نوع مقاله : مقاله پژوهشی

نویسندگان

1 دانشگاه تبریز

2 دانشگاه شهید مدنی آذربایجان

3 دانشگاه زنجان

چکیده

ویروس‌های گیاهی از عوامل محدود کننده در کشاورزی به شمار می‌روند. تاکنون 63 عامل ویروسی آلوده کننده مو در دنیا شناسایی شده است که یکی از مخربترین آنها ویروس برگ بادبزنی مو (Grape Fan Leaf Virus: GFLV) می باشد. برای کنترل ویروسها از روش‌های سنتی مثل تناوب گیاهی، تشخیص زودهنگام و حذف گیاهان آلوده، ریشه کنی گیاهان منبع آلودگی، حفاظت تقاطعی، اصلاح برای مقاومت و کنترل شیمیایی ناقلین آنها استفاده شده است. مقاومت به واسطه RNA Silencing یک روش جدید و کارا برای ایجاد ارقام مقاوم به ویروسهاست. در این تحقیق امکان القای مقاومت نسبت به ویروس برگ بادبزنی مو (GFLV) با استفاده از ترادف نوکلئوتیدی بخشی از ژن RNA پلیمراز وابسته به RNA (RdRP) این ویروس بررسی شد. به این منظور یک سازه سنجاق سری حاوی اینترون با استفاده از ترادفی از ژن RdRP ساخته شد. جهت تراریختی توتون از آگروباکتریوم استفاده شد. پس از ایجاد 40 لاین از گیاهان توتون تراریخت، تأیید تراریختی با استفاده از آزمون PCR انجام شد. گیاهان تراریخته به منظور ارزیابی مقاومت آنها نسبت به GFLV، با این ویروس مایه‌زنی مکانیکی شدند. نتایج آزمون الایزا و نیز علایم ظاهری گیاهان نشان داد که به ترتیب 5/27 و 40 درصد از گیاهان تراریخت نسبت به ویروس مقاوم بوده و یا در بروز علایم و آلودگی تأخیر داشتند. نتایج این تحقیق ضمن ایجاد گیاهان تراریخت توتون متحمل به GFLV نشان داد که سازه بکار رفته برای ایجاد مقاومت کارایی دارد و می‌توان از آن برای ایجاد مقاومت در مو و سایر میزبانهای ویروس استفاده کرد.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Induction of Resistance to Grapevine fanleaf Virus (GFLV) by RNA Silencing Method

نویسندگان [English]

  • Samira Pakbaz 1
  • Maghsoud PAZHOUHANDEH 2

2 Azarbaijan Shahid Madani University

چکیده [English]

Plant viruses have been the limiting factor in agriculture. To date, 63 viral agents infecting grapes have been identified around the world. One of the most destructive of these agents is GFLV. To control these pathogens, traditional methods, such as crop rotation, early detection and elimination of infected plants, eradication of the infection source plants, cross protection, genetically modified plants for resistance and chemical control of vectors, have been used. The most efficient method to control viruses is the use of resistant plant varieties and the RNA Silencing-based resistance is the best way to establish the resistance to viruses in plants. In this study, the possibility of induction of resistance to GFLV using a partial GFLV RdRP gene sequence was evaluated. For this purpose, a hairpin construct containing intron and a partial RdRP gene sequence was developed. Agrobacterium tumefaciens was used for N. benthamiana transformation. 40 lines of transgenic N. benthamiana plants were created and confirmed by PCR reactions. The transgenic plants were mechanically inoculated with GFLV in order to evaluate their resistance to GFLV. The results of ELISA testing and plant symptoms showed that 27.5% of transgenic plants were resistant to GFLV and 40% of them showed the symptom and infection with delay. In this research, in addition to produce transgenic N. benthamiana plants resistant to GFLV, the results showed that the used hairpin construct is efficient to establish resistance to this virus and it could apply to produce resistance in grape and other host plants.

کلیدواژه‌ها [English]

  • GFLV
  • RNA silencing
  • Resistant
  • Transgenic Plant

القای مقاومت به روش RNA Silencing نسبت به ویروس برگ بادبزنی مو (GFLV)  

سمیرا پاکباز1، مقصود پژوهنده2*، امید عینی گندمانی3 و نعمت سخندان1 

1 تبریز، دانشگاه تبریز، دانشکده کشاورزی، گروه گیاهپزشکی

2 تبریز،دانشگاه شهید مدنی آذربایجان، دانشکده کشاورزی،گروه بیوتکنولوژی

3 زنجان، دانشگاه زنجان، دانشکده کشاورزی، گروه گیاهپزشکی

تاریخ دریافت: 27/2/95                تاریخ پذیرش: 21/6/95

چکیده

ویروسهای گیاهی از عوامل محدود کننده در کشاورزی به شمار می‌روند. تاکنون 64 عامل ویروسی آلوده­کننده مو در دنیا شناسایی شده­ است که یکی از مخرب­ترین آنها ویروس برگ بادبزنی مو(Grapevine fanleaf virus, GFLV) می­باشد. برای کنترل ویروسها از روشهای سنتی مثل تناوب گیاهی، تشخیص زودهنگام و حذف گیاهان آلوده، ریشه­کنی گیاهان منبع آلودگی، حفاظت تقاطعی، اصلاح برای مقاومت و کنترل شیمیایی ناقلین آنها استفاده شده است. استفاده از ارقام مقاوم گیاهان بهترین راه برای کنترل عوامل ویروسی بوده و مقاومت به واسطه RNA Silencing یک روش جدید و کارآمد برای ایجاد ارقام مقاوم به ویروسها می­باشد. در این تحقیق امکان القای مقاومت نسبت به ویروس برگ بادبزنی مو (GFLV) با استفاده از ترادف نوکلئوتیدی بخشی از ژن RNA پلیمراز وابسته به RNA (RdRP) این ویروس بررسی شد. به این منظور یک سازه سنجاق سری حاوی اینترون با استفاده از ترادفی از ژن RdRP ساخته شد. جهت تراریختی گیاهان Nicotiana benthamiana از Agrobacterium tumefaciens استفاده شد. پس از ایجاد 40 دودمان از گیاهان توتون تراریخت، تأیید تراریختی با استفاده از آزمون PCR انجام شد. گیاهان تراریخته به منظور ارزیابی مقاومت آنها نسبت به GFLV، با این ویروس مایه­زنی مکانیکی شدند. نتایج آزمون الایزا و نیز علائم ظاهری گیاهان نشان داد که به ترتیب 5/27 و 40 درصد از گیاهان تراریخت نسبت به ویروس مقاوم بوده و یا در بروز علائم و آلودگی تأخیر داشتند. نتایج این تحقیق ضمن ایجاد تعدادی گیاه تراریخت توتون متحمل به GFLV نشان داد که توالی نوکلئوتیدی بخشی از ژن  1EPol که جهت ساخت سازه سنجاق­سری در این تحقیق استفاده شد، فعالیتی مشابه با ژن مهار کننده خاموشی رمز شونده توسط ویروس ندارد و مقاومت القاء شده توسط این سازه در گیاه، به وسیله ژن ناشناخته مهار کننده خاموشی در این ویروس شکسته شده و سبب بروز واکنش حساسیت در گیاهان تراریخت می شود.

واژه­های کلیدی: خاموشی ژن، تراریخت، مقاومت، ویروس برگ بادبزنی مو

* نویسنده مسئول، تلفن: 04134327572 ، پست الکترونیکی:  [email protected]

مقدمه

 

بیماری برگ بادبزنی مو قدیمی­ترین بیماری ویروسی شناخته شده در گیاه  Vitis viniferaمی­باشد (9). تاکنون 64 عامل ویروسی آلوده­کننده مو در سراسر دنیا شناسایی شده­اند که یکی از مخرب­ترین آنها ویروس برگ بادبزنی مو Grapevine fanleaf virus  (GFLV) می­باشد (21). موزاییک و ابلقی شدن برگ و نواحی بین رگبرگها و در نهایت زردی کامل برگ­ از علائم بیماری است. در صورت شدت بیماری، خوشه­ها به ندرت تشکیل شده و در صورت وجود نیز حبه­های بسیار کمی داشته و یا اصلاً محصولی تولید نمی­شود (22). ویروس برگ بادبزنی مو به طور طبیعی تنها از طریق نماتد اکتوپارازیت Xiphinema index انتقال می­یابد (3). حمل و نقل مواد تکثیری به ویژه ارقام حساس مو نیز نقش مهمی در گسترش این ویروس دارد (23). ویروس GFLV یک عضو دو پیکره­ای با ژنوم دو قسمتی از جنس Nepovirus، زیرخانواده Comovirinae، خانواده Secoviridae و راسته Picornavirales می­باشد (28). ژنوم ویروس از دو قطعه RNA تک رشته­ای با قطبیت مثبت تشکیل شده است (+ssRNA) که در انتهای '5 دارای پروتئین متصل به ژنوم (VPg) و در انتهای '3 به صورت پلی­آدنینی (Poly A) می­باشند. هر قطعه محتوی یک چارچوب خواندنی باز است و یک پلی­پروتئین را رمز می­کند (P1 و P2) (26). پلی­پروتئین رمزشونده توسط RNA1 (P1) به پنج پروتئین شکسته می­شود که در تکثیر ویروس نقش دارند و به ترتیب شامل یک کوفاکتور پروتئیناز فرضی، هلیکاز فرضی، پروتئین متصل به ژنوم ویروس (VPg)، پروتئیناز سیستئین و RNA پلیمراز وابسته به RNA (RdRP) (1EPol) می­باشد (25). RNA2 پلی پروتئین P2 را رمز می­کند که با فعالیت پروتئولیتیکی به ترتیب به سه پروتئین شامل 2AHP که برای تکثیر RNA2 مورد نیاز است و می­تواند به عنوان پروتئین خانگی عمل کند (10)، پروتئین حرکتی 2BMP که پروتئین اصلی مشاهده شده در پلاسمودسماتاست (27) و پروتئین پوششی 2CCP (30) شکسته می­شود. هر دو RNA ژنومی برای آلودگی سیستمیک گیاه ضروری هستند (35 و 36).

ویروسهای گیاهی از عوامل محدود کننده در کشت محصولات کشاورزی در دنیا به شمار می‌روند. برای کنترل این بیمارگرها از روشهای سنتی مثل تناوب گیاهی و تکنیکهای دیگر کشت، تشخیص زودهنگام و حذف گیاهان آلوده، ریشه­کنی گیاهان منبع آلودگی، حفاظت تقاطعی، اصلاح برای مقاومت و کنترل شیمیایی ناقلین آنها استفاده شده است. افزایش دانش بشر در ژنتیک مولکولی ویروسهای گیاهی و سیستمهای دفاعی طبیعی گیاه میزبان، راههای تازه‌ای برای کنترل بیماریهای ویروسی در گیاه ایجاد کرده است (14). مقاومت وابسته به بیمارگر اولین بار به وسیله Johnston و Sanford در سال 1985 پیشنهاد شد (37) و از قسمتی از مواد ژنتیکی بیمارگر برای دفاع میزبان بر علیه همان بیمارگر استفاده شد. گفته شده که بیان ژنهای مشخصی از بیمارگر در میزبان باعث به هم ریختن تعادل عادی ویروس و بنابراین به هم ریختن چرخه همانند سازی بیمارگر می­شود (29). از آن­جایی‌که ویروسها ژنوم کوچک و تعداد محدودی ژن دارند که در مدت همانندسازی ویروس روشن می‌شود، این پاتوژنها برای مقاومت منشأ گرفته از بیمارگر مناسب می‌باشند (4). مقاومت به واسطه پروتئین پوششی ویروس، بیان یک منطقه کد کننده در رپلیکاز، استفاده از آنتی­سنس RNA و استفاده از RNA های ماهواره­ای مواردی از استفاده‌های موفق بر اساس روش PDR می‌باشد (6). یک مکانیسم مهم در PDR خاموشی RNA نامیده می‌شود. مشخص شده است که بسیاری از واکنشهای مقاومت نیاز به سنتز پروتئین ندارند و به واسطه RNA وساطت می‌شوند (5). شناسایی این روش زمانی اتفاق افتاد که ژن رپلیکاز ویروس موزاییک توتون (TMV) جهت ایجاد مقاومت به گیاه توتون منتقل شد و مقاومت بالایی در توتون تراریخت مشاهده شد، در حالی که بیان شدن پروتئین رپلیکاز مشاهده نشد (12). مقاومت به واسطه RNA یک حالت از خاموشی ژن در سطح پس از نسخه­برداری می‌باشد (33). از تکنیک خاموشی ژن پس از نسخه برداری (PTGS) برای ایجاد مقاومت گیاهان نسبت به بیمارگرهای گیاهی استفاده شده است (18). سازه­های مختلف به منظور افزایش کارآیی این سازوکار و ایجاد مقاومت مؤثر معرفی شده اند که سازه­های سنجاق سری دارای اینترون از عملکرد مناسبی برخوردار بوده­اند (31). در تحقیق حاضر امکان ایجاد مقاومت به ویروس برگ بادبزنی مو (GFLV) به کمک ترادف نوکلئوتیدی بخشی از ژن پلیمراز و نیز ارزیابی سطوح مقاومت توتون نسبت به این ویروس که توسط سازه تکرار معکوس حاوی اینترون القاء شده بود مورد بررسی قرار گرفت.

مواد و روشها 

ساخت سازه سنجاق­سری GFLV: طراحی آغازگر (Primer): ابتدا توالی نوکلئوتیدی کاملRNA1  مربوط به 9 جدایه از GFLV که در NCBI موجود است، با استفاده از نرم افزار Bioedit زیر هم چینی شد و یک ناحیه حفاظت شده از ژن RdRP (1EPol) به اندازه 116 جفت باز جهت ساخت سازه سنجاق­سری انتخاب شد. طراحی آغازگر­های رفت و برگشت برای ناحیه حفاظت شده در دو جهت سنس و آنتی سنس و بر اساس جایگاه آنزیمهای برشی (جدول 1) در نقشه ژنتیکی ناقل pEPT8MCS2 (34) (شکل1) انجام پذیرفت. همچنین از توالی نوکلئوتیدی اینترون دوم گیاه سیب زمینی که در ناقل  pBin19-Gus-Intron  همسانه­سازی شده بود (32) به عنوان جدا­کننده در ساختار تکرار معکوس استفاده شد. این ناقل نوترکیب توسط آزمایشگاه ویروس شناسی گیاهی دانشگاه کرنل امریکا در اختیار این تحقیق قرار گرفت. طراحی همه آغازگرها به کمک نرم افزار Primer Premier 5 صورت گرفت.

آزمون RT-PCR: استخراج RNA با استفاده از کیت استخراج RNA کل شرکت Omega (Biotek) و از برگ2های گیاه Chenopodium quinoa آلوده به GFLV انجام شد. تکثیر رشته­های سنس و آنتی­سنس با استفاده از آغازگرهای اختصاصی طراحی شده و نیز کیت یک مرحله­ای RT-PCR شرکت کیاژن انجام شد. این آزمون مطابق با دستورالعمل شرکت و طی برنامه­ای شامل 30 دقیقه جهت نسخه­برداری معکوس در 50 درجه سانتی­گراد، 15 دقیقه جهت فعال سازی اولیه PCR در 95 درجه سانتی­گراد، 30 چرخه دمایی شامل 30 ثانیه واسرشت سازی اولیه در 94 درجه، یک دقیقه جهت اتصال آغازگرها در 58 درجه و یک دقیقه جهت گسترش توالی در 72 درجه و در نهایت 10 دقیقه جهت گسترش نهایی در 72 درجه سانتی­گراد صورت گرفت. جهت مشاهده محصولات تکثیر شده، از ژل آگارز 5/1 درصد و نشانگر مولکولی 100 جفت باز استفاده شد.

آزمون PCR: جهت تکثیر قطعه اینترون ابتدا استخراج پلاسمید از ناقلpBin19-Gus-Intron  توسط کیت استخراج پلاسمید Omega صورت گرفت. سپس آزمونPCR با استفاده از آغازگرهای طراحی شده و کیتQ5 Hot start High-Fidelity DNA polymerase (شرکت New England Biolabs) روی DNA استخراج شده انجام شد. برنامه دمایی آزمون PCR مطابق با دستورالعمل شرکت و به صورت 30 ثانیه واسرشت سازی اولیه در 98 درجه،30 چرخه دمایی شامل 10 ثانیه واسرشت سازی اولیه در 98 درجه، 20 ثانیه جهت اتصال آغازگرها در 58 درجه و 30 ثانیه جهت گسترش توالی در 72 درجه و در نهایت 2 دقیقه جهت گسترش نهایی در 72 درجه سانتی­گراد اعمال شد. 

همسانه­سازی قطعات: جهت ساخت سازه تکرار معکوس، از ناقل pEPT8MCS2 که دارای جایگاه چندگانه همسانه سازی می­باشد استفاده شد. این ناقل با دارا بودن جایگاه چندین آنریم برشی، امکان همسانه­سازی چند ژن را در کنار هم فراهم می­کند و در نتیجه برای ساخت سازه تکرار معکوس مناسب می­باشد. این ناقل همچنین دارای ناحیه پیش برنده و خاتمه دهنده 35SCaMV می­باشد. جهت ساخت سازه، ابتدا محصول تکثیر یافته اینترون و نیز پلاسمید  pEPT8MCS2 با استفاده از آنزیمهای  KpnSalI هضم شدند. اینترون برش یافته پس از خالص سازی با استفاده از کیت خالص سازی Enzyme Clean Up (Omega) توسط آنزیم T4DNA Ligase (BioLabs) به ناقل هضم شده متصل شد. سپس این همسانه به باکتری
 E. coli سویه DH5α انتقال داده شد.

 

جدول 1- ترادف آغازگر­ها و جایگاه برشی در نظر گرفته شده در آنها

اندازه قطعه

جایگاه برشی

ترادف آغازگر و محل اثر آنزیم­ برشی

جهت

* نام آغازگر

211bp 

 

KpnI

5' GCTGTGGTACCGTTTGTTTCTGCTTCTACCTTTG 3'

-

Int.For

SalI

5' AATGCGTCGACCTAAACATCACCATGTTTTGGTC 3'

-

Int.Rev

138bp 

NcoI

5' TACCACCATGGGTTTTCTGTGGTGCCCTTGGCATAC 3'

Sense

1E.For

 

KpnI

5' GATGTGGTACCAAGGATTGATGCCTACTTGAC 3'

Sense

1E.Rev

 

138bp 

BamHI

5' AGTGAGGATCCGTTTTCTGTGGTGCCCTTGGCATAC 3'

Antisense

1E.For

 

SalI

5' AATGCGTCGACAAGGATTGATGCCTACTTGAC 3'

Antisense

1E.Rev

 

*: نام آغازگرها به طور مخفف در جدول آمده است که Int بیانگر اینترون، For بیانگر آغازگر رفت و Rev بیانگر آغازگر برگشت می­باشد.

 

 

شکل 1- نقشه ژنتیکی ناقل pEPT8MCS2

باکتریهای حامل این همسانه در محیط جامد  LBحاوی100 میلی­گرم در لیتر آمپی سیلین انتخاب شدند. به منظور یافتن کلونی حاوی پلاسمید نوترکیب از روش  Colony PCRاستفاده شد. پس از استخراج پلاسمید وجود قطعه مورد نظر با استفاده از هضم آنزیمی با آنزیمهای نامبرده تأیید شد. پلاسمید کلونیهایی که برای دریافت اینترون مثبت ارزیابی شدند، جهت دریافت قطعه در جهت سنس انتخاب شدند. این پلاسمید و نیز قطعه سنس تکثیر یافته ژن پلیمراز با آنزیمهای برشی NcoI و KpnI هضم شدند. پس از خالص­سازی محصول برش، همسانه­سازی و انتقال به میزبان E. coli مشابه قطعه اینترون انجام شد و برای تأیید حضور قطعه سنس از روش Colony PCR و نیز واکنش هضم آنزیمی با آنزیمهای NcoI و KpnI استفاده شد.پلاسمید کلونیهایی که علاوه بر اینترون، قطعه سنس را نیز دریافت کرده بودند این بار برای دریافت قطعه در جهت آنتی­سنس استفاده شدند. این پلاسمید­ها و نیز قطعه آنتی سنس تکثیر شده ژن پلیمراز با استفاده از آنزیمهای برشی SalI و BamHI برش یافتند و پس از همسانه­سازی و انتقال به میزبان E. coli، جهت تأیید حضور قطعه آنتی­سنس، واکنش برش با استفاده از این دو آنزیم انجام شد. پلاسمیدهای نوترکیب حاوی سازه سنجاق سری جهت اطمینان با آنزیم HindIII برش داده شدند. با انجام این واکنش انتظار می رود سازه تکرار معکوس به همراه ناحیه پیش برنده و خاتمه دهنده 35SCaMV با طول 1323 جفت باز از پلاسمید جدا شود. در تمام مراحل همسانه­سازی، جهت بررسی و مشاهده محصولات برش از ژل آگارز 5/1 درصد و نشانگر مولکولی 100 جفت بازی و نیز یک کیلوبازی استفاده شد.

انتقال کاست ژنی­ به ناقل pGA482G: جهت انتقال سازه مورد نظر به گیاه از ناقل دوگانه pGA482G استفاده شد که دارای ژن گزینش­گر نئومایسین فسفوترانسفراز II (nptII) می­باشد. این ناقل همچنین دارای مناطق مرزی چپ و راست می­باشد که در انتقال T-DNA از Agrobacterium tumefaciens  به سلول گیاهی نقش دارد (20). تکثیر کاست ژنی 35SPro.1ESense.Int.1EAntisense.35STer با استفاده از آغازگر­های ناحیه 35SCaMV (جدول2) که دارای جایگاه آنزیمهای برشی منطبق با نقشه ژنتیکی ناقل دوگانه pGA482G بودند انجام شد. سپس واکنش برش با آنزیمهای HindIII و HpaI روی محصول تکثیر یافته و نیز ناقل pGA482G انجام شد. کاست ژنی 1EPol برش یافته، روی ژل آگارزی که درصد خلوص بیشتری داشته و برای خالص­سازی اسید نوکلئیک از ژل مناسب می­باشد الکتروفورز و با استفاده از کیت خالص­سازی Omega از ژل جداسازی شد. سپس با استفاده از آنزیم T4DNA Ligase واکنش اتصال و همسانه­سازی در ناقل pGA482G انجام شد و انتقال به میزبان E.coli صورت گرفت. حضور کاست مورد نظر با استفاده از واکنش برش آنزیمی با آنزیمهای  HindIIIو HpaI روی پلاسمید استخراج شده تأیید شد. پلاسمید نوترکیب pGA482G حاوی کاست ساخته شده با استفاده از روش شوک الکتریکی در سلولهای مستعد A. tumefaciens سویه C58Z707 همسانه­سازی شد. سویه نامبرده توسط آزمایشگاه ویروس­شناسی گیاهی دانشگاه کرنل امریکا در اختیار این پژوهش قرار گرفت.

 

جدول2 - ترادف آغازگرها و جایگاه برشی در نظر گرفته شده در آنها

آنزیم برشی

ترادف آغازگر و محل اثر آنزیم برشی

*نام آغازگر

HindIII 

5' CGT GCG AGC TCT GAG ACT TTT CAA CAA AGG G 3'

35S-Pro

HpaI 

5' GCA CCG TTAACG ATT TTG GTT TTA GGA ATT AG 3'

35S-Ter

*: نام آغازگرها به طور مخفف در جدول آمده است که 35S-Pro بیانگر آغازگر مربوط به ناحیه پیش­بر 35SCaMV و 35S-Ter بیانگر آغازگر مربوط به ناحیه خاتمه دهنده 35SCaMV می باشد.


تراریزش توتون Nicotiana benthamiana: جهت تراریختی از تیپ وحشی گیاه N. benthamiana استفاده شد. بذر­ها در شرایط استریل بر روی محیط کشت جامد حاوی نصف غلظت نمکهایMS  تکمیل شده (24) کشت شدند و ریزنمونه­های برگی سترون از گیاهان رشد یافته از این بذور تهیه شدند.ریز نمونه­ها به مدت 15 دقیقه در محیط تهیه شده از MS حاوی سوسپانسیون A. tumefaciens سویه C58Z707 (8/0-6/ : OD600) حامل سازه مورد نظر فرو برده شدند و سپس روی کاغذ صافی آب اضافی آنها گرفته شد. ریز نمونه­ها به محیط کشت  MSجامد حاوی هورمونهای BAP با غلظت دو میلی­گرم در لیتر وNAA  با غلظت 1/0 میلی­گرم در لیتر به طوری که سطح فوقانی نمونه­ها روی محیط کشت قرار بگیرد، منتقل و نمونه­ها در شرایط تاریکی و در دمای 25 درجه سانتی­گراد قرار داده شدند. 48 ساعت پس از طی دوره هم­کشتی، ریزنمونه­ها به محیط کشت گزینش­گر حاوی 50 میلی­گرم در لیتر آنتی­بیوتیک کانامایسین و 250 میلی­گرم در لیتر سفوتاکسیم منتقل شدند و به مدت 6-4 هفته در اتاقک رشد با دمای 25 درجه سانتی گراد و شرایط نوری 8:16 (نور: تاریکی) جهت باززایی و القای جوانه نگهداری شدند. در طول این مدت نمونه­های باززا شده هفته­ای یک بار در محیط تازه تجدید کشت شدند. جهت انتخاب گیاهچه­های تراریخت احتمالی، از محیط MS حاوی کانامایسین با غلظتهای 75 و 100 میلی­گرم در لیتر استفاده شد. این روند فرصتی را به نوساقه­های تراریخت می­دهد تا به آرامی با غلظتهای بالاتر کانامایسین سازگار شوند و نوساقه­های غیر تراریخت در غلظت نهایی کانامایسین سفید خواهند شد. نوساقه­های رشد یافته به محیط کشت ریشه­زایی منتقل شدند. محیط ریشه­زایی با افزودن دو میلی­گرم در لیتر هورمون IBA به همراه آنتی­بیوتیکهای کانامایسین و سفوتاکسیم به محیط کشت پایه MS حاوی یک درصد ساکاروز و 7/0 درصد آگار بدست آمد. گیاهچه­های ریشه­دار در ظروف مخصوص محتوی خاک استریل حاوی ورمیکولایت، پیت و پرلایت (به نسبت 2:2:1) کشت و با محلول غذایی MS مایع نصف غلظت محلول­پاشی شدند. گیاهچه­ها جهت سازگاری با دما و رطوبت محیط به مدت دو هفته در شرایط اتاقک رشد و پس از آن در گلخانه نگهداری شدند.

بررسی مولکولی گیاهان تراریخته احتمالی: جهت تأیید حضور سازه و تراریختی گیاهان، استخراج DNA از برگهای جوان گیاهان تراریخته احتمالی نسل T0 با استفاده از کیت استخراج DNA گیاهی  Omegaصورت گرفت. سپس واکنش زنجیره­ای پلیمراز با استفاده از کیت (Biolabs)  Hot start High-Fidelity DNA polymeraseو آغازگرهای ژن گزینش­گر nptII ناقل pGA482G انجام شد. محصولات تکثیر شده بر روی ژل آگارز 5/1 درصد الکتروفورز شدند. گیاهانی­ که حضور سازه در آنها تأیید شد، برای مایه­زنی با ویروس انتخاب شدند.

مایه­زنی گیاهان تراریخته و ارزیابی میزان مقاومت: برگهای C. quinoa آلوده به GFLV با استفاده از بافر فسفات 1/0 مولار (4/7pH: ) عصاره­گیری شدند. سپس مایه زنی مکانیکی (مالش روی برگ) با استفاده از عصاره گیاهی حاوی ویروس و به کمک کمی پودر کاربوراندوم روی برگهای 40 گیاه مستقل که تراریختی آنها تأیید شده بود و در مرحله 5-4 برگی بودند صورت گرفت. همچنین 5 گیاه از تیپ وحشی و غیرتراریخت گیاه
N. benthamiana نیز به عنوان کنترل منفی در نظر گرفته شد و مایه­زنی با GFLV روی آنها انجام شد. هفت روز پس از مایه­زنی، علائم تظاهر یافته احتمالی در گیاهان تراریخت بررسی و تا روز دهم پس از مایه­زنی ادامه داشت. همچنین جهت اندازه­گیری غلظت ویروس، آزمون سرولوژیکی الایز (DAS– ELISA) با استفاده از آنتی­بادی پلی­کلونال و اختصاصی پروتئین پوششی GFLV (کیت شرکت Bioreba) و نیز بافرهای این کیت انجام شد. این آزمون در روز نهم پس از مایه­زنی مکانیکی روی برگهای نوظهور و مایه­زنی نشده گیاهان تراریخت انجام گرفت. در مرحله آخر آزمون پس از افزودن ماده زمینه، میزان تغییر رنگ چاهکها در طول موج 405 نانومتر با استفاده از دستگاه الایزا خوان Synergy2 (شرکت Biotek) و نرم افزار  Gen5 اندازه­گیری شد.

نتایج و بحث 

این تحقیق به منظور ایجاد گیاهان تراریخت توتون مقاوم به GFLV و تست کارآیی سازه سنجاق­سری برای ایجاد مقاومتبراساس RNA Silencing انجام شد. 

ساخت سازه سنجاق­سری: آزمون  RT-PCRبا استفاده از آغازگرهای اختصاصی طراحی شده توانست دو قطعه به اندازه 138 جفت باز برای رشته سنس و آنتی سنس ژن 1EPol تکثیر کند. همچنین آزمون PCR با استفاده از آغازگرهای اختصاصی طراحی شده از توالی نوکلئوتیدی اینترون دوم گیاه سیب زمینی، توانست قطعه­ای به اندازه 211 جفت باز برای اینترون تکثیر کند. پس از همسانه­سازی این قطعات، واکنش هضم آنزیمی توسط ترکیب آنزیمی موجود بر روی سازه، حضور سازه سنجاق­سری را در ناقل pEPT8MCS2 (شکل 2- الف) تأیید کرد. واکنش برش آنزیمی با استفاده از آنزیم HindIII نیز توانست قطعه­ای به اندازه 1323 جفت باز را از پلاسمید نوترکیب pEPT8MCS2 جدا کند. این قطعه حامل سازه سنجاق­سری 1EPol همراه با پیش­بر 35SCaMV می­باشد (شکل 2- ب). پس از همسانه­سازی این قطعه در ناقل دوگانه pGA482G، حضور قطعه 1323 جفت بازی با استفاده از واکنش هضم آنزیمی به کمک آنزیمهای HindIII و HpaI در این ناقل تأیید شد (شکل 3).

 

 

شکل 2- محصول واکنش برش آنزیمی پلاسمید نوترکیب pEPT8MSC2 حامل سازه تکرار معکوس 1EPol. الف- چاهک 1- نشانگر مولکولی 100 جفت بازی. چاهک 2- قطعه سنس 1EPol. ناقل هضم شده با آنزیمهای NcoI و KpnI. چاهک 3- قطعه اینترون. ناقل هضم شده با آنزیمهای KpnI و SalI. چاهک 4- قطعه آنتی سنس 1EPol. ناقل هضم شده با آنزیمهای SalI و BamHI. چاهک 5- ناقل فاقد قطعه و هضم شده با آنزیمهای NcoI و BamHI به عنوان کنترل. چاهک 6- نشانگر مولکولی یک کیلو بازی. ب –چاهک 1- نشانگر مولکولی یک کیلو بازی. چاهک 2-4-  ناقل حامل سازه تکرار معکوس 1EPol هضم شده با آنزیم HindIII. چاهک 5- ناقل فاقد قطعه و هضم شده با آنزیم HindIII به عنوان کنترل که ناحیه 35SCaMV به طول 916 جفت باز از پلاسمید جدا شده است. چاهک 6- نشانگر مولکولی 100 جفت بازی.

 

 

شکل 3- محصول واکنش برش آنزیمی ناقل pGA482G با استفاده از آنزیمهای HindIII و HpaI. چاهک 1- نشانگر مولکولی یک کیلوبازی. چاهک 2- ناقل فاقد قطعه. چاهک 3- ناقل نوترکیب حامل سازه تکرار معکوس 1EPol.

قطعات برگ توتون N. benthamiana برای تراریزش استفاده شد و پس از کالوس­زایی، جوانه زنی و ریشه دهی تعداد 40 دودمان (لاین) تراریخت مستقل ایجاد و تکثیر یافت.

تعیینتراریختیبوته­ها: واکنش زنجیره­ای پلیمراز با استفاده از آغازگرهای ژن گزینش­گر nptII رویDNA  گیاهان تراریخت احتمالی، توانست قطعه­ای به طول 1105 جفت باز را تکثیر کند (شکل 4). این در حالی بود که این قطعه در گیاهان غیر تراریخت تکثیر نشد. در نتیجه تکثیر این ناحیه حاکی از تراریختی گیاهان با سازه سنجاق سری حامل بخشی از ژن پلیمراز بود.

 

 

شکل 4- نمونه­ای از تأیید تراریختی گیاهان N. benthamiana با استفاده از آغازگرهای ژن nptII. چاهک 1- نشانگر مولکولی یک کیلو بازی. چاهک 13-2- قطعه 1105 جفت بازی تکثیر یافته از ژن nptII در گیاهان تراریخت شده با سازه تکرار معکوس 1EPol. چاهک 14- گیاه غیر تراریخت. چاهک 15- کنترل منفی آزمون PCR.

 

پس از تأیید تراریختی گیاهان، 40 دودمان گیاه تراریخت جهت بررسی میزان مقاومت ایجاد شده نسبت به GFLV با این ویروس مایه­زنی شدند. علاوه بر بررسی علائم ظهور یافته از روز هفتم تا دهم پس از مایه­زنی، آزمون الایزا نیز جهت تعیین حضور یا عدم حضور GFLV در گیاهان تراریخت در روز نهم پس از مایه­زنی انجام و توسط دستگاه الایزا خوان میزان غلظت ویروس در طول موج 405 نانومتر اندازه­گیری شد. در روزهای هفتم تا دهم پس از مایه­زنی، علائم بیماری در تعدادی از گیاهان تراریخت شده با سازه 1EPol به طور واضحی قابل مشاهده بود. این آلودگی با آزمون الایزا نیز تأیید شد و این گیاهان در مجموع حساس به GFLV ارزیابی شدند (شکل 5- ه). واکنش این گیاهان به مایه­زنی، کاملاً مشابه گیاهان توتون غیرتراریخت و مایه­زنی شده با GFLV بود که به عنوان کنترل مثبت در این تحقیق استفاده شدند (شکل 5- الف). در تعدادی از گیاهان تراریخت علائم بیماری با شدت کمتری نسبت به گیاه غیرتراریخت و حساس ایجاد شد. علاوه بر این، علائم در این گیاهان با تأخیر و حدود 3 تا 4 هفته بعد ظاهر شد (شکل 5- د). تعدادی از گیاهان تراریخت حتی پس از یک ماه نیز علایمی از آلودگی به GFLV نشان ندادند. آزمون الایزا نیز عدم حضور ویروس را در این گیاهان تأیید کرد و این گیاهان در مجموع مقاوم (شکل 5- ج) و مشابه با گیاهان غیرتراریخت و مایه­زنی نشده با ویروس که به عنوان کنترل منفی در این تحقیق استفاده شدند (شکل 5- ب)، ارزیابی شدند. بر اساس نتایج علائم شناسی و نیز آزمون الایزا 5/27 درصد از گیاهان تراریخت، مقاوم به ویروس بوده و 5/32 درصد از آنها مشابه گیاهان غیرتراریخت حساسیت نشان دادند. همچنین 40 درصد از گیاهان تراریخت در حالی در آزمون الایزا مثبت ارزیابی شدند که هنوز علائم آلودگی را نشان نداده بودند و علائم ویروسی روی این گیاهان با تأخیر ظاهر شد (جدول 3).

در پژوهش حاضر تراریختی گیاهان توتون مورد مطالعه با استفاده از A. tumefaciens حامل سازه سنجاق­سری با موفقیت انجام شد. همچنان که در مطالعه­ای،
A. tumefaciens حامل پلاسمید pZM1047 به گیاه داتوره منتقل و جهت تعیین تراریختی گیاهان از آزمونPCR  و آغازگرهای ژن  nptIIاستفاده شد. نرخ تراریختی حاصل از قطعات برگی در این آزمایش 13 درصد گزارش شد که در مقایسه با نرخ 78 درصدی حاصل از آزمایش مشابه روی گیاهان توتون نشان داد که گیاه توتون از لحاظ ژنتیکی نسبت به دریافت T-DNA بسیار خوب و مستعدتر از گیاه داتوره عمل می کند. البته شرایط محیطی مانند دما، حضور مواد فنلی و بعضی از آنزیمها در محیط کشت می­تواند بر روی انجام موفق تراریختی اثر گذار باشد (2).

 

 

جدول 3- واکنش گیاهان تراریخت با سازه 1EPol و غیرتراریخت نسبت به GFLV بر اساس علایم، آزمون الایزا و PCR.

آزمون PCR با 

آغازگر nptII 

آزمون الایزا

ظهور علائم (روز پس از مایه­زنی)

واکنش گیاه

تعداد کل/گیاه آلوده 

-

+

-

+

+

بدون علایم

30-25

10-7

مقاومت

تأخیر

حساسیت*

40/ 11 (5/27%)

40/ 16 (40%)

40/ 13 (5/32)

گیاهان تراریخت

-

+

10-7

حساسیت

5/5

گیاهان غیرتراریخت

*: یک هفته پس از مایه­زنی، ظهور علائم موزاییک و زردی در گیاهان حساس ظاهر شد.

 

شکل 5- واکنش گیاهان N. benthamiana تراریخت با سازه تکرار معکوس 1EPol و غیرتراریخت به GFLV. الف- گیاه غیرتراریخت و مایه­زنی شده به عنوان کنترل مثبت. ب- گیاه غیرتراریخت بدون مایه­زنی به عنوان کنترل منفی. ج- نمونه ای از گیاه مقاوم تراریخت با سازه 1EPol. د- گیاه تراریخت با سازه 1EPol ه- گیاه تراریخت با سازه 1EPol.

 

تعیین­کننده­هایی که تاکنون در مورد اعضاء خانواده Secoviridae شناسایی شده و سبب بروز علائم می­شدند، پروتئینهای درگیر در تکثیر و پلی­پروتئین بالغ مثل هلیکاز نوع III و پروتئیناز سیستئین شبه 3C بودند (7 و 13). در آزمایشات Vigne و همکاران، وجود دومینهای اختصاصی نژاد، روی ژن RNA پلیمراز وابسته به RNA (RdRP) ویروس GFLV تأیید و مشخص شد که این دومینها وظیفه تنظیم عوامل تعیین­کننده علائم را دارند. برای شناسایی این تعیین­کننده­ها، کلونهای عفونی cDNA مربوط به RNA1 و RNA2 نژاد GHu و F13 ویروس GFLV تهیه و با استفاده از رویکرد ژنتیک معکوس مشخص شد که در نژاد GHu، تعیین­کننده­های علائم روی RNA1 خصوصاً در 408 نوکلئوتید انتهای '3 RdRP (1EPol) قرار دارند، اما به نظر نمی­رسد این ناحیه به عنوان مهارکننده خاموشی عمل کند. این محققین در آزمایش دیگری نشان دادند که ژن 1EPol در مهار خاموشی EGFP در N. benthamiana تراریخته بیان کننده EGFP موفق عمل نکرد. این آزمایش بار دیگر با استفاده از رقم وحشیN. benthamiana  انجام شد، اما پروتئین 1EPol در هیچ کدام از دو نژاد F13 و GHu برخلاف CMV- 2b قادر به افزایش بیان GFP نبود. این در حالی بود که پروتئین 1EPol در قسمتهای اگرواینفیلتر شده به آسانی توسط آزمون وسترن بلاتینگ ردیابی شد. نتایج این آزمایشات، هیچ­گونه فعالیت مهارکنندگی خاموشی قابل ردیابی در ارتباط با پروتئین 1EPol در دو نژاد GHu و F13 ویروس GFLV نشان نداد (34). نتایج به دست آمده از پژوهش حاضر با نتایج این محققین مطابقت دارد. همچنان که توالی نوکلئوتیدی بخشی از ژن 1EPol که در ساخت سازه سنجاق­سری در این پژوهش به کار برده شد، کارآیی لازم جهت القای مقاومت نسبت به GFLV را نداشت و نتیجه به دست آمده بیانگر این است که ژن یا ژنهای دیگری در این ویروس مسئولیت بیماریزایی و مهار خاموشی ژن (VSRs) را بر عهده دارند و این ژن یا ژنها علی­رغم حضور یک سازه تکرار معکوس که بیان کننده یک RNA دو رشته ای ((dsRNA بوده و القاءکننده مکانیسم خاموشی ژن در گیاه است، می­توانند بر مقاومت ایجاد شده ناشی از این سازه غلبه کنند و سبب بروز واکنش حساسیت در گیاهان تراریخت شده با این سازه شوند. در سال 1998 مشخص شد که ویروسها پروتئینهایی رمز می­کنند که مهارکننده خاموشی ژن (VSRs) می باشند. این یافته علاوه بر حمایت از این ایده که خاموشی RNA به عنوان یک مکانیسم دفاعی طبیعی بر علیه ویروس است، همچنین ابزار قابل دسترسی برای توصیف مسیرهای خاموشی ژن می باشد (36). دانش موجود از تعیین کننده­های علائم و مهارکننده­های خاموشی ویروسهای جنس Nepovirus خیلی محدود است (34 و 35) و تاکنون تلاش­های زیادی در این زمینه صورت گرفته است. در مطالعه­ای در سال 2009 سازه­ای بر اساس توالی­های GFLV برای ایجاد موهای تراریخت که خاموشی اختصاصی GFLV را القاء می­کرد، طراحی شد. سازه تکرار معکوس با استفاده از قطعاتی از ناحیه حفاظت شده ژن پروتئین حرکتی یک جدایه GFLV از تونس همراه با کاستهای محتوی نئومایسین فسفوترانسفراز ΙΙ یا ژن bar به عنوان گزینش­گر طراحی شد. این سازه از طریق tumefaciensA. به N. benthamiana منتقل شد. مدتی بعد از مایه­زنی گیاهان تراریخته با GFLV ایجاد مقاومت، بهبودی، به تعویق افتادن آلودگی و حساسیت در این گیاهان مشاهده شد. تجزیه و تحلیل آزمون لکه گذاری نورترن (Northern blotting) که در آن یک توالی با منشأ ویروسی (پروتئین حرکتی) به عنوان کاوش­گر استفاده شد، توانست RNA های کوچک مداخله کننده (siRNA) اختصاصی ژن انتقال یافته به گیاه N. benthamiana تراریخته بعد از مایه­زنی را ردیابی کند. همچنین سازه تکرار معکوس از طریق A. tumefaciens به سلولهای جنینی مو (V. vinifera) منتقل شد. 67/66 درصد گیاهان تراریخته مو به ویروس مقاوم شدند. آزمون الایزا مقاومت را در گیاهان تراریخته تأیید کرد و همچنین تجزیه و تحلیل آزمون لکه گذاری نورترن، سطوح متفاوتی از نسخه­های تکرار معکوس را در دودمانهای مستقل مو تراریخته، که خاموشی ژن پس از نسخه­رداری را نشان می­دادند، ردیابی کرد. تفاوت در برابر مایه­زنی با GFLV در گیاهان وحشی و N. benthamiana تراریخته حاوی ساختار تکرار معکوس، تصور وقوع خاموشی اختصاصی GFLV در گیاهان تراریخته را افزایش می­دهد و نشان دهنده عملکرد ساختار تکرار معکوس است که یک استراتژی مؤثر برای ایجاد گیاهان مقاوم به GFLV می­باشد (16). در تحقیق حاضر نیز مشابه آزمایشات Jardak و همکاران تفاوت در واکنش تیپ وحشی گیاهان N. benthamiana و نیز گیاهان تراریخت مقاوم به مایه­زنی با GFLV، بیان­گر وقوع خاموشی ژن در گیاهان تراریخت بوده و کارآیی سازه­ ساخته شده را نشان می­دهد. اگرچه پیشنهاد شده است که خاموشی ژن در درختان چوبی نسبتاً نادر است (7) اما در مطالعه­ای دیگر توسط Gambino و همکاران در سال 2009، خاموشی ژن در درختچه­های تراریخت با ژن پروتئین پوششی GFLV مشاهده شد و با اینکه احتمال خاموشی ژن در سطح نسخه برداری (TGS) نمی­توانست به طور کامل رد شود، خاموشی ژن پس از نسخه­برداری (PTGS) در پنج دودمان از هشت دودمان تراریخته القاء شد و میزان بیان ژن پروتئین پوششی GFLV در هشت دودمان تراریخته مو توسط آزمون لکه­گذاری نورترن ارزیابی گردید (11). همچنین در نتایج Gambino و همکاران حساسیت و تأخیر در آلودگی در
N. benthamiana تراریخت بیان کننده ژن پروتئین پوششی GFLV پس از مایه­زنی با این ویروس مشاهده شد که این نتایج با نتایج به دست آمده در پژوهش حاضر مطابقت دارد (11). کاربرد ترادفهای تکرار معکوس (IR) منشاء گرفته از دو قطعه ژنومی ویروس به عنوان روشی به منظور دستیابی به مقاومت بر علیه MV در سطوح بالا بوده است. نتایج نشان می­دهد که سازه­های سنجاق­سری می­توانند مقاومت در سطح بالایی را ایجاد نمایند (36). در مطالعه ای روی گیاهان تراریخت  N. tabacum cv Samsunکه ژن  RDR1  (RNA-Directed-RNA Polymerase-1) در آنها توسط ساختارهای ساقه - حلقه دارای مشابهت ژنتیکی با ژن RDR1 خاموش شده بود، میزان پایداری خاموشی ژن بررسی شد. بدین منظور میزان حساسیت به آلودگی سیستمیک ویروس (Potato virus Y strain o) PVY° و نیز میزان بیان ژنهای RDR1 و  RDR6یک هفته پس از مایه­زنی نسلهای دوم  (T2)و سوم(T3)  توتونهای تراریخت بررسی شد. نتایج نشان داد که نسل دوم این گیاهان نسبت به نسل بعدی از میزان بیان کمتر ژن  RDR1برخوردار می باشد. همچنین لاینهای نسل دوم در مقایسه با نسل سوم از حساسیت بیشتر به ویروس PVY° برخوردار بود. در مجموع نتایج نشان داد کارآیی ساختار ساقه - حلقه در خاموشی ژنRDR1  در نسل بعد کاهش یافته است. از آنجایی که ژن RDR6 تحت تأثیر ژن RDR1  بوده و برای انتقال پیام خاموشی در طول گیاه و افزایش مقاومت گیاهان به آلودگی ویروسی لازم می­باشد، پیشنهاد شد که سرکوب ژن  RDR1 در توتونهای تراریخت موجب جلوگیری از بیان ژن RDR1  و در نهایت موجب کاهش انتقال عمودی ساختارهای ساقه - حلقه خاموش کننده به نسل بعد شده است (1).

همچنین ایجاد مقاومت به ویروس پژمردگی لکه­ای گوجه­فرنگی (TSWV)  و PVY نشان داد که نسبتی بین بیان ژن منتقل شده و مقاومت ایجاد شده وجود ندارد (17). مشخص شده است که علاوه بر سازه‌های قابل ترجمه، سازه­های غیر قابل ترجمه نیز قادر به ایجاد مقاومت هستند (19). همچنان که در تحقیق حاضر بیان یک ترادف نوکلئوتیدی غیر قابل ترجمه قادر به ایجاد گیاه تراریخت مقاوم به ویروس بود. به دست آمدن نتایج متفاوت در رابطه با گیاهان تراریخت جهت ایجاد مقاومت نشان دهنده پیچیده بودن واکنش بین گیاه و ویروس می­باشد (8 و 15). علاوه براین به دست آمدن گیاهان تراریختی که علائم را با تأخیر نشان می­دادند می­تواند مربوط به میزان تولید siRNA در این گیاهان باشد و احتمالاً این گیاهان دارای سطوح پایین­تر siRNA نسبت به گیاهان مقاوم تراریخت می­باشند. بنابراین بررسی سطوح siRNA در گیاهان تراریخت ضروری می­باشد. در مجموع با توجه به کارآیی بالای سازه های تکرار معکوس حاوی اینترون در ایجاد مقاومت و نتایج به دست آمده در این تحقیق و ایجاد تنها تعدادی گیاه تراریخت مقاوم به GFLV، بررسی بیشتر ترادف نوکلئوتیدی ژنوم ویروس برگ بادبزنی مو (GFLV) جهت یافتن ناحیه مسئول مهارکنندگی خاموشی ژن (VSR) در این ویروس ضروری به نظر می­رسد. Vigne و همکاران در سال 2013 گزارش کردند که اگرچه مهارکننده­های خاموشی (VSRs) در بیشتر جنسهای ویروسهای گیاهی به خوبی توصیف شده­اند، اما شناسایی آنها در اعضاء Nepovirus به تعویق افتاده است (34). بنابراین انجام آزمایشات بیشتر جهت یافتن ژن مهارکننده خاموشی این ویروس و ساخت سازه القاءکننده­ای مبتنی بر آن، می­تواند در رسیدن به مقاومت کاملی علیه این ویروس بسیار کمک کننده باشد، زیرا در غیر این صورت استفاده از هر ناحیه از ترادف نوکلئوتیدی این ویروس، کارآیی لازم برای القای مقاومت به این ویروس در گیاه را نخواهد داشت.

سپاسگزاری 

از آقای دکتر مارک فیوکس به خاطر در اختیار گذاشتن مواد و امکانات مورد نیاز جهت انجام این پژوهش در آزمایشگاه ویروس شناسی گیاهی دانشکده کشاورزی دانشگاه کرنل امریکا (ایستگاه تحقیقاتی کشاورزی در ایالت نیویورک) صمیمانه تشکر و قدردانی می شود.

1- رخشنده­رو، ف.، پالوکایتیس، پ.، شمس بخش، م. (1392)، ناپایداری ساختارهای ساقه - حلقه در جلوگیری از بیان ژن­های مسئول مقاومت در برابر آلودگی­های ویروسی در توتون­های تراریخت. مجله زیست شناسی ایران. جلد 26، شماره 3. صفحه 401-415.
2- همایی بروجنی، ط.، احسانپور، ع. ا.، اصغری، غ. (1394). انتقالT-DNA  و ایجاد گیاه تراریخت داتوره (. Datura metel L). مجله زیست شناسی ایران. جلد 28. شماره 2. صفحه 310-317.
 
3- Andert-Link, P., Laporte, C., Valat, L., Ritzenthaler, C., Demangeat, G., Ving, E., Laval, V., Pfeiffer, P., Stussi-Garaud, C. and Fuchs, M. (2004). Grapevine fanleaf virus: still a major threat to the grapevine industry. Journal of Plant Pathology, 86: 183- 195.
4- Baulcombe, D. C. (1996). Mechanisms of pathogen- derived resistance to virusrs in transgenic plants. Plant ell. 8:1833-1844.
5- Dasgupta, V. G., Malathi, S. and Mukherjee, K. (2003). Genetic engineering for virus resistance. Current Science, 84:3-10.
6- Dawson, W. O. and Hilf, M. E. (1992). Host-range determinants of plant viruses. Annu Rev plant physiol plant Mol Biol.43: 527-555.
7- Fan, Q., Niroula, M., Feldstein, P.A. and Bruening, G. (2011). Participation of the Cowpea mosaic virus protease in eliciting extreme resistance. Virology 417: 71-78.
8- Fladung, M., Kumar, S., and Ahuja, R. (1997). Genetic transformation of Populus genotypes with different chimaeric gene constructs: transformation efficiency and molecular analysis. Transgenic Research 6: 111–121.
9- Fuchs, M., Pinck, M., Serghini, M. A., Ravelonandro, M., Walter, B., and Pinck, L. (1989). The nucleotide sequence of satellite RNA in Grapevine fanleaf virus, strain F13. Journal of General Virology. 70: 955–962.
10- Gaire, F., Schmitt, C., Stussi-Garaud, C., Pinck, L. and Ritzenthaler, C. (1999). Protein 2A of Grapevine fanleafnepovirus is implicated in RNA2 replication and colocalizes to the replication site. Virology 264: 25–36.
11- Gambino, G., Perrone, I.,  Carra, A., Chitarra, W., Boccacci, P., Marinoni, D., Barberis, M., Maghuly, F., Laimer, M., and Gribaudo, I. (2009). Transgene silencing in grapevines transformed with GFLV resistance genes: analysis of variable expression of transgene, siRNAs production and cytosine methylation. Transgenic Research 19 (1): 17-27.
12- Golemboski, D .B., Lomonossoff, G. P., and Zaitlin, M. (1990). Plants transformed with a tobacco mosaic virus non structural gene sequence are resistance to the virus. proc Nat/AcadSci USA.87: 6311-6315
13- Gu, H., and Ghabrial, S.A. (2005). The Bean pod mottle virus proteinase cofactor and putative helicase are symptom severity determinants. Virology 333: 271-283.
14- Hull, R. (2002). Matthews' Plant Virology, 4th edn. San Diego: Academic Press.
15- Jacqumond, M., Teycheney, P. Y., Carrere, I., Navas- Castillo, J., and Tepfer, M. (2001). Resistance phenotypes of transgenic tobacco plants expressing different Cucumber mosaic virus (CMV) coat protein genes. Mol. Breed. 8: 85-94.
16- Jardak-Jamoussi, R., Winterhagen, P., Bouamama, B., Dubois, C., Mliki, A., Wetzel, T., Ghorbel, A., and Reustle, G. (2009). Development and evaluation of a GFLV inverted repeat construct for genetic transformation of grapevine. Plant Cell, Tissue and Organ Culture 97: 187–196.
17- Kawchuke, L. M., Martin, R.R., and Macpherson, P. (1991). Sense and antisense RNA mediated resistance to potato leafroll virus in Russet Burbank potato plants. Mol. plant-Microbe interact.4:247-253
18- Lennefors, B. L., Savenkov, E. I., Bensefelt, J., Wremerth, E., Roggen, P., Tuvesson, S., Valkonen, J. P. T., and Gielen, J. (2006). dsRNA- mediated resistance to Beet necrotic yellow vein virus infections in sugar beet (Beta vulgaris L. ssp. vulgaris). Mol breeding 18: 313-325.
19- Lindbo, J, A. and Dougherty, W. G. (1992). Untranslatable transcripts of tobacco etch virus coat protein gene sequence can interfere with tobacco etch virus replivcation in transgenic plants and protoplast. Virology. 189: 725 – 733.
20- Ling, K. S., Zhu, H. Y., Alvizo, H., Hu, J. S., Drong, R. F., Slightom, J. L., and Gonsalves, D. (1997). The coat protein gene of Grapevine leafroll associated 162 Closterovirus-3: cloning, nucleotide sequencing and expression in transgenic plants. Archives of Virology. 142: 1101–1116.
21- Martelli, G. P. (2014). Directory of virus and virus-like diseases of the grapevine and their agents. Journal of Plant Pathology. 96: (1S). 1-4.
22- Martelli, G. P., and Savino, V. (1988). Fanleaf degeneration. pp: 48- 49. In Compendium of Grape Diseases (Pearson R.C., and Goheen A.C. Eds). The American Phytopathological SocietyPress, St Paul, Minnesota. 93 p.
23- Martelli, G. P., and Savino, V. (1990). Fanleaf degeneration. In: Pearson R.C. and Goheen A. (eds.). Compendium of grape diseases, pp. 48-49. APS Press, St. Paul, MN, USA.
24- Murashige, S. and Skoog, M. (1962). Arevised medium for rapid growth and bioassays with tobacco tissue cultures. Plant Physiol., 15: 473-497.
25- Naraghi-Arani, P., Duabert, S., and Rowhani, A. (2001). Quasispecies nature of the genome of Grapevine fanleaf virus. Journal of General Virology 82: 1791- 1795.
26- Pinck, L., Fuchs, M., Pinck, M., Ravelonandro, M. and Walter, B. (1988). A satellite RNA in grapevine fanleaf virus strain F13. Journal of General Virology 69: 233–239.
27- Ritzenthaler, C., Pink, M., and Pink, L., (1995). Grapevine fanleafnepovirus P38 putative movement protein is not transiently expressed and is a stable final maturation product in vivo. Journal of General Virology 76: 907-15..
28- Sanfaçon, H., Wellink, J., Le Gall, O., Karasev, A., Vlugt, van der, R., and Wetzel, T. (2009). Secoviridae: a proposed  family of plant viruses within the order Picornavirales that combines the families Sequiviridae and Comoviridae, the unassigned genera Cheravirus and Sadwavirus, and the proposed genus Torradovirus. Archives of Virology 154: 899-907.
29- Scholthof, K. B. G, Scholthof, H. B, Jackson, A. O. (1993). Control of plant virus diseases by Pathogen-derived resistance in transgenic plants. Plant Physiol. 102, 7-12.
30- Serghini, M. A., Fuchs, M., Pinck, M., Reinbolt, J., Walter, B., and Pinck, L. (1990). RNA2 of Grapevine fanleaf virus: sequence analysis and coat protein cistron location. Journal of General Virology 71: 1433–1441.
31- Smith, N. A., Singh, S. P., Wang, M. B., Stoutjesdijk, P. A., Green, A. G., Waterhouse, P. M. (2000). Total silencing by intron-spliced hairpin RNAs. Nature. 407: 319-320.
32- Vancanneyt, G., Schmidt, R., O'Connor-Sanchez, A., Willmitzer, L., and Rocha-Sosa, M. (1990). Construction of an intron-containing marker gene:  Splicing of the intron in transgenic plants and its use in monitoring early events in Agrobacterium-mediated plant transformation. Mol Gen Genet 220: 245-250
33- Vazquez, R. C, Del Vas, M, Hopp, H. E. (2002). RNA–mediated virus resistance. Curr Opin Biotechnol, 13: 167-172.
34- Vigne, E., Gottula, J., Schmitt-Keichinger, C., Komar, V., Ackerer, L., Belval, L., Rakotomalala, L., Lemaire, O., Ritzenthaler, C., and Fuchs, M. (2013). A strain specific segment of the RNA-dependent RNA polymerase of Grapevine fanleaf virus determines symptoms in Nicotiana species. Journal of General Virology. 94: 2803–2813.
35- Viry, M., Serghini, M.A., Hans, F., Ritzenthaler, C., Pinck, M., and Pinck, L. (1993). Biologically active transcripts from cloned cDNA of genomic grapevine nepovirus RNAs. Journal of General Virology 74: 169-174.
36- Wesley, S. V., Helliwell, C. A., Smith, N. A., Wang, M. B., Rouse, D. T., Liu, Q., Gooding, P. S., Singh, S. P., Abbott, D., Stoutjesdijk, P. A. (2001). Construct design for efficient, effective and high throughput gene silencing in plants. Plant J 27: 581-590.
37- Sanford JC. and Johnston S. (1985). The concept of parasite-derived resistance-Deriving resistance genes from the parasite's own genome. Journal of Theoretical Biology, 113(2): 395-405.