). Reproductive evaluation of aqueous crude extract of Achillea millefolium L. (Asteraceae) in Wistar rats. Reproductive Toxicology,18(6):819-23.
13- Flamini R., Mattivi F., Rosso M. D., Arapitsas P., & Bavaresco L. (2013). Advanced knowledge of three important classes of grape phenolics: anthocyanins, stilbenes and flavonols. International Journal of Molecular Sciences, 14(10), 19651-19669.‏
14- Graf J. (2000). Herbal anti-inflammatory agents for skin disease. Skin Therapy Lett, 5(4): 3-5.
15- Gupta P., Agarwal A.V., Akhtar N., Sangwan R.S., Singh S.P. and Trivedi P.K.  (2013). Cloning and characterization of 2-C-methyl-D-erythritol-4-phosphate pathway genes for isoprenoid biosynthesis from Indian ginseng, Withania somnifera. Protoplasma, 250: 285-295.
16- Haidara K., Zamir L., Shi Q.W. and Batist G. (2006). The flavonoid Casticin has multiple mechanisms of tumor cytotoxicity action. Cancer Letters., 242: 180-190.
17- Humphreys J.M. and Chapple C. (2002). Rewriting the lignin roadmap. Current Opinion in Plant Biology, 5: 224-229.
18- Innocenti G., Vegeto E., Dall'Acqua S., Ciana P., Giorgetti M. and Agradi E. (2007). In vitro estrogenic activity of Achillea millefolium L. Phytomedicine,14(2-3):147-52.
19- Jaimand K., Rezaee M.B. and Mozaffarian V. (2006). Chemical constituents of the leaf and flower oils from Achillea millefolium subsp. elbursensis. Journal of Essential Oil Research.,18: 293-295.
20- Jerald E., Joshi S.B. and Jain D.C. (2008). Diabetes and Herbal Medicines. Iran Journal of  Pharmacology and Therapeutics,7(1):97-106.
21- Ji Y., Jinxia H., Hongya G.,Yang Zh. and Ziheng Y. (2002). Duplication and adaptive evolution of Chalcone synthase genes of dendranthema (Asteraceae). Molecular Biology and Evolution, 19: 1752-1759.
22- Katan M.B. and Hollman P.C.H. (1998). Dietary flavonoids and cardiovascular disease. Nutrition, Metabolism and Cardiovascular Diseases, 8: 1-4.
23- Kim H.J., Chen F., Wang X. and Rajapakse N.C. (2006). Effect of methyl jasmonate on secondary metabolites of sweet basil (Ocimum basilicum L.). Journal of Agricultural and Food Chemistry 54(6):2327-2332.
24- Lale A., Herbert J.M., Augereau J.M., Billon M., Leconte M. and Gleye J. (1996). Ability of different flavonoids to inhibit the procoagulant activity of adherent human monocytes. Journal Natural Products, 59(3): 273-276.
25- Majdi M., Karimzadeh G. and Malboobi M. (2014). Spatial and developmental expression of key genes of terpene biosynthesis in Tanacetum parthenium. Biologia Plantarum, 58(2):379-384.
26- Majdi M., Liu Q., Karimzadeh G., Malboobi M.A., Beekwilder J., Cankar K., de Vos R., Todorovic S., Simonovic A. and Bouwmeester H. (2011). Biosynthesis and localization of parthenolide in glandular trichomes of feverfew (Tanacetum parthenium L. Schulz Bip.). Phytochemistry, 72: 1739-1750.
27- Mazzara M. and James D. J. (2000). The influence of photoperiodic growth condition on isolation of RNA from strawberry (Fragaria× ananassa Duch.) tissue.Molecular Biotechnology, 15(3), 237-241.
28- Martin D., Tholl D., Gershenzon J. and Bohlmann J. (2002). Methyl jasmonate induces traumatic resin ducts, terpenoid resin biosynthesis, and terpenoid accumulation in developing xylem of Norway spruce stems. Plant Physiology. 129: 1003-1018.
29- Mockute D. and Judzentiene A. (2002). Chemical composition of the essential oils of Achillea millefolium L. subsp. millefolium (yarrow) growing wild in Vilnius.Institute of Chemistry.Journal of Chemija (Vilnius). 13(2): 97-102.
30- Oksman-Caldentey K.M., Inzé D.  (2004). Plant cell factories in the post-genomic era: new ways to produce designer secondary metabolites. Trends in Plant Science, 9(9): 433-440.
31- Rechinger K.H. (1986). Flora Iranica, Issue 158. Akademische Druck-U.Verna gsanstalt, Graz Austria.
32- Rohmer M. (1999). The discovery of a mevalonate –independent pathway for isoprenoid biosynthesis in bacteria, algae and higher plants. Natural Product Reports, 16: 565-574.
33- Ruiz-May E., Galaz-Avalos R.M. and Loyola-Vargas V.M. (2009). Differential secretion and accumulation of terpene indole alkaloids in hairy roots of Catharanthus roseus treated with methyl jasmonate. Molecular Biotechnology 41(3):278-285.
34- Saufi A. (2007). Lignans in Phaleria macrocarpa and in Linum flavum var. compactum L. Doctoral Thesis. Heinrich-Heine-Dusseldorf University, Germany, 300-316.
35- Shabani  L. and Ehsanpour A.A. (2009). Induction of antioxidant enzymes, phenolic and flavonoid compounds in in vitro culture of licorice (Glycyrrhiza glabra L.) using methyl jasmonate and salicylic acid. Iranian Journal of Plant Biology, 21(3):421-432.
36- Sharma H., Parihar L.and Parihar P. (2011). Review on cancer and anticancerous properties of some medicinal plants. Journal of  Medicinal  Plan Research, 5(10):1818-1835 .
37- Sumner L.W., Mendes P. and Dixon R. A. (2003). Plant metabolomics large-scale phytochemistry in the functional genomics era. Phytochemistry, 62(6), 817-836.
38- Tahsili J., Sharifi M., Behmanesh B., Pourbozorgi R.N. and Ziaei M. (2010). Gene expression of eugenol O – methyl transferase and components of essential oils in (Ocimum basilicum L.) at different stages of growth. Journal of Biology, 23 (1): 25-18.
39- Taiz L., and Zeiger E. (2006). Stress physiology. Plant Physiology, 4.
40- Upton R., Graff A., Jolliffe G., Länger R. and Williamson E. (2011). American Herbal Pharmacopoeia: botanical pharmacognosy-microscopic characterization of botanical medicines. CRC Press, 800p.
41- Yan S., Ruicai L., Qingchuan Y., Tiejun Z. and Junmei K. (2013). Molecular cloning and characterization of three isopernyl diphosphate synthase genes from alfalfa. Molecular Biology Reports, 28: 572-582
42- Yang D., Ma P., Liang X., Wei Z., Liang Z., Liu Y. and Liu F. (2012). PEG and ABA trigger methyl jasmonate accumulation to induce the MEP pathway and increase tanshinone production in Salvia miltiorrhiza hairy roots.  Physiologia Plantarum, 146(2), 173-183.
43- Zhang Y., Teoh K.H. Reed D.W., Maes L., Goossens A., Olson D.J., Ross A.R. and Covello P.S. (2008). The molecular cloning of artemisinic aldehyde Δ11 (13) reductase and its role in glandular trichome-dependent biosynthesis of artemisinin in Artemisia annua. Journal of Biological Chemistry, 283: 21501-21508.
44- Zheng X., Xu H., Ma X., Zhan, R., & Chen W. (2014). Triterpenoid saponin biosynthetic pathway profiling and candidate gene mining of the Ilex asprella root using RNA-seq. International Journal of Molecular Sciences, 15(4), 5970-5987.
45- Ziaei M., Sharifi M., Behmanesh M. and Razavi K. (2012). Gene expression and activity of phenyl alanine ammonialyase and essential oil composition of Ocimumbasilicum L. at different growth stage. Journal of Biotechnology, 10: 32-39.