نوع مقاله : مقاله پژوهشی

نویسندگان

1 گروه زیست شناسی، دانشکده علوم پایه، دانشگاه گنبد کاووس، گنبد کاووس، ایران.

2 گروه میکروب شناسی، دانشکده پزشکی، دانشگاه علوم پزشکی گلستان، گرگان، ایران.

چکیده

سرطان کولون چهارمین سرطان شایع می‌باشد. با توجه به شیوع بسیار بالای سرطان و مرگ ناشی از آن، اهمیت پرداختن به پژوهش‌های مرتبط با داروها از جمله ترکیبات موثر در پیشگیری، درمان و جلوگیری از عود و بازگشت سرطان کاملا واضح و آشکار است. کورکومین رنگدانه زرد طبیعی جداشده از ریزوم زردچوبه می‌باشد. کورکومین یک کاندید جدید برای درمان سرطان محسوب می‌شود اما دسترسی زیستی و حلالیت کم، استفاده از آن را با محدودیت روبرو کرده است. بدین منظور اثر نانوحامل دندروزومی در افزایش اثر کورکومین بر روی رده سلولی سرطانی کولون (Caco-2) مورد بررسی قرار گرفت. بدین منظور IC50 با استفاده از روش MTT محاسبه گردید و همچنین تاثیر نانوکورکومین دندروزومی بر بیان ژن‌های POU5F1 و NANOG به وسیله روش Real Time PCR بررسی شد. نتایج ما نشان داد که نانوکورکومین دندروزومی به صورت وابسته به زمان و غلظت، رشد سلولی را کاهش داده، علاوه بر این بیان ژن‌های POU5F1و NANOG را در رده سلولی Caco-2 سرطان کولون کاهش می‌دهد. به‌طور کلی نتایج نشان داد که نانوکورکومین دندروزومی می‌تواند به طور مؤثر در درمان سرطان کولون با کاهش بیان ژن‌های دخیل در تکثیر نامحدود سلول‌ها دخیل باشد.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Investigation of POU5F1 and NANOG gene expression in colon cancer cell line (Caco-2) treated by dendrosomal nano-curcumin

نویسندگان [English]

  • Marziyeh Choori 1
  • sohrab Boozarpour 1
  • Abdolvahab moradi 2
  • Eisa Jorjani 1

1 Department of Biology, Faculty of Basic Science, Gonbadkavous University, Gonbadkavous, Golestan, Iran.

2 Department of Microbiology, School of Medicine, Golestan University of Medical Sciences, Gorgan, Iran.

چکیده [English]

Colon cancer is the fourth most common cancer. With concern to high prevalence and mortality of colon cancer, it is obvious the importance of drug related study, such as effective component in prevention, therapy and recurrence of the cancer. Curcumin is natural yellow pigment isolated from rhizome of turmeric. Curcumin is a new candidate for anticancer treatment, but its low bioavailability and water solubility represent the main disadvantages of its use. In this study, the role of dendrosomal nano carrier assessed in increment of curcumin effects in colon cancer cell line (caco-2). For this reason, IC50 was determined by MTT assay. Also, the effects of dendrosomal nano-curcumin recognized with gene expression study of POU5F1 and NANOG by Real Time PCR. Our finding showed that dendrosomal nano-curcumin decrease cell growth depends on time and concentration, moreover, it significantly declines POU5F1 and NANOG gene expression in colon cancer cell line (caco-2). Overall, the results showed that dendrosomal nano-cucomin could be effective in therapy of colon cancer by reducing the expression of genes involved in unlimited cell proliferation.

کلیدواژه‌ها [English]

  • dendrosomal curcumin
  • Colon cancer
  • POU5F1
  • NANOG

بررسی اثر نانوکورکومین دندروزومی بر بیان ژن های POU5F1وNANOGدر رده سلولیCaco-2 سرطان کولون

مرضیه چوری، سهراب بوذرپور*، عبدالوهاب مرادی و عیسی جرجانی

ایران، گنبد کاووس،دانشگاه گنبد کاووس، دانشکده علوم پایه، گروه زیست شناسی

تاریخ دریافت: 21/6/96                تاریخ پذیرش: 16/11/96

چکیده

سرطان کولون چهارمین سرطان شایع می‌باشد. با توجه به شیوع بسیار بالای سرطان و مرگ ناشی از آن، اهمیت پرداختن به پژوهش‌های مرتبط با داروها از جمله ترکیبات موثر در پیشگیری، درمان و جلوگیری از عود و بازگشت سرطان کاملا واضح و آشکار است. کورکومین رنگدانه زرد طبیعی جداشده از ریزوم زردچوبه می‌باشد. کورکومین یک کاندید جدید برای درمان سرطان محسوب می‌شود اما دسترسی زیستی و حلالیت کم،  استفاده از آن را با محدودیت روبرو کرده است. بدین منظور اثر نانوحامل دندروزومی در افزایش اثر کورکومین بر روی رده سلولی سرطانی کولون (Caco-2) مورد بررسی قرار گرفت. بدین منظور IC50 با استفاده از روش MTT محاسبه گردید و همچنین تاثیر نانوکورکومین دندروزومی بر بیان ژن‌های POU5F1 و NANOG به وسیله روش Real Time PCR بررسی شد. نتایج مطالعه حاضر نشان داد که نانوکورکومین دندروزومی به صورت وابسته به زمان و غلظت، رشد سلولی را کاهش داده، علاوه بر این بیان ژن‌های  POU5F1وNANOG را در رده سلولیCaco-2سرطان کولون کاهش می‌دهد. به‌طور کلی نتایج نشان داد که نانوکورکومین دندروزومی می‌تواند به طور مؤثر در درمان سرطان کولون با کاهش بیان ژن‌های دخیل در تکثیر نامحدود سلول‌ها دخیل باشد.   

واژه های کلیدی: نانوکورکومین دندروزومی، سرطان کولون، POU5F1 ،NANOG .

* نویسنده مسئول، تلفن: 09126878783 ، پست الکترونیکی:[email protected]

مقدمه

 

سرطان یک فرایند چند مرحله‌ای بوده که دوره نهفته آن طولانی ولی در ادامه سریع و پیش‌رونده است (14). با توجه به شیوع بسیار بالای سرطان و مرگ ناشی از آن، اهمیت پرداختن به پژوهش های مرتبط با داروها از جمله ترکیبات موثر در پیشگیری، درمان و جلوگیری از عود مجدد سرطان کاملا آشکار است. سرطان کولون، شایع ترین سرطان دستگاه گوارش می باشد که اگر در مراحل اولیه تشخیص داده شوند قابل درمان است. روش‌های مختلفی برای درمان سرطان کولون مانند جراحی، شیمی‌درمانی و ایمنوتراپی وجود دارد، با این حال، امروزه تحقیقات گسترده ای جهت استفاده از ترکیباتی با منشا گیاهی در حال انجام می باشد (4 و 5 ، 18).

Turmeric یا زردچوبه، نام عامیانه گیاه Curcuma longa عضوی از خانواده زنجبیل می باشد که ریزوم های خشک شده آن به عنوان غذا و همچنین دارو در طب سنتی استفاده می گردد (10). زردچوبه علاوه بر استفاده به‌ عنوان ادویه، طعم دهنده و رنگ دهنده به غذا، به طور سنتی برای درمان بیماری های مختلف از جمله زخم معده، زردی، تصفیه خون، گلودرد، نفخ شکم، تب، بیماری‌های پوستی مانند پسوریازیس، بیماری‌های ریوی مثل آسم، آلرژی، روماتیسم و غیره کاربرد داشته است (18,23,24). با این حال نامحلول بودن، جذب و توزیع بافتی پایین، فعالیت کم، متابولیسم سریع و غیرفعال بودن محصولات حاصل در بدن، استفاده از کورکومین را به‌عنوان یک دارو با محدودیت روبه‌رو کرده است (12). بدین علت راهکارهای متنوعی جهت رفع این محدودیت ها در حال بررسی می باشد از آن جمله می توان به طراحی آنالوگ‌های ساختاری، مهارکننده‌های متابولیسمی و ناقل‌های فسفولیپیدی اشاره کرد (22). دندروزوم ها، نانو ناقل‌های پلیمری شاخه دار مشتق از اولئیک اسید می‌باشند و برای اولین بار در ایران سنتز شدند. پایداری، عدم سمیت، خنثی بودن بار الکتریکی، زیست‌تخریب‌پذیری، تهیه آسان و هزینه اندک تولید از ویژگی های این ناقلین محسوب می شود (26,25).

بر اساس نظریه سلول بنیادی سرطان، سلول های بنیادی بالغ که تقریباً در تمامی بافت های بدن یافت می شوند، منشا پیدایش و توسعه سرطان می باشند. این نظریه با ردیابی رده های سلولی در تومورهای در حال رشد تائید شده است. گزارشات متعددی حاکی از ارتباط مستقیم افزایش بیان ژن های ویژه سلول های بنیادی، پیشرفت و تهاجم سلول های سرطانی وجود دارد (17).

فاکتورهای رونویسی نقش مهمی در بقاء ویژگی های پرتوانی و خودنوزائی سلول های بنیادی دارند که ژن های POU5F1وNANOG جزء مهمترین ژن های دخیل در حفظ خودنوزائی و ویژگی های پرتوانی بوده و ژن های شروع کننده تمایز را مهار می کنند (7).

همچنین مطالعات متعددی بیانگر افزایش بیان این ژن ها در سلول های سرطانی کولون می باشد به طوریکه ژن هایPOU5F1  و NANOGرا به عنوان عامل مهمی در رشد و پیشرفت سلول های سرطانی کولون مطرح کرده است(13).

بنابراین ما در این مطالعه برای بررسی اثرپذیری و کارایی نانوکورکومین دندروزومی بر رده سلولی Caco-2 سرطان کولون بیان این ژن ها را مورد بررسی قرار دادیم.

مواد و روشها

کشت سلولی: به منظور کشت و ازدیاد رده سلولی Caco-2 سرطان کولون در آزمایشگاه از محیط کشت DMEM حاوی 20% FBS (سرم جنینی گاوی) و 1% آنتی‌بیوتیک پنی‌سیلین- استرپستومایین استفاده گردید و سلول ها در دمای 37 درجه سانتی گراد و CO2 5% انکوبه شدند. محیط کشت سلول ها هر 4 روز تعویض و تقریباً هر دو هفته یکبار سلول ها توسط تریپسین پاساژ داده شدند.

بررسی بقا سلولی پس از تیمار با کورکومین آزاد و نانوکورکومین دندروزومی با استفاده از روش MTT : میزان حساسیت سلول های کولون به داروی نانوکورکومین دندروزومی و کورکومین آزاد با روش MTT بررسی گردید. بدین منظور ده هزار سلول سرطانی(Caco-2) را در هر چاهک از پلیت 96 خانه ای قرار داده و پس از گذشت 24 ساعت، تحت تیمار با غلظت های مختلف نانوکورکومین دندروزومی، قرار داده شدند. همزمان به عنوان شاهد، تیمار با دندروزوم نیز برای بررسی سمیت این حامل بر رده سلولی مورد مطالعه صورت گرفت. در بازه های زمانی 24، 48 و 72 ساعت پس از تیمار، محیط کشت حاوی دارو حذف و سلول ها با PBS شستشو شدند و سپس 20 میکرولیتر محلول MTT با غلظت 5 میلی گرم در هر میلی لیتر به هر چاهک اضافه شد و نمونه ها به مدت 4 ساعت در 37 درجه سانتی گراد انکوبه شدند. سلول های زنده قادر هستند که MTT را احیاء نموده و فورمازان را ایجاد کنند که وجه تمایز سلول های زنده از سلول های مرده می باشد. به منظور بررسی میزان رسوب فورمازان تشکیل شده در سلول، 200 میکرولیتر DMSO به سلول ها اضافه شد و به مدت 15 دقیقه در دمای محیط انکوبه گردید و سپس شدت رنگ هر چاهک با استفاده از دستگاه الایزا در طول موج 570 نانومتر تعیین گردید. درصد سلول های زنده در هر غلظت، از تقسیم میانگین جذب نوری سلول های تیمار شده با آن غلظت از ماده، بر میانگین جذب نوری کنترل(غلظت صفر دارو) و ضرب عدد حاصل در 100 محاسبه گردید. با این روش، IC50 که به عنوان غلظتی از دارو می باشد که توانایی کشتن نیمی از سلول ها را دارد تعیین شد. نتایج بدست آمده توسط نرم افزار Excel به صورت منحنی های دوز- پاسخ رسم گردید.

استخراج RNA : RNA تام سلول با استفاده از محلول Roche, Germany)) Tripure طبق پروتکل استاندارد کیت از سلول ها، استخراج گردید. بررسی کیفیت و کمیت RNA استخراج شده برای مراحل بعدی آزمایشات به ویژه روش Real time PCR از اهمیت ویژه ای برخوردار است. کمیت RNA به وسیله جذب نوری نمونه ها در 260 نانومتر در دستگاه نانودرآپ تعیین گردید و همچنین کیفیت RNA با بررسی پیوستگی آن در الکتروفورز ژل آگارز بررسی شد. در ادامه برای حذف آلودگی احتمالی DNA نمونه های RNA استخراج شده طبق پروتکل استاندارد با (Thermo Scientific, USA) DNase I تیمار شدند.

بررسی بیان ژن های OCT-4 و  NANOGبا استفاه از روش Real time PCR

واکنش نسخه‌برداری معکوس (سنتز cDNA): سنتز cDNA، با استفاده از آغازگرهای Oligo (dT) و Random Hexamers طبق پروتکل استاندارد کیت  PrimeScript RT reagent Kit (Takara, Japan) صورت گرفت بر این اساس، واکنش نسخه برداری معکوس در دمای 37 درجه سانتی گراد به مدت 15 دقیقه انجام پذیرفت و در نهایت آنزیم نسخه بردار معکوس در دمای 85 درجه سانتی گراد به مدت 5 ثانیه غیرفعال گردید و نمونه ها به فریزر 20- درجه سانتی گراد منتقل شدند.

برای بررسی میزان بیان ژن ها، پرایمرهای مورد نیاز برای ژن های OCT-4B1، NANOG وGAPDH(ژن مرجع) از مقالات مختلف انتخاب و توسط نرم افزار آنلاین BLAST-Primer بررسی شدند و در نهایت سه جفت پرایمر اختصاصی انتخاب گردید (جدول1). واکنش Real time PCR با استفاده از TAKARA, Japan))Premix Ex Taq TM II SYBR و پرایمرهای اختصاصی انجام گرفت (جدول2). برای به دست آوردن شرایط بهینه، واکنش های مختلف از نظر بازه دمایی صورت گرفت.

 

 

جدول 1- توالی و ویژگی های پرایمرهای مورد استفاده

نام ژن

شماره پذیرشNCBI

(Acceptation number)

توالی

دمای اتصال

(Annealing)

اندازه‌ی قطعه

OCT-4B1

NM_001285986

F5’- GGTTCTATTTGGTGGGTTCC -3’

°C60

bp 130

R 5’- TTCTCCCTCTCCCTACTCCTC -3’

GAPDH

NM-001289746.1

F5’- GTGAACCATGAGAAGTATGACAAC-3’

°C60

bp 123

R5’- CATGAGTCCTTCCACGATACC-3’

NANOG

XM_011520852.1

F5’- AATACCTCAGCCTCCAGCAGATG -3’

°C60

bp 149

R5’- TGCGTCACACCATTGCTATTCTTC -3’

 

 

جدول2- برنامه واکنش Real Time PCR

برنامه

مرحله

دما

زمان

تعداد چرخه

1

واسرشتگی اولیه

̊C 95

"30

1

2

واسرشتگی و اتصال

̊C 95

"5

40

3

گسترش

̊C 60

"30

4

منحنی ذوب

̊C 95

̊C 60

̊C 95

"15

"60

"15

1

 

آنالیز داده ها با استفاده از روش ارزیابی نسبی صورت گرفت. این روش بر پایه نسبت بیان ژن مورد نظر به ژن مرجع است. پس از محاسبه کارایی تکثیر آغازگرهای واکنش که به منظور استفاده از روش 14 2-خ”خ”Ct">  انجام شد، آنالیز داده های حاصل از Real time PCR براسـاس چرخـه آسـتانه به دست آمده برای ژن های هدف و مرجـع و محاسـبه   142-خ”خ”Ct">  طبق قانون لیواک انجام گرفت و در نهایت آنالیز داده های Real time PCR با نرم افزار REST و رسم نمودارها توسط نرم افزارExcel صورت گرفت.

نتایج و بحث

بررسی سمیت سلولی نانوکورکومین دندروزومی و کورکومین آزاد بر روی رده سلولی Caco-2 سرطان کولون:به‌منظور بررسی اثرات سمیت سلولی و فعالیت ضد سرطانی کورکومین و نانوکورکومین دندروزومی در شرایط in vitro بر رده سلولی Caco-2 سرطان کولون از تست MTT استفاده شد. بدین منظور غلظت‌های مختلفی از ترکیبات فوق بر روی سلول‌ها اثر داده شد و سلول‌های بدون تیمار نیز به‌ عنوان کنترل در نظر گرفته شدند. میزان زنده ماندن سلول‌ها به کمک سنجش MTT در سه بازه زمانی 24, 48 و 72 ساعت ارزیابی گردید.

نتایج نشان داد که کورکومین آزاد و نانوکورکومین دندروزومی به شکل وابسته به غلظت و زمان موجب مهار رشد سلول های سرطانی کولون می شوند. همچنین نانوکورکومین دندروزومی در مقایسه با کورکومین آزاد اثر سمیت بیشتری دارد و در غلظت‌های پایین‌تر سبب مرگ سلولی شده درصورتی‌که کورکومین آزاد در غلظت‌های بالاتر سبب مرگ سلولی می‌شود و این نشان‌دهنده حلالیت پایین کورکومین می‌باشد. داده های حاصل نشان می‌دهد که القای مرگ سلولی در سلول‌های Caco-2 سرطان کولون از طریق کورکومین صورت گرفته و دندروزوم حلالیت کورکومین را باعث شده است.

پس از تیمار سلول های سرطانی با کورکومین آزاد میزان مرگ و میر سلول ها تا غلظت30 میکرومولار اندک بود اما در غلظت های بیش از40 میکرومولار، افزایش ناگهانی در مرگ و میر سلول ها مشاهده گردید. به طوری که میزان IC50 در 24 ساعت برابر با60 و در 48 ساعت برابر با 49 میکرومولار محاسبه گردید. پس از تیمار سلول های Caco-2 سرطان کولون با نانوکورکومین دندروزومی در غلظت های 15-10 میکرومولار اثر چندانی بر میزان مرگ و میر سلول ها مشاهده نشد در حالیکه در غلظت های 25-20 میکرومولار افزایش ناگهانی در مرگ سلول ها قابل مشاهده بود این میزان پس از گذشت 48 و 72 ساعت از تیمار سلول ها با نانوکورکومین دندروزومی بیشتر گردید.

با توجه به نتایج بدست آمده، IC50 نانوکورکومین دندروزومی در بازه زمانی 24 ساعت معادل 26 میکرومولار و در 48 ساعت برابر با 22 و در 72 ساعت 18 میکرومولار محاسبه گردید. لذا نتایج ما رفتار وابسته به دوز نانوکورکومین دندروزومی را نشان می دهد.

بررسی بیان ژن های OCT-4B1 و  NANOGتوسط نانوکورکومین دندروزومی: به منظور بررسی اختصاصیت پرایمرهای مورد استفاده از منحنی‌های ذوب آن‌ها استفاده گردید وجود یک پیک نشانه اختصاصیت تکثیر انجام شــده در هر سه پرایمر مورد استفاده می‌باشد (نمودار 1).


الف

ب

ج

 

نمودار 1- منحنی ذوب مربوط به بررسی بیان ژن های الف)  GAPDH، ب) NANOG ، ج) OCT-4B1 که توسط دستگاه Real-Time PCR (One Step Plus ABI) ثبت شده است. وجود یک پیک در نمودار بیانگر تکثیر اختصاصی ژن های موردمطالعه می باشد.

 


رسم منحنی استاندارد و محاسبه Efficiency برای ژن های مورد مطالعه: برای هر یک از ژن‌های مورد مطالعه به طور همزمان، یک واکنش Real time PCR انجام شد و پس از اتمام کار، منحنی استاندارد و نمودار تکثیر بر اساس  CTهای حاصل از هر یک از این واکنش‌ها به شکل زیر توسط دستگاه رسم گردید (نمودار‌ 2).

کارایی تکثیر ژن GAPDH معادل،121.33 و ژن NANOG، 99.71 می‌باشد و کارایی تکثیر واکنش برای ژن OCT-4B1 معادل 93.91 می‌باشد.

 

الف

ب

 

ج

نمودار 2- منحنی استاندارد ژن های مورد مطالعه که توسط دستگاه Real-Time PCR ثبت شده است. الف) GAPDH با کارایی121.33 ، ب) NANOG با کارایی99.71  ، ج) OCT-4B1 با کارایی 93.91.

 

 


بررسی اثر نانوکورکومین دندروزومی بر بیان ژن های OCT-4B1 و NANOG در سلول های Caco-2 سرطان کولون: داده های حاصل از Real Time PCR نشان داد که ژن های OCT-4B1وNANOGدر ردهسلولی Caco-2 سرطان کولون بیان می شوند که می تواند نشان دهنده نقش این ژن ها در رشد و تکثیر تومورهای کولون باشد. نتایج نشان داد که بیان ژن NANOG پس از تیمار با نانوکورکومین دندروزومی 3.15 برابر و بیان ژن  OCT-4B12.58 برابر کاهش می یابد. در نتیجه تیمار به میزان IC50 نانوکورکومین دندروزومی (26میکرومولار) بیان ژن های مورد مطالعه را به طور معناداری کاهش می دهد (نمودار 3).

 

الف

 

ب

 

نمودار 3- بررسی بیان mRNA ژن های مورد مطالعه پس از تیمار به میزان IC50 نانوکورکومین دندروزومی. الف) بیان ژن NANOG پس از تیمار 24ساعته، ب) بیان ژن OCT-4 B1 پس از تیمار 24ساعته.

 

با توجه به میزان بالای شیوع سرطان و مرگ ناشی از آن، اهمیت شناسایی داروهای موثر بر سلول های سرطانی واضح و آشکار می باشد. سرطان کولون از جمله سرطان هایی است که شیوع بسیار زیادی دارد (14). بطوریکه، چهارمین سرطان شایع در میان افراد جامعه می باشد. اختلال در مسیرهای پیام رسان متعدد یکی از روندهایی است که موجب بروز سرطان کولون می گردد. نقش کورکومین در مهار مسیر WNT و در نتیجه کاهش تکثیر سلولی در مطالعات مختلف و از طرق گوناگون بررسی و تایید شده است. همچنین تاثیر آن بر مسیرهای PTEN و NFKB از طریق مهار ژن miR-21 تایید شده است. علاوه بر این از آنجاییکه سرطان کولون بیماری است که نقش اپی ژنتیک در آن بارز می باشد لذا ترکیباتی مانند کورکومین که با متیل ترانسفرازها و دیگر آنزیم های دخیل در فرایندهای اپی ژنتیکی بر همکنش دارد کاندید مناسبی برای درمان آن می باشد (15,9).

لذا ما در این تحقیق اثر نانوکورکومین دندروزومی را در مقایسه با کورکومین آزاد مورد مطالعه قرار دادیم نتایج این پژوهش نشان داد که نانوکورکومین دندروزومی در مقایسه با کورکومین آزاد اثر سمیت بیشتری دارد و در غلظت‌های پایین‌تر سبب مرگ سلولی شده در صورتی‌که کورکومین آزاد در غلظت‌های بالاتر سبب مرگ سلولی می‌شود و این نشان‌دهنده حلالیت پایین کورکومین می‌باشد. این داده‌ها نشان می‌دهد که القای مرگ سلولی در سلول‌های Caco-2 سرطان کولون به ‌واسطه کورکومین صورت گرفته و دندروزوم با افزایش حلالیت کورکومین این رسانش را به سلول‌های سرطانی تسهیل کرده است و این در حالی است که دندروزوم به تنهایی فاقد سمیت بر این رده سلولی می باشد.

یافته های حاضر نشان داد که نانوکورکومین دندروزومی اثر مهاری بالقوه ای بر سلول های Caco-2 سرطان کولون داشت که باعث کاهش رشد سلولی گردید. تاثیر مهاری نانوکورکومین دندروزومی به صورت وابسته به زمان و غلظت بود که در مطالعه ما IC50 نانوکورکومین دندروزومی در بازه زمانی 24 ساعت معادل 26 میکرومولار و در 48 ساعت برابر با 22 و در 72 ساعت 18 میکرومولار تعیین گردید.

نتایج مطالعات متعدد بر رده های مختلف سلول های سرطانی از جمله  SW-480(کولون) ، AGS (معده) ،  4T1(سرطان پستان) و 5637(مثانه) هم راستا با مطالعه حاضر ، نشان می دهند که نانوکورکومین دندروزومی با یک الگوی وابسته به غلظت و زمان رشد سلول های سرطانی را مهار می کند (جدول 3) (4,21).

 

جدول 3- مقایسه IC50 نانوکورکومین دندروزومی در رده های مختلف سلول های سرطانی

منبع

IC50

رده سلولی

نوع سرطان

عصمت آبادی و همکاران (1392)

86/15

SW-480

کولون

پناهی و همکاران (1392)

5/13

AGS

معده

عارف زاده و همکاران (1394)

19

4T1

پستان

طهماسبی و همکاران (1392)

20

5637

مثانه

 

 

ژن های OCT-4 و  NANOGاز فاکتورهای رونویسی مهم ایجاد توانایی خودنوزایی و نامیرایی در سلول های بنیادی سرطانی می باشند (5). مطالعات گوناگونی نقش ژن های دخیل در خودنوزایی سلول های بنیادی از جمله NANOG، SOX2 و OCT-4  را در سلول های سرطان کولون نشان داده اند.

رنجی و همکاران نشان دادند که بیان ژن های hTERT و SURVIVIN که از ژن های دخیل در افزایش تکثیر و بقای سلول های سرطانی می باشند، در رده سلولی آدنوکارسینومای معده انسان (AGS) تحت تیمار با نانوکورکومین کاهش می یابد (3).

 همچنین در تائید کار ما طهماسبی و همکاران القاء مرگ برنامه ریزی شده سلولی در رده سلولی توموری 5637 مثانه توسط نانوکورکومین دندروزومی و اثر آن بر کاهش بیان ژن های NANOG، OCT-4 و NUCLEOSTEMIN را نشان دادند (1).

هم راستا با مطالعه حاضر، میرزایی و همکاران در سال 1393 اثر کورکومین بر بیان ژن‌های POU5F1، NUCLEOSTEMIN و NANOG در رده سلولی AGS معده را بررسی نمودند. نتایج آن‌ها نشان داد که کورکومین می‌تواند بیان ژن‌های فوق را کاهش دهد و به‌عنوان یک مهارکننده تقسیمات سلولی، در پیشگیری از سرطان مورد توجه قرار گیرد (20).

مطالعه حاضر نشان داد که ژن های OCT-4B1 و NANOG که ژن های مهم دخیل در خودنوزایی سلول های بنیادی سرطانی هستند، در رده سلولی Caco-2 سرطان کولون بیان می شوند و نانوکورکومین دندروزومی بطور موثری بیان آن ها را کاهش می دهد که موید این امر است که می تواند اثر مهاری بر رشد و توسعه سلول های سرطانی کولون داشته باشد. با این حال لزوم مطالعات تکمیلی گسترده تر برای استفاده آن در کلینیک ضروری می باشد.

سپاسگزاری

نویسندگان مقاله از همکاری صـمیمانه جناب آقای دکتر مجید صادقی زاده بخاطر در اختیار گذاشتن کورکومین ، نانوکورکومین و مشاوره های مفیدشان در جهت ارتقای این مطالعه کمـال تشکر و قدردانی را دارند.

1- طهماسبی میرگانی، م. صادقی‌زاده، م. نجفی، ف.مولی، ج. 1392. القای مرگ برنامه ریزی شده سلولی در رده توموری 5637 مثانه توسط نانوکورکومین دندروزومی با مهار ژن‌های دخیل در پرتوانی. مجله علوم پزشکی مدرس، 1:16، 33-39.
2- دهقان عصمت آبادی، م. فرهنگی، ب. شیرزاد، ه. صادقی زاده، م. 1392. بررسی اثر نانوکورکومین در مهار نرخ رشد و چسبندگی به ماتریکس خارج سلولی در سلول سرطانی رده SW-480. مجله طب انتظامی، (4)2:263-272.
3- رنجی، ن. پادگانه، ع. صادقی زاده، د. صادقی زاده،م. 1393. بررسی بیان ژنهای hTERT و Survivin در رده سلولی آدنوکارسینومای معده انسان (AGS)  تحت تیمار با نانوکورکومین. مجله پژوهش های سلولی مولکولی، (27)2:233-241.
4-تفریحی، م. نخعی سیستانی، ر. 1395. اثر عصاره استونی دانه انار بر بیان پروتئین های B-catenin و E-cadherinدر سلول های سرطانی PC-3 .مجله پژوهش های سلولی و مولکولی،(1)29.
5- میمندی،ک. یعقوبی، م.1394. اثرات عصاره آبی و اتانولی گل محمدی بر علیه سلول های سرطانی معده انسان. مجله پژوهش های سلولی مولکولی، (2)28.
 

6- Amini, S. Fathi, F. Ghadimi, T. Mobaleghi, J. 2014. The expressions of stem cell markers: OCT4, NANOG, SOX2, nucleostemin, BMI, ZFX, TCL1, TBX3, DPPA4, and ESRRB in bladder, colon, and prostate cancer, and certain cancer cell lines. Oncogene. 32(37): 4397–4405.

7- Avery, S. Inniss, K. Moore, H. 2006. The regulation of self-renewal in human embryonic stem cells. Stem Cells Dev. 15(5): 729-740.
8- Assadollahi, V. Gholami, M. Zendedel, A. Afsartala, Z. Lahanmardi, F. 2015. Comparison of Oct- Sox-2 and Nanog Expression in pancreatic Cancer Cell Lines and Human Pancreatic Tumor. Original Article. 12(2): 256-288.
9- Anand, P. Sundaram, C. Jhurani, S, Kunnumakkara, A.B. Aggarwal, B.B. 2008. Curcumin and cancer: an "old-age" disease with an "ageold" solution. Cancer Lett. 267(1): 133-64.
10-Anand, P. Kunnumakkara, A.B, Newman, R.A. Aggarwal, B.B. 2007. Bioavailability of curcumin: problems and promises. Mol Pharm. 4(6):807-18.
11- Amini, S. Fathi, F.Parivar, K. Kuchesfahani, M. Rezaie, M. J. Nikkhoo, B. 2009. Evaluating the Expression of Oct-4, Nanog, Sox2 and Nucleostemin in Colon Cancer Cell Lines (Caco-2, HT-29). Original Article. 12:223-230.
12-Aggarwal, B.B. Sung, B.B. 2009. Pharmacological basis for the role of curcumin in chronic diseases: an age-old spice with modern targets. Trends Pharmacol Sci. 30(2): 85-94.
13- Freberg, C. T. Dahl, J. A. Timoskainen, S. Collas, P. 2007. Epigenetic reprogramming of Oct-4 and NANOG regulatory regions by embryonal carcinoma cell extract. MolBiol Cell. 18(5): 1543-1553.
14- Gorgoulis, V. G. Vassiliou, L. V. Karakaidos, P. Zacharatos, P. Kotsinas, A. Liloglou, T. Venere, M. Ditullio, R. A. Kastrinakis, N. G., Levy, B., Kletsas, D. Yoneta, A. Herlyn, M. Kittas, C. and Halazonetis, T. D. 2005.
15- Gordaliza, M. 2007. Natural products as leads to anticancer drugs. Clin Transl Oncol. 9(1): 767-776.
16- Giovannucci, E.2003.body weight, and colorectal cancer: a summary of the epidemiologic evidence. J Wom-ens Health (Larchmt). 12:173-82.
17-Gostjeva EV. Thilly, W.G.2005.  Stem cell stages and the origins of colon cancer: a multidisciplinary perspective. Stem Cell Rev. 1(3): 243-251.
18 -Khan R, Khan AQ, Lateef A, Rehman MU, Tahir M, Ali F, et al. 2013. Glycyrrhizic Acid Suppresses the Development of Precancerous Lesions via Regulating the Hyperproliferation Inflammation, Angiogenesis and Apoptosis in the Colon of Wistar Rats. PLoS ONE. 8(2): 56020.
19- Maheshwari, R.K. Singh, A.K. Gaddipati, J. Srimal, R.C.2006. Multiple biological activities of curcumin: a short review. Life Sci. 78(18): 2081-7.
20- Mirzaei, M. R. Mahmodi, M. Hajizadeh, M. R. Bagrezaei, F. Akbar poor, V. Bahramabadi, R. 2014. The survey of curcumin effect on the expressional profile of oct4, Nanog and Nucleostemin genes in AGS (adenocarcinoma) cancer cell line. 8(2): 19-27.
21- Nabiuni, M. Kouchesfahani, H. Azari, S. Delfan,B. Gholami, S. Yarmohamadi, A. 2012. Effect of Curcumin on AQP5 gene expression in HT-29 human colorectal cancer cells. Original Article. 16(6): 493-500.
22- Ohori, H. Yamakoshi, H. Tomizawa, M. Shibuya,M. Kakudo, Y. Takahashi, A. Takahashi, S. Kato, S. Suzuki, T. Ishioka, C. Iwabuchi, Y.Shibata, H. 2006.Synthesis and biological analysis of new curcumin analogues bearing an enhanced potential for the medicinal treatment of cancer. Mol Cancer Ther. 5(10): 2563-71.
23- Singh, S. 2007.From exotic spice to modern drug? Cell. 130(5): 765-8.
24- Sharma, R. A. Gescher, A. J. Steward, W. P. 2005. Curcumin: the story so far. Cancer. 41(13): 1955-68.
25- Sarbolouki, M.N. Sadeghizadeah, M. Yaghoobi, M.M. Karami, A. Lohrasbi, T. 2000. Dendrosomes: a novel family of vehicles for transfection and therapy. J Chem Technol Biotechnol. 75(10): 919-22.
26- Sadeghizadeh, M. Ranjbar, B. Damaghi, M.  Khaki, L. Sarbolouki, M.N. Najafi, F. Parsaee, S. Ziaee, A.A. Massumi, M. Lubitz, W. Kudela, P. Paukner, S. Karami, A. 2008. Dendrosomes as novel gene porters-III. J Chem Technol Biot 83(6): 912-20.