نوع مقاله : مقاله پژوهشی

نویسندگان

1 دانشگاه شهرکرد- دانشکده علوم پایه- گروه ژنتیک

2 دانشگاه شهرکرد

3 دانشگاه شهرکرد- علوم پایه - ژنتیک

چکیده

سیستم کمپلمان از اجزاء اصلی سیستم دفاعی بدن بسیاری از موجودات میباشد. وجود این سیستم در موجودات متعددی تایید شده است اما در مورد مکانیسم های تنظیم بیان آن در سطح ژنومی برخی از موجودات اطلاعاتی وجود ندارد. در این مطالعه به بررسی ناحیه بالادستی ژن C3 از ماهی قزل آلا پرداخته ایم. بافتهای مختلف ماهی تهیه و DNA با روش تغییر یافته فنل-کلروفرم استخراج شد. به کمک پرایمرهای دجنره طراحی شده برای ناحیه بالادستی این ژن که بر اساس اطلاعات سایر گونه ها انجام شد، با واکنش زنجیره پلیمراز غیر کلاسیک، قطعه هدف تکثیر و تعیین توالی و در نهایت در بانک اطلاعات ژنومی ثبت شد. در مرحله بعد به کمک سرورها و نرم افزارهای مختلف آناتومی کامل توالی بدست آمده از نظر وجود عناصر تنظیمی بررسی گردید. توالی ناحیه پروموتوری ژن C3 ماهی قزل آلا در بانک ژنومی NCBI با شماره دستیابی JQ799884.1 به ثبت رسید. وجود توالیهای حفاظت شده جعبه TATA و همچنین عناصر پاسخگو به فاکتورهایی مانند abaA ، C/EBP،CTCF، IL-6، GR و PPAR ردگیری شد، هرچند وجود نواحی پاسخگو مانند Sp1، CRE، ERE تایید نشد. نتایج این مطالعه علاوه بر تایید وجود سیستم نسبتا تکامل یافته ای از تنظیم روی سیستم کمپلمان در ماهی های استخوانی میتواند از قدیمی بودن این سیستم حمایت نماید. این مطالعه اولین گزارش دقیق از عناصر تنظیمی کنترل کننده بیان ژنی از سیستم کمپلمان است و شاید موید نقشهای جدیدی مانند دخالت مشتقات کمپلمان در تکوین اولیه جنین باشد که در مطالعاتی مطرح شده است.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Isolation, sequencing and bioinformatics analysis of regulatory elements in C3 gene promoter region of Salmon fish(Salmo salar)

نویسندگان [English]

  • Somayeh Khatami 2
  • Hoda Ayat 3

1 Department of Genetics, Faculty of science, Shahrekord University

2 Shahrekord University

3 shahrekord university

چکیده [English]

The complement system is one of the main components of the immune system in many organisms. The existence of this system has been confirmed in numerous organisms, but there is no information about the mechanisms regulating the expression of it in some of them. In this study, we have focused on the upstream element of salmon fish C3 gene. Different tissues of the fish were prepared and DNA was extracted with a modified phenol-chloroform method. Target sequence was amplified using unclassical PCR method by using of designed degenerate primers and PCR product was purified and sequenced and finally confirmed sequence was recorded in Genomic Bank Database. In the next step, a full anatomy of obtained sequence was examined for the presence of regulatory elements by application of different servers and software. Salmon fish C3 gene promoter region sequence was recorded in NCBI genomic data bank with accession number JQ799884.1. The presence of conserved TATA box and abaA, C/EBP, CTCF, IL-6, GR and PPAR transcription factors responsive elements were confirmed, however, responsive element sequence for factors such as Sp1, CRE, ERE were not detected. Our results can confirm the existence of an evolutionary well-developed regulatory system on the complement system in bony fishes and support ancestral nature of complement system genes. This study is the first detailed report on the regulatory elements controlling gene expression of the C3 gene and may suggest the involvement of complement derivatives in the early embryonic development steps that have been reported in some study.

کلیدواژه‌ها [English]

  • Complement system
  • gene regulatory elements
  • promoter region

جداسازی ، توالی یابی و بررسی عناصر تنظیمی ناحیه پروموتوری ژن C3 در ماهی قزل آلا علی محمد احدی*، سمیه خاتمی و هدا آیت شهرکرد، دانشگاه شهرکرد، دانشکده علوم پایه، گروه ژنتیک تاریخ دریافت: 1/5/95 تاریخ پذیرش: 1/10/95 چکیده سیستم کمپلمان از اجزاء اصلی سیستم دفاعی بدن بسیاری از موجودات می باشد. وجود این سیستم در موجودات متعددی تأیید شده است اما در مورد مکانیسمهای تنظیم بیان آن در سطح ژنومی برخی از موجودات اطلاعاتی وجود ندارد. در این مطالعه به بررسی ناحیه بالادستی ژن C3 از ماهی قزل آلا پرداخته شده است. بافتهای مختلف ماهی تهیه و DNA با روش تغییر یافته فنل-کلروفرم استخراج شد. به کمک پرایمرهای دجنره طراحی شده برای ناحیه بالادستی این ژن که بر اساس اطلاعات سایر گونه ها انجام شد، با روش زنجیره پلیمراز غیر کلاسیک، قطعه هدف تکثیر و تعیین توالی و در نهایت در بانک اطلاعات ژنومی ثبت شد. در مرحله بعد به کمک سرورها و نرم افزارهای مختلف آناتومی کامل توالی به دست آمده از نظر وجود عناصر تنظیمی بررسی گردید. توالی ناحیه پروموتوری ژن C3 ماهی قزل آلا در بانک ژنومی NCBI با شماره دستیابی JQ799884.1 به ثبت رسید. وجود توالیهای حفاظت شده جعبه TATA و همچنین عناصر پاسخگو به فاکتورهایی مانند abaA ، C/EBP،CTCF، IL-6، GR و PPAR اثبات شد، هرچند وجود نواحی پاسخگو مانند Sp1، CRE، ERE تأیید نشد. نتایج این مطالعه علاوه بر تأیید وجود سیستم نسبتاً تکامل یافته ای از تنظیم روی سیستم کمپلمان در ماهیهای استخوانی می تواند از قدیمی بودن این سیستم حمایت نماید. این مطالعه اولین گزارش دقیق از عناصر تنظیمی کنترل کننده بیان ژنی از سیستم کمپلمان است و شاید مؤید نقشهای جدیدی مانند دخالت مشتقات کمپلمان در تکوین اولیه جنین باشد که در مطالعاتی مطرح شده است. واژه های کلیدی: سیستم کپلمان- عناصرتنظیم ژنی- ناحیه پروموتوری * نویسنده مسئول، تلفن: 09122094047 ، پست الکترونیکی: [email protected] مقدمه سیستم کمپلمان جزیی از سیستم دفاعی بدن بوده و از 30 پروتئین سطحی سلولی و پلاسما تشکیل شده است که به صورت دقیق و تنظیم شده با یکدیگر میان‌کنش دارند(4 و 7). سیستم کمپلمان زمانی که فعال می شود موجب تولید پلی پپتیدهایی می‌گردد که واسطه پاسخهای فیزیولوژیکی در التهاب، ایمنی و دفاع میزبان می باشند. کمپلمان دارای سه مسیر فعال‌شدن کلاسیک، متناوب و لکتین است. هر سه مسیرها سبب فعال‌شدن کانورتازهای C3می‌شوند. این کانورتاز‌ها C3 را به دوقطعه C3a و C3b تقسیم می کند. مولکول C3 به صورت پیش‌ساز بوده و در حالت طبیعی غیر فعال است. بعد از اینکه پروتئین پیش‌ساز C3 شکسته شد، یک توالی چهار اسیدآمینه‌ای از پلی‌پپتید خارج می شود و C3 به زنجیره α (kD 115) و زنجیره β (kD 75) تبدیل می شود(17). قطعه بزرگتر C3b با اتصال به سطوح سلولی به وسیله گروه تیواستر موجود درقلمرو TED منجر به تسهیل فاگوسیتوز و تشکیل کمپلکس حمله غشایی(Mac:Membrane attack complex) می‌گردد. قطعه کوچکتر C3a خاصیت آنافیلاتوکسینی دارد و واسطه فعالیتهای بیولوژیکی متنوع شامل انقباض ماهیچه-های صاف، اتساع رگهای خونی، آزادشدن هیستامین از ماست سلها و جذب شیمیایی ائوزینوفیلها می باشد. و خاصیت کانورتازی دارد iC3b هنگامی تشکیل می شود که فاکتور I قطعه می شود(12 و 14). جزء سوم کمپلمان C3 در تمام مهره داران ترشح می شود و یکی از فراوان-ترین پروتئینهای سرم پستانداران است. عده‌ای از پژوهشگران عنوان کرده‌اند که میزان پروتیئن C3 در پاسخ به سیتوکینهای مختلف تغییر می کند. به عنوان مثال در مطالعات محققین میزان بیان mRNA کد گذارC3 در پاسخ به IL-1 تا 40 برابر افزایش نشان داد (8). با توجه به نقشهای فیزیولوژیکی متعدد این سیستم، مطالعات متعددی در رابطه با تنظیم بیان این ژن صورت گرفته است. ناحیه پروموتر ناحیه تنظیمی ژنهایی است که بیان آنها تحت تأثیر هورمونها و سیتوکینهای مختلف بوده و از طریق نواحی پاسخ‌گوی بالادست ژنها کنترل می گردد. ناحیه پروموتر اجزای کمپلمان در انسان و موش و برخی دیگر از مهره داران تعیین توالی شده است، اما هیچ اطلاعاتی در مورد ماهیها ثبت نشده است. در زنوپوس(Xenopus) هر دو مسیر فعال شدن کلاسیک و متناوب کمپلمان وجود دارد. پروتئین کمپلمان C3 و C4 که از سرم زنوپوس جدا شده است دارای زیر واحدهایی شبیه به C3 و C4 پستانداران است. مشاهدات نشان می-دهند C3b انسان به وسیله سرم زنوپوس شکسته می شود. محل برش شبیه به محل برشی است که توسط سرم انسان شکسته شده است و این مشاهدات نشان دهنده آن است که پروتئینهای تنظیمی مانند فاکتور I و H در سرم زنوپوس حضور دارند. همچنین گیرنده‌هایی برای قطعات C3 در زنوپوس روی سطح ماکروفاژهای این جانور حضور دارند. البته این مشخص نیست که این رسپتورها با رسپتورهای ماکروفاژهای پستانداران مانند CR1 و CR3 همولوژی داشته باشند. نوکلئوتیدها و آمینواسیدهای C3 در زنوپوس، شبیه توالی انسان، موش و خرگوش می باشند(6).C3 ، Clq و فاکتور B از پرندگان خالص‌سازی شده است و ساختار و عملکردی مشابه با این فاکتور‌ها در پستانداران دارند. هر دو مسیر فعال سازی کلاسیک و متناوب در مرغ وجود داشته و میزان غلظت C3 در سرم مرغ 0.5 mg/ml می باشد که این مقدار نصف غلظتی است که در انسان مشاهده شده است(10). این تحقیقات نشان می دهد که سیستم کمپلمان تا رده دوزیستان شناسایی شده است اما در مورد ماهیها اطلاعات کمی در دست است که در این مطالعه به بخش کوچکی از آن پرداخته شده است. باتوجه به اهمیت این سیستم در موجودات، بررسی چگونگی تنظیم این ژن در جانوران مختلف به صورت مولکولی می تواند دریچه‌ای در رابطه با تکامل این ژن و همچنین استفاده از پروموتر این ژن در رابطه با شناخت مسیر های کنترلی و بیان سایر ژنهای مرتبط باز نماید. مواد و روشها نمونه گیری و استخراج DNA ژنومی: در این بررسی از نمونه های خون انسان، کبد موش و بافت دیواره شکم ماهی نمونه گیری صورت گرفت. استخراج DNA کامل با روش استاندارد فنل-کلروفرم انجام گرفت. کیفیت DNA استخراج شده در الکتروفورز ژل آگارز 1 درصد بررسی شد. طراحی پرایمر: با توجه به اینکه در رابطه با توالی مورد نظر اطلاعات مستقیمی در دست نبود، ابتدا توالی پروموتری ژن C3 برخی مهره‌ داران ثبت شده در پایگاه-های اطلاعات NCBI و ENSEMBL مورد بررسی قرار گرفت. توالی پروموتر ژن C3 انسان (Homo sapiens)، موش (Mus musculus) و گاو (Bos taurus) با شماره دسترسی به ترتیب X62904، X62903 و Q693V9 از سایت NCBI گرفته شد. در مورد خروس و قورباغه ناحیه پروموتری به صورت جزیی تعیین توالی شده است. توالی پروموتری این ژن در مورد خروس (Gallus gallus) و قورباغه (Xenopustropicalis) با شماره دسترسی به ترتیب G00000011509 و G00000017270 از پایگاه اطلاعات Ensembl گرفته شد. سپس بررسی همردیفی دوتایی و چندگانه بین توالیهای به دست آمده انجام شد و بر اساس همولوژیهای موجود پرایمرها طراحی شدند(جدول 1). جدول 1- توالی پرایمرهای به کار رفته در این تحقیق. ارگانیسم توالی پرایمر نام پرایمر انسان 1119 GCACCACTGCAATTTAGCCT FC3H1 موش 1500 CTGCACATACCTCAAAGCCC FC3B1 گاو 750 TGAGCATCGTGGGCCTCCAG RC3u * پرایمرهای فوروارد FC3H1 و معکوس RC3u در انسان یک آمپلیکون 1119 جفت بازی تکثیر می کردند. پرایمرهای فوروارد FC3B1 و معکوس RC3u در موش یک آمپلیکون 1500 جفت بازی و در گاو آمپلیکونی به طول 750 جفت باز تکثیر می کردند. در خروس و قورباغه به دلیل گسسته بودن توالی مرجع، طول آمپلیکون قابل محاسبه نبود. در ماهی هیچ اطلاعاتی در دسترس نبود. انجام PCR و تعیین توالی: جهت بهینه سازی شرایط PCR روی ژنوم ماهی ابتدا شرایط عملکرد پرایمرها روی نمونه های DNA انسان و موش بهینه سازی شد. پس از حصول نتیجه با شرایط به دست آمده روی DNA ماهی واکنش PCR انجام شد و در نهایت با روش Hot Start و همچنین گرادیان به سمت بالا (Touch Up) که در طی آن شرایط واکنش به مرور سخت تر می شود، محصولی در حدود 600 جفت باز به دست آمد. محصول به دست آمده جهت تعیین توالی با روش پیروسکونسینگ، ارسال شد. در واکنشهای انجام شده از شرایط استاندارد برای غلظت مواد واکنش استفاده شد(بافرX1 PCR، 5/1 میلی مولار MgCl2، 200 میکرومولار dNTP و پرایمرها با غلظت نهایی 4/0 میکرومولار و 5/1 واحد بین المللی آنزیم Taq polymerase). بررسی و تعیین آناتومی توالی به دست آمده: پس از تصحیح توالی به کمک نرم افزار Chromas 2.1، توالی به دست آمده ماهی در بانک ژنی NCBI به ثبت رسید. توالی به دست آمده با استفاده از نرم‌افزار CLC Main Workbench 5.6.1 و همچنین سرور Clustal W همردیفی چند‌گانه بین توالی پروموتری مورد نظر این تحقیق (Oncorhynchus mykiss)، انسان(Homo sapiens)، موش(Mus musculus)، گاو(Bos taurus)، قورباغه (Xenopus tropicalis) و خروس(Gallus gallus) انجام شد. از سرورهای دیگر در جهت مطالعه دقیق آناتومی توالی به دست آمده استفاده شد که در جدول 2 خلاصه شده است. نتایج استخراج DNA و انجام PCR ناحیه پروموتر ژن C3 در ماهی قزل‌آلا: شکل 1-الف نتیجه الکتروفورز DNA استخراج شده از بافت عضلات شکمی ماهی قزل‌آلا روی ژل آگارز 1 درصد را نشان می دهد. شکل 1-ب نتیجه واکنش PCR با استفاده از پرایمرهای دجنره طراحی شده براساس توالی انسان (Homo sapiens)، موش (Mus musculus) و گاو (Bos taurus) را با باند اختصاصی به طول 700 جفت باز که در ماهی به دست آمد نشان داده است. توالی‌یابی و بررسی وجود نواحی تنظیمی پاسخگو در توالی پروموتر ژن C3 در ماهی: کروماتوگرام توالی به دست آمده در اینجا آورده نشده است و در صورت درخواست قابل ارائه می باشد. توالی به دست آمده ناحیه پروموتوری ژن C3 ماهی در بانک ژنی NCBI با شماره دستیابی JQ799884.1 به ثبت رسید. جدول 2- لیست نرم افزارها و سرورهای به کار رفته در این تحقیق. آدرس نوع بررسی نوع نام پایگاه یا نرم افزار http://technelysium.com.au/wp/chromas/ بررسی توالی و کروماتوگرام نرم افزار Chromas 2.1 http://www.clcbio.com/products/clc-main-workbench-old-releases/ بررسی همولوژی نرم افزار CLC Main Workbench 5.6.1 http://www.genome.jp/tools/clustalw/ بررسی همولوژی سرور CLUSTALW http://www.fruitfly.org/index.html بررسی توالیهای هسته ای پروموتوری سرور BDGP Berkeley Drosophila Genome Project http://bioinfo.itb.cnr.it/~webgene/wwwHC_tata.html بررسی وجود جعبه‌ی TATA و موقعیت آن سرور HCtata http://www.softberry.com/freedownloadhelp/fprom/description.html بررسی محل جعبه‌ی TATA و موقعیت آن سرور FProm http://zlab.bu.edu/~mfrith/cister.shtml بررسی محل و وجود عناصر سیس سرور CisTer Cis-element Cluster Finder https://bioinformatics.ca/links_directory/category/expression/gene-regulation بررسی محل اتصال فاکتورهای نسخه برداری سرور Gene regulation شکل1- الف( بررسی کیفی DNA استخراج شده در ژل آگارز 1 درصد. چاهک M مارکر DNA (SMO373) و چاهک 1 و 2 به ترتیب DNA استخراج شده از کبد و گوشت ماهی قزل‌آلا می‌باشد. ب) نتایج PCR ناحیه پروموتر ژن C3 در ژل آگارز 1 درصد، چاهک M مارکر DNA (SMO373)، چاهک 1 محصول PCR باند بیش از 600 جفت بازی دیده می شود، چاهک شماره 2 کنترل منفی. جهت تأیید ناحیه وجود ناحیه پروموتری در توالی به دست آمده، سرورBDGP ، به کار گرفته شد که ناحیه پروموتور هسته ای با امتیاز 9/0 از 1 را مشخص نمود (شکل 2). پایگاه اطلاعات HCtataوجود جعبه TATA را در 3 موقعیت نشان داد که موقعیت 329 توالی می تواند صحیح ترین حالت ممکن و نزدیکترین توالی به توالی مهره داران باشد (شکل 3). نتایج سرور FPROM جعبه TATA را در موقعیت 329 نشان داد که با نتیجه HCtata همخوانی داشت(شکل 4). این سرور امتیاز بالاتر از3 را برای این پروموتور محاسبه کرد. در ناحیه پروموتری ژن C3در انسان نواحی پاسخگوی متعددی از جمله عناصر پاسخگو به NF-KB، IFN-γ، IL-6و عناصر پاسخگو به استروژن وجود دارد. جهت بررسی وجود نواحی تنظیمی در پروموتر ژن C3 در ماهی از پایگاه اطلاعات مختلف از جمله Cis-element Cluster Finder و ۀGene regulation استفاده شد. شکل2- ناحیه هسته پروموتوری مشخص شده در توالی ناحیه پروموتوری ژن C3 به کمک سرور BDGP با امتیاز 9/. می‌باشد. شکل3- پایگاه اطلاعات HCtataجهت پیش‌بینی وجود جعبه‌ی TATA در توالی مورد نظر می‌باشد. بر طیق نتیجه این پایگاه 3 جعبه TATA در توالی ما وجود دارد که موقعیت 329 می تواند کاندیدای اصلی باشد. شکل 4- بر اساس نتایج FPROM جعبه TATA در محل 329 وجود دارد که با نتیجه HCtata منطبق می‌باشد. پایگاه اطلاعات Cis-element Cluster Finder جهت بررسی وجود نواحی پاسخگو مانند Sp1، CRE، ERE، NF-1، E2F، Mef-2، Myf، AP-1، Ets و Myc می باشد. بر اساس نتایج این پایگاه هیچ کدام از عناصر تنظیمی که اشاره گردید در رابطه با توالی پروموتری ماهی یافت نشد. شکل 5. پایگاه اطلاعات Gene regulation جهت پیش بینی نواحی اتصالی عناصر عمل‌کننده ترانس و فاکتورهای رونویسی می باشد. براساس نتایج این پایگاه عناصر عمل‌کننده ترانس متعدد و جایگاه اتصال آن‌ها در پروموتر ژن C3 ماهی در جدول 3 آورده شده‌است. بررسی همولوژی پروموتر ژن C3 در ماهی با سایر مهره‌داران مورد مطالعه: جدول 4 همردیفی چند‌گانه بین توالی پروموتری به دست آمده (Oncorhynchus mykiss) و توالیهای مربوط به انسان(Homo sapiens)، موش(Mus musculus)، گاو(Bos taurus)،قورباغه(Xenopus tropicalis) و خروس(Gallus gallus) را که توسط سرور ClustalW انجام شده، نشان می دهد. شکل 5- خروجی گرافیکی پایگاه اطلاعات Cis-element Cluster Finder جهت شناسایی عناصر پاسخ‌گو در پروموتر ژن C3 در ماهی. هیچ کدام از عناصر تنظیمی که اشاره گردید در رابطه با توالی پروموتری ماهی یافت نشد (الف). جهت صحت کار این پایگاه توالی پروموتری انسان نیز از نظر وجود این توالیها بررسی گردید(ب). اطلاعات به‌دست آمده با استفاده از نرم‌افزار CLC workbench تأیید شد (نتایج مربوطه آورده نشده است). بر طبق نتایج سرور ClustalW بیشترین میزان همولوژی با موش 45 درصد و کمترین میزان با خروس 36 درصد است. در این جدول نیز میزان همولوژی توالی پروموتری ژن C3 در سایر گونه‌ها آورده شده‌است. بحث در این مقاله توالی ناحیه پروموتوری ژن C3 ماهی قزل آلا از اجزای سیستم کمپلمان شناسایی و معرفی شده است. این تحقیق و نتایج آن می تواند دلیلی بر وجود سیستم کمپلمان در ماهیان استخوانی باشد و از دیدگاه تکاملی نیز حائز اهمیت است. به علاوه اثبات وجود توالیهای دقیق تنظیمی نیز به جذابیت این مطالعه افزوده است. جدول3- شناسایی عناصر تنظیمی و جایگاه اتصال عناصر عمل‌کننده ترانس در پروموتر ژن C3 در ماهی . توالی حفاظت شده محل اتصال موقعیت در توالی فاکتور متصل شونده CATTCY 638 abaA CATTCY 94 abaA ATTGC 402 C/EBP TCNTACTC 260 C/EBP CCCTC 352 CTCF TGAAAAA 591 IL-6 nAGAACAnnnTGTTCTnnnnnnn 43 GR AGGTCA 119 PPAR * این جدول براساس نتایج پایگاه اطلاعات Gene regulation می باشد. شماره موقعیت بر اساس توالی ثبت شده با شماره JQ799884.1 در بانک ژنومی می باشد. در این جدول موقعیتها بر اساس مکانیسم عمل فاکتور متصل شونده غربال گری شده است. جدول 4- نتایج استخراج شده از بررسیهای میزان همولوژی توالی ناحیه پروموتری ژن C3 در ماهی،انسان،موش،گاو،خروس و قورباغه . * امتیاز همولوژی بین ناحیه پروموتوری ژن C3 ماهی و سایر گونه های مورد بررسی از 36 تا 45 به دست آمد. بررسی نواحی تنظیمی و پروموتوری ژنها در موجودات مختلف می تواند اطلاعات با ارزشی در رابطه با مکانیسمهای کنترلی و شناسه ژنتیکی آنها در اختیار بشر قرار دهد. در این تحقیق برای اولین بار به توالی یابی ناحیه پروموتوری ژن C3 در ماهی پرداخته شده است. توالی این ناحیه در پستانداران، پرندگان و دوزیستان در مواردی مشخص شده است. اطلاعات موجود به عنوان ابزار اولیه جهت بررسیهای بیوانفورماتیک مد نظر قرار گرفت و بر اساس حفاظت شدگی نواحی خاص، سه دسته پرایمر طراحی شد. بهینه سازی شرایط برای حصول محصول مناسب PCR جهت تعیین توالی یخش زیادی از این تحقیق را به خود اختصاص داد. نتایج به دست آمده به خوبی صحت عملیات انجام شده را تأیید می نماید. با استفاده از سرورهای متعدد، وجود نواحی پروموتوری در توالی به دست آمده تأیید شد. همچنین وجود سایر عناصر تنظیمی مشابه با نوع پستانداران مانند انسان نیز نقطه تأیید دیگری بر صحت نتایج است. در بررسی همولوژی نتایج همانند نتایج بررسی تشابه بین انسان و موش یا انسان و گاو می باشد که مؤید کم اهمیت بودن توالیهای فاصله گذار بین نواحی تنظیمی خاص این پروموتور می باشد . همچنین مطالعه حاضر تأییدی بر ارزش مطالعات بیوانفورماتیک در واکاوی سیستمهای ایمنی بدن موجودات می باشد که در مطالعات دیگری نیز تأکید شده است(1). C3 فراوان‌ترین پروتیئن سیستم کمپلمان در خون مهره-داران می باشد. جزء سوم کمپلمان یک نقش مرکزی در تمام مسیرهای فعال‌سازی کمپلمان بازی می کند.C3 از تعداد زیادی از گونه‌های مهره‌داران از انواع ابتدایی (لامپری و مار‌ماهی دهان‌گرد) تا انسان خالص سازی شده است. در همه گونه‌هایی که مورد مطالعه قرار‌گرفته‌اند، به جزلامپری، C3 از دو زنجیره تشکیل شده است که به وسیله یک پیوند دی‌سولفیدی و همچنین نیروهای غیر-کووالان با یکدیگر مرتبط می باشند. ساختار پروتئین C3 در انسان، خوکچه هندی، موش، رت، ماهی دهان‌گرد، لامپری، مار کبری، ماهی قزل‌آلا ،خرگوش و قورباغه مشخص شده است. اطلاعات مربوط به عناصر ساختمانی C3 و عملکرد آنها با شناسایی مکانهای حفاظت شده درگونه‌های مختلف به دست آمده است(13). سیستم کمپلمان مهره داران به نظر می‌رسد در اثر مضاعف‌سازی ژنی ایجاد شده باشد. این مضاعف سازی در طول دوران تکامل مهره داران اتفاق افتاده است(5). در مطالعه دیگری مشخص شده است که پروتئینهای C5/C4/C3 همولوگ α-2ماکروگلوبین هستند و توسط پدیده مضاعف شدن ژنها ایجاد شده‌اند. در رابطه با سه مسیر فعال‌شدن کمپلمان، مسیر متناوب نسبت به دو مسیر کلاسیک و لکتین قدیمی‌تر بوده و در مهره‌داران بی آرواره نیز وجود داشته است (3). با این وجود مطالعات بسیار کمی در رابطه با عناصر تنظیمی و توالیهای مربوطه در رابطه با بیان این پروتئینها وجود دارد که به نوبه خود ارزش مطالعه حاضر را بیشتر می کند. هرچند اطلاعات موجود در رابطه با قرابت پروتئینهای فوق طراحی آزمایشات لازم برای این مطالعه را آسان تر نمود. مکانیسم مولکولی بیان ژن C3 و تنظیم آن به وسیله عناصر پاسخ دهنده مختلفی صورت می‌گیرد که در انتهای ′5 این ژن واقع شده است. پروموتر ژن C3 انسان شامل عناصر تنظیمی مختلفی است که بیان آن را تحت تأثیر قرار می دهند. جعبه TATA و CAATدر محل28- و 87- قرار گرفته اند. در منطقه ′5 تعدادی ناحیه وجود دارند که با توالیهای تنظیمی عمل کننده سیس همولوژی دارند برای مثال در مطالعات Vik و همکارانش مشخص شده که پروموتر ژن C3 در انسان شامل عناصر پاسخگوی متعددی است که بیان این ژن راتنظیم می‌کنند(17). در موش نیز ناحیه پروموتری ژن C3 تعیین توالی شده است و نواحی پاسخگو به IL-6 و IL-1 شناسایی شده است(9). این مطالعه اولین گزارش دقیق از عناصر تنظیمی کنترل کننده بیان ژنی از سیستم کمپلمان است و شاید مؤید نقشهای جدیدی مانند دخالت مشتقات کمپلمان در فرآیند تکوین اولیه جنین باشد که در مطالعاتی مطرح شده است(12). در این مطالعه جهت بررسی وجود نواحی تنظیمی در پروموتر ژن C3 در ماهی از پایگاههای اطلاعات مختلفی شامل Cis-element Cluster Finder و gene regulation استفاده شد. پایگاه اطلاعات Cis-element Cluster Finder جهت بررسی وجود نواحی پاسخگو مانند Sp1، CRE، ERE، NF-1، E2F، Mef-2، Myf، AP-1، Ets و Myc می باشد. بر اساس نتایج این پایگاه هیچ کدام از عناصر تنظیمی که اشاره گردید در رابطه با توالی پروموتری ماهی یافت نشد. در این رابطه می توان دو پیشنهاد مطرح نمود، اول اینکه ممکن است ناحیه تعیین توالی شده این موتیفها را در بر نگرفته باشد و این توالیهای عملکردی در پایین دست یا بالادست ناحیه هدف مطالعه شده باشد. دوم اینکه ناحیه پروموتوری ژن C3 ماهی فاقد پیچیدگیهای موجود در مورد مشابه در انسان و سایر مهره داران می باشد که در مطالعات دیگری گزارش شده است. با این وجود در توالی به دست آمده در ماهی توسط گروه این تحقیق، موتیفهای اتصالی برای فاکتورهای abaA، C/EBP، CTCF، IL-6، GR و PPAR نشان دهنده وجود سیستم تنظیمی نسبتاً پیچیده روی این ژن می باشد. در این بررسی توالی محل اتصال فاکتور CTCF در ناحیه پروموتوری ژن C3 ماهی شناسایی شد (CCCTC) که قبلاً به عنوان یک فاکتور مهاری در پروموتور ژن c-Myc مرغ شناسایی شده بود(11). همچنین توالی محل اتصال فاکتور C/EBPs که خانواده ای از فاکتورهای نسخه برداری متصل شونده با عوامل افزاینده (Enhancer) می باشند نیز در موقعیتهای 402 و 260 شناسایی شد (CCAAT) که در خور توجه بوده و با ماهیت بیان ژن C3 همخوانی دارد(15). موقعیت به دست آمده در این مطالعه با مطالعات و گزارشهای قبلی تا حدی همخوانی نشان می دهد. برای مثال عناصر سیس و ترانس متعددی در پروموتر ژن C3 در murine شناسایی شده‌اند که جهت تنظیم بیان این ژن توسط سیتوکینهای (IL-6, IL-1) مورد نیاز است. میزان شباهت بین ناحیه ´5 ژن C3 انسان و murine 51 درصد است. همچنین جعبه‌های TATA متعددی در بالادست نقطه آغازین رونویسی این ژن در murine شناسایی شده است. C3 به صورت ثابت در بافتهای زیادی بیان می شود و بیان آن مختص بافت می باشد. عناصری که برای بیان ابتدایی ژن مورد نیاز هستند و همچنین عناصر تنظیمی منفی به صورت تجربی در بالادست جعبه TATA ژن C3 در murine شناسایی شده-اند که در 395- تا 111- و 1457- تا 800- قرار دارند. این عناصر نقش مهمی را در بیان ویژه بافتی ژن C3 ایفاء می‌کنند. برای مثال عناصر پاسخ دهنده به IL1 و IL6 بین محل 91- تا 40- از ژن C3 murine قرار گرفته اند(9). در این مطالعه امتیاز همولوژی بین ناحیه پروموتوری ژن C3 ماهی و سایر گونه های مورد بررسی از 36 تا 45 به دست آمد. مطالعات نشان می‌دهند که هر سه مسیر فعال-شدن کمپلمان در ماهیهای غضروفی و استخوانی وجود دارد. ماهیها سیستم ایمنی تکامل یافته‌ای دارند که نقش مهمی در پاسخ ایمنی ذاتی آنها بازی می کند. ویژگی منحصر به فرد سیستم کمپلمان در ماهی این است که در برخی از آنها، سرم می تواند گلبولهای قرمز گوسفند، بز، سگ و خرگوش را از طریق مسیر متناوب تجزیه کند در حالی که سرم انسان تنها گلبولهای خرگوش را می تواند تجزیه کند. علاوه بر این در ماهیها میزان اجزای مسیر متناوب بسیار بالا بوده و این مقدار 10 برابر بیشتر از سایر مهره‌داران است(16). وجود توالی پاسخگو به هورمونهای خاص می تواند دست مایه مطالعات مشابه و مفیدی در این زمینه باشد(2). شناخت توالی ناحیه پروموتوری ژن C3 در ماهی قزل آلا به عنوان یکی از مهره داران ابتدایی می تواند نشانگر اهمیت این خانواده ژنی در فرآیندهای فیزیولوژیک باشد. نتایج این مطالعه علاوه بر تأیید وجود سیستم نسبتاً تکامل یافته از سطح تنظیمی روی سیستم کمپلمان در ماهیهای استخوانی می تواند از قدیمی تر بودن این سیستم نسبت به سایر ژنهای دفاعی بدن حمایت نماید. قدردانی: نویسندگان از دانشگاه شهرکرد به خاطر حمایتهای مالی و معنوی در این تحقیق قدردانی مینمایند.

1- سعید خلیلی، ابولفضل جهانگیری؛ جعفر امانی ؛ علی هاتف سلمانیان.1393. کاربرد بیوانفورماتیک در مطالعات ایمنی‌شناسی. مقاله 4، دوره 27، شماره 2، صفحه 192-210
2- سمیه عرب نژاد ؛ احمد قرایی   ؛ مصطفی غفاری ؛ عبدالعلی راهداری. 1393. بررسی تغییرات کیفی اسپرم ماهی سفیدک سیستان (Schizothorax zarudnyi Nikolskii, 1897 ) در پاسخ به القاء هورمونی. مجله پژوهشهای سلولی و مولکولی ایران. مقاله 13، دوره 27، شماره 4، صفحه 611-617.
 
3- Doolittie R.F. 1987. The Evolution of the vertebrate plasma proteins. Biology Bull. 172: 269-283.
4- Fredslund F. Jenner L. Husted L.B. Nyborg J. Andersen G.R. and Sottrup-Jensen L. 2006. The structure of bovine complement component 3 reveals the basis for thioester function. Journal Mol. Biology 361: 115-127.
5- Gongora R. Figueroa F. and Klein J. 1998. Independent Duplications of Bf and C3 Complement Genes in the Zebrafish. Scand. J. Immunol 48: 651-658.
6- Grossberger D. Marcuz A. Du Pasquier L. and Lambris j. D. 1989. Conservation of structural and functional domains in complement component C3 of Xenopus and mammals. PNAS 86(4):1323–1327.
7- Janssen B.J.C. Huizinga E.G. Raaijmakers H.C.A. Roos A. Daha M.R. Nilsson-Ekdahl K. Nilsson B. and Gros P. 2005. Structures of complement component C3 provide insights in function and evolution of immunit. Nature 437: 505-511.
8- Juan T.S.C. Wilson D.R. Wilde M.D. and Darlington G.J. 1993. Participation of the transcription factor C/EBP6 in the acute-phase regulation of the human gene for complement component C3. Biochemistry. 90: 2584-2588.
9- Kawamura N.   Singer L.  Wetsel R. A.   Colten H. R.  1992. Cis- and Trans-acting elements required for constitutive and cytokine-regulated expression of the mouse complement C3 gene. Biochemical Journal.283 (3):705-712.
10- Kirschfink M. and Mollnes T. E. 2003. Modern Complement Analysis. 10(6): 982–989.
11- Lobanenkov V.V. Nicolas R.H. Adler V.V. Paterson H. Klenova E.M. Polotskaja A.V. Goodwin G.H. 1990. A novel sequence-specific DNA binding protein which interacts with three regularly spaced direct repeats of the CCCTC-motif in the 5'-flanking sequence of the chicken c-myc gene. Oncogene 5 (12): 1743–53.
12- Matthews K.W. Drouin S.M. Liu C. Martin J.F. Skidgel R.A. and Wetsel R.A. 2004. Expression of the third complement component (C3) and carboxypeptidase N small subunit (CPN1) during mouse embryonic development. Developmental and Comparative Immunology, 28: 647-655.
13- Mavroidi M. Sunye O.J. and Lambri J.D. 1995. Isolation, Primary Structure, and Evolution of the Third Component of Chicken Complement and Evidence for a New Member of the-Macroglobulin Famil. The Journal of Immunology. 154: 21 64-21 74. 
14- Nishida N. Walz T. and Springer T.A. 2006. Structural transitions of complement component C3 and its activation products. Proc Natl Acad Sci. 103: 19737-19742.
15- Ramji D.P. Foka P. 2002. "CCAAT/enhancer-binding proteins: structure, function and regulation". The Biochemical Journal 365 (3): 561–75. 
16- Sunyer J.O. Tort L. and Lambris J.D. 1997. Diversity of the third form of complement, C3, in fish: functional characterization of five forms of C3 in the diploid fish Sparus aurata. Biochemistry Journal. 326: 877-881.
17- Vik D.P. Amiguet P. Moffat G.J. Fey M. and Amiguet-Barras F. 1991. Structural features of the human C3 gene: intron/exon organization, transcriptional start site, and promoter region sequence. Biochemistry. 30: 1080-1085.