نوع مقاله : مقاله پژوهشی

نویسندگان

1 دانش آموخته دکتری گروه علوم دامی دانشکده کشاورزی دانشگاه تبریز

2 زنجان، دانشگاه زنجان، گروه علوم دامی

3 زنجان، دانشگاه زنجان، پژوهشکده فناوریهای نوین زیستی

4 عضو هیات علمی دانشگاه تبریز

چکیده

نواحی اگزون 5 و بخشی از ناحیه 3′ UTR بود. برای این منظور تعداد 133 رأس بره از یک گله و در سن تقریبا یکسان در سه گروه افشاری خالص، آمیخته افشاری- برولامرینو نسل F2 و F5 مورد استفاده قرار گرفتند. قبل از کشتار از این دامها نمونه خون تهیه شد. پس از انجام اندازه-گیری‌های فنوتیپی بر روی دام زنده، تعداد 85 رأس از این دام‌ها کشتار شدند. پس از کشتار، وزن لاشه اندازه‌گیری شد و بعد از 24 ساعت ماندن لاشه در سردخانه، وزن ران، سردست، قلوه‌گاه، دنبه و ضایعات اندازه‌گیری شد. برآورد صفات لاشه در دام‌های کشتار نشده، با استفاده از ضرایب رگرسیونی انجام شد. از نمونه‌های خون به روش فنل-کلروفرم DNA استخراج گردید. سپس با استفاده از پرایمرهای طراحی شده، قطعه موردنظر تکثیر ومستقما توالی‌یابی گردید. پس از آنالیز توالی‌ها، ارتباط ژنوتیپ‌ها با صفات لاشه مورد بررسی قرار گرفت. نتایج نشان داد جایگاه نوکلئوتیدی 2846 دارای دو ژنوتیپ TT و TC بود که بر اندازه طول بدن دام در دام‌های افشاری خالص و F5 تأثیر داشت. در جایگاه نوکلئوتیدی 2882 یک نوکلئوتید در برخی از دام‌ها به توالی اضافه شده بود که این ژنوتیپ فقط در دام‌های F2 با ضایعات(چربی) لاشه ارتباط داشت. این نتایج نشان می‌دهد که از تغییرات نوکلئوتیدی مشاهده شده در صورت تائید در دیگر بررسی های مربوطه می‌تواند در برنامه انتخاب دام به کمک مارکرها مورد استفاده قرار گیرد.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Single Nucleotide Polymorphism in part of GH Gene and its Association with Carcass Traits in Afshari and Afshari-Booroola Merino sheep

نویسندگان [English]

  • Rahimeh Sepehri 1 2
  • Taher Harakinejad 3 2
  • Sadegh Alijani 4
  • Jalil Shoja 4
  • Seyed Abas Raafat 4

1 Tabriz University

2 Tabriz University

3 Zanjan University

4 Tabriz University

چکیده [English]

Growth hormone is one of the main factors affecting the growth of animals. There are different alleles of the gene leading different phenotypic effects. The aim of this study was to identify alleles of this gene in exon 5 and part of the 3 ‘UTR area. For this purpose, 133 lambs from a flock at almost the same age in three groups of pure Afshari breed and F2 and F5 crosses of Afshari- Booroola Merino were used. After taking Blood samples and recording the phenotypic measurements on live animals, 85 lambs were slaughtered. After slaughtering, carcass weight was measured and after 24 hours storing the carcasses in the cold room weight of thigh, shoulder, neck, fat tail and waste was measured. Regression coefficient Analyses were used to estimate carcass traits of those animals that not slaughtered. DNA was extracted by phenol-chloroform procedures from blood samples. Then, using primers designed, the desired fragment was amplified and directly sequenced. Afterward analyzing sequences, association of genotypes with carcass traits were evaluated. The results showed that in the nucleotide site of 2846 there were two genotypes, TT and TC, affecting the length of the body in pure Afshari breed and F5 crosses. In position 2882 of the gene sequence, a nucleotide was inserted in some animals and this insertion only in F2 crosses was associated with waste (carcass fat). The results show that the observed variations in case be proved in other evaluations can be used in marker assisted selection in sheep breeding programs.

کلیدواژه‌ها [English]

  • Afshri sheep
  • carcass quality growth hormone
  • multiple births
  • SNP

پلی‌مورفیسم تک نوکلئوتیدی بخشی از ژن GH و ارتباط آن با صفات لاشه در گوسفندان افشاری و افشاری- برولا مرینو رحیمه سپهری1، طاهر هرکی‌نژاد3،2*، صادق علیجانی1، جلیل شجاع غیاث1 و سید عباس رأفت1 1 تبریز، دانشگاه تبریز، دانشکده کشاورزی، گروه علوم دامی 2 زنجان، دانشگاه زنجان، پژوهشکده فناوریهای نوین زیستی 3 زنجان، دانشگاه زنجان، دانشکده کشاورزی، گروه علوم دامی تاریخ دریافت: 26/11/94 تاریخ پذیرش: 9/6/95 چکیده هورمون رشد یکی از عوامل اصلی تأثیرگذار بر رشد حیوانات است. وجود آللهای مختلف این ژن ممکن است تأثیرات فنوتیپی متفاوتی داشته باشند. هدف مطالعه حاضر، شناسایی آللهای این ژن در نواحی اگزون 5 و بخشی از ناحیه 3′ UTR بود. برای این منظور تعداد 133 رأس بره از یک گله و در سن تقریباً یکسان در سه گروه افشاری خالص، آمیخته افشاری- برولامرینو نسل F2 و F5 مورد بررسی قرار گرفتند. ابتدا از این دامها نمونه خون تهیه و پس از انجام اندازه‌گیریهای فنوتیپی بر روی دام زنده، تعداد 85 رأس از آنها کشتار شدند. پس از کشتار، وزن لاشه اندازه‌گیری شد و بعد از 24 ساعت ماندن لاشه در سردخانه، وزن ران، سردست، قلوه‌گاه، دنبه و ضایعات اندازه‌گیری شد. برآورد صفات لاشه در دام‌های کشتار نشده، با استفاده از ضرایب رگرسیونی انجام شد. از نمونه‌های خون به روش فنل-کلروفرم DNA استخراج گردید. سپس با استفاده از پرایمرهای طراحی شده، قطعه موردنظر تکثیر و مستقیما توالی‌یابی گردید. پس از آنالیز توالیها، ارتباط ژنوتیپها با صفات لاشه مورد بررسی قرار گرفت. نتایج نشان داد جایگاه نوکلئوتیدی 2846 دارای دو ژنوتیپ TT و TC می‌باشد که بر اندازه طول بدن دام در دامهای افشاری خالص و F5 تأثیر دارد. در جایگاه نوکلئوتیدی 2882 یک نوکلئوتید در برخی از دامها به توالی اضافه شده بود که این ژنوتیپ فقط در دامهای F2 با ضایعات (چربی) لاشه ارتباط داشت. این نتایج نشان می‌دهد که تغییرات نوکلئوتیدی مشاهده شده در صورت تأئید در دیگر بررسیهای مربوطه، می‌تواند در برنامه انتخاب دام به کمک مارکرها مورد استفاده قرار گیرد. واژه های کلیدی: گوسفند افشاری، هورمون رشد، چند قلوزایی، کیفیت لاشه، SNP. * نویسنده مسئول، تلفن: 02433052230 ، پست الکترونیکی: [email protected] مقدمه هورمون رشد (GH) که به نام سوماتوتروپین نیز شناخته شده‌است یک پلی پپتید تک زنجیره است که توسط سلولهای سوماتوتروپ واقع در غده هیپوفیز پیشین ساخته، ذخیره و ترشح می‌شود (8). GH نقش اصلی را در کنترل فرآیندهای فیزیولوژیکی متعدد شامل رشد و متابولیسم بر عهده دارد. این هورمون توزیع مواد مغذی میان بافتهای مختلف را در دامها تحت تأثیر قرار می‌دهد و سبب افزایش رشد استخوان و تولید شیر و کاهش ذخیره چربی می‌شود (4). با توجه به محدوده وسیع اثرات هورمون رشد، ژن کنترل کننده آن، GH، به عنوان یک کاندیدای اختصاصی برای تغییرپذیری صفات مرتبط با تولید و کیفیت لاشه پیشنهاد شده است (12) . گوسفند افشاری جزء گوسفندان سنگین وزن ایران بوده که از لحاظ تولید گوشت حائز اهمیت می‌باشد. میزان دو قلو زایی در این نژاد قابل توجه بوده و وزن تولد ، سرعت رشد و وزن از شیر گیری در این گوسفند در مقایسه با سایر نژاد های ایران قابل توجه است. لذا می‌توان این نژاد را یکی از نژادهای گوشتی گوسفند ایران به‌حساب آورد که از پتانسیل مناسبی برای تولید گوشت برخوردار است و نقش مهمی را در تأمین گوشت قرمز می‌تواند ایفاء کند. برای بهبود برخی از صفات لاشه این گوسفند هنوز کارهای زیادی لازم است که انجام شود (2). برای افزایش بهره‌وری در سال 1386در دانشگاه زنجان اقدام به انتقال ژن چندقلوزایی از گوسفند نژاد برولامرینو به نژاد افشاری گردید. به دنبال اجرای این طرح و ایجاد آمیخته-های افشاری- برولامرینو، ترکیب ژنتیکی جدیدی ایجاد شد. ژن GH گوسفند (NM_001009315) (Transcript ID:ENSOART00000015172) روی کروموزوم 11 واقع شده و دارای 5 اگزون می‌باشد. پروتئین حاصله یعنی هورمون رشد در گوسفند از 217 اسیدامینه و در انسان از 191 اسید امینه تشکیل شده است. مطالعات متعددی به منظور شناسایی چندشکلیهای تک نوکلئوتیدی در نژادهای مختلف گاو (6، 7، 11، 12، 15، 19 و 22) و گوسفند (9،11،13،15،16،19 و 21) انجام شده‌است. به‌عنوان نمونه، بررسی پلی‌مورفیسم تک نوکلئوتیدی روی گاوهای سیاه ژاپنی منجر به شناسایی دو SNP در اگزون شماره 5 این ژن شد که سبب تغییر اسیدآمینه لوسین (CTG) به والین (GTG) و ترئونین (ACG) به متیونین (ATG) به ترتیب در کدونهای 127 و 172 شدند. سه هاپلوتایپ حاصل از این دو SNP به نامهای هاپلوتایپ A(Leu-Thr)، هاپلوتایپ B (Val-Thr) و هاپلوتایپ C (Val-Met) سبب به وجود آمدن 6 ژنوتیپ شامل AA,AB,BB,AC,BC و CC شد (11). تاتسودا و همکاران (2008) ارتباط این هاپلوتایپها را با صفات لاشه در یک جمعیت 940 رأسی بررسی نموده و نتیجه گرفتند که ژن GH گاوی می تواند بعنوان یک نشانگر در بهبود صفات کمی (لاشه) مورد استفاده قرار گیرد (22). در مطالعات بعدی نشان داده شد که این چند شکلیها با صفات کیفیت گوشت و وزن لاشه (7) و نیز غلظتهای هورمونی پلاسما (5) در گاو سیاه ژاپنی مرتبط هستند. همچنین این دو SNP میزان بیان ژنهای FASN (Fatty acid synthesis)، SCD (Stearoyl-CoA Desaturase) و SREBP (Sterol regulatory element binding protein) را نیز تحت تاثیر قرار دادند (6). تحقیق حاضر به منظور بررسی چندشکلی نوکلئوتیدی ژن‌ GH در بره‌های این ترکیب ژنتیکی جدید (آمیخته‌های افشاری برولامرینو) و بره‌های خالص افشاری و تأثیر آن بر صفات لاشه انجام شد. مواد و روشها جمعیت مورد بررسی: در این تحقیق از 133رأس بره تقریبا همسن (11 ماهه) شامل 96 رأس بره آمیخته افشاری (نسل اول تلاقی برگشتی نژاد افشاری با آمیخته های افشاری _ برولا مرینو )، 11 رأس بره‌های نسل چهارم تلاقی برگشتی نژاد افشاری با آمیخته های افشاری _ برولا مرینو و 26 رأس بره خالص افشاری متعلق به گله اصلاح نژادی گوسفند افشاری گروه علوم دامی دانشکده کشاورزی دانشگاه زنجان استفاده شد. این سه گروه ژنتیکی در ادامه این نوشتار به ترتیب تحت عناوین نسل F2، نسل F5 و افشاری نام‌ برده می‌شوند. صفات فنوتیپی مورد مطالعه: صفات مورد نظر عبارت بودند از: الف) صفات بیومتری (مرتبط با رشد) شامل: ارتفاع جدوگاه، طول بدن و دور سینه، ب) داده‌های سونوگرافی ضخامت چربی پشت و عمق عضله راسته بین دنده 12 و 13 و ج) صفات لاشه شامل: وزن لاشه، ران، سردست، قلوه‌گاه، دنبه و ضایعات. نحوه اندازه‌گیری صفات: در بخش صفات بیومتری، اندازه‌های مربوط به صفات طول بدن (حدفاصل بین آخرین مهره گردن و آخرین مهره پشت) و دورسینه (محیط دور سینه در ناحیه قدامی سینه پشت دستها) به-وسیله متر پارچه‌ای؛ و ارتفاع جدوگاه (فاصله بین سطح موازی با ستون فقرات تا کف زمین در محل شانه و چسبیده به دست سمت راست) با استفاده از کولیس فلزی بزرگ اندازه‌گیری شد (1). صفات ضخامت چربی پشت (UBF=Ultrasonography Back Fat) و عمق عضله راسته (ULMD=Ultrasonography Loin Muscle Depth) بین دنده 12 و 13 توسط دستگاه اولتراسوند Sonovet 600 (Medison, USA) که دارای پروب 5 مگاهرتز بود، به-دست آمد. برای تهیه تصویری صاف و شفاف باید ناحیه مورد بررسی فاقد مو و پشم باشد. به این منظور پشم چینی بره‌ها انجام شد و سپس پشمهای باقی‌مانده در ناحیه بین دنده 12 و 13 توسط تیغ تراشیده شد. برای حرکت بهتر پروب بر روی ناحیه مورد نظر و عاری کردن محیط بین پروب و پوست از هوا، از ژل مخصوص سونوگرافی استفاده شد. سپس تمامی بره‌ها سونوگرافی شده و تصاویر مربوطه ضبط گردید. با استفاده از نرم‌افزار Scion Image عکسهای مناسبی از تصاویر برای اندازه-گیری نواحی موردنظر تهیه شد (20). (شکل 1). شکل1- اندازه گیری ضخامت چربی پشت و عمق عضله راسته به کمک دستگاه اولترا سونوگرافی. در مورد بره های نسل F2، بره‌ها پس از تحمل 24 ساعت گرسنگی توزین و سپس کشتار شدند. لاشه‌ها پس از کشتار توزین و به یک شرکت بسته‌بندی گوشت منتقل و به مدت 24 ساعت در سردخانه نگهداری شدند. سپس لاشه‌ها از سردخانه خارج و با دقت از طول به دو نیمه چپ و راست تقسیم گردیدند و نیم لاشه راست جهت تعیین اندازه‌های لاشه استفاده گردید. نیم لاشه مذکور به قطعات گردن، ران، سردست، قلوه گاه، راسته، دنبه تقسیم و ضایعات )چربی روی لاشه و اعماء و احشاء( آن اندازه‌گیری شد. در مورد بره‌های خالص افشاری و نسل F5 که امکان کشتار بره‌ها وجود نداشت، برای برآورد مقادیر مربوط به این صفات از روابط رگرسیونی بین صفات بیومتری و صفات لاشه استفاده شد. استخراجDNA از نمونه های خون: جهت تهیه نمونه‌های خون از ونوجکت خلاء‌دار 5 سی‌سی حاوی ماده ضد انعقاد EDTA استفاده شد. خون‌گیری از سیاه‌رگ وداج صورت گرفت و نمونه‌ها در ظرف محتوی یخ به آزمایشگاه منتقل شدند. نمونه‌های خون تا زمان استخراج DNA، در دمای منهای 20 درجه فریزر نگهداری شدند. استخراج DNA از تمام نمونه‌های خون به روش فنول-کلروفرم (3 و 18) تعدیل شده انجام شد. برای تعیین کمیت و کیفیت DNA استخراج شده از دستگاه نانودراپ (Thermo Scientific®, UK) استفاده شد. تعیین چندشکلیهای تک نوکلئوتیدی در ژن‌ مورد بررسی: به‌منظور شناسایی چندشکلی نوکلئوتیدی ژن‌ مورد نظر در توده مورد بررسی ابتدا پرایمر اختصاصی برای تکثیر نواحی مورد نظر (بخشی از اینترون 4، کل اگزون 5 و بخشی از ناحیه 3′ UTR) به کمک نرم‌افزار آنلاین Primer3(v. 0.4.0) طراحی شد. توالی این پرایمرها به‌شرح زیر بود: پرایمر فرادست"5′ CCTTTTGAAACCTCCTTCCT 3′ " و فرودست "5′CCCCTAGAATAGAATGACACCT3′". هر مخلوط واکنش (lµ25) شامل 16پیکومول از هر پرایمر، 50 نانوگرم DNA ژنومیک، lµ 5/12Master Mix آماده با mM 5/1، MgCl2 و مابقی تا رسیدن به حجم نهایی (lµ 25) آب دیونیزه بود. برنامه زمانی به ترتیب، مرحله واسرشتگی اولیه به مدت 5 دقیقه با دمای 95 درجه سانتی گراد، 30 چرخه شامل سه مرحله: 95 درجه سانتی گراد به مدت 30 ثانیه، دمای اتصال 60 درجه سانتی گراد به مدت 30 ثانیه و 72 درجه سانتی گراد به مدت 40 ثانیه و یک چرخه گسترش نهایی 72 درجه سانتی گراد به مدت 5 دقیقه برای انجام PCR در نظر گرفته شد. برای شناسایی SNP (های) احتمالی موجود در ناحیه مورد تکثیر از ژن مورد نظر، از روش تعیین توالی محصولات PCR استفاده شد. بدین منظور، تعیین توالی هر یک از این نمونه‌ها با ارسال به شرکت ماکروژن کره جنوبی انجام گرفت. مجموعه توالیهای به دست آمده نمونه‌ها بررسی و چندشکلی SNPها به‌کمک نرم‌افزار CLC Main Workbench 5 شناسایی شدند. تجزیه و تحلیل آماری داده‌ها: محاسبه فراوانیهای ژنی، ژنوتیپی و بررسی وجود تعادل هاردی- واینبرگ به کمک نرم افزار Popgene V=1.32 انجام شد. تجزیه و تحلیل آماری داده‌های فنوتیپی و ژنوتیپی و ارتباط بین آنها توسط نرم افزار SAS V=9.1 و رویه GLM انجام شد. مقایسه میانگینها نیز با استفاده از آزمون توکی انجام شد. در این پژوهش از وزن تولد و سن در زمان رکوردگیری به عنوان متغیر کمکی (کوواریت) در تجزیه و تحلیل داده‌ها استفاده شد. نتایج و بحث در این پژوهش، تکثیر قطعه‌ ای از ژن شامل بخشی از اینترون 4 (توالی نوکلئوتیدی 2630- 2509 از توالی ژن GH)، کل اگزون 5 (توالی نوکلئوتیدی 2937-2631) و بخشی از ناحیه پایین دست 3′ (توالی نوکلئوتیدی 2969-2938) با موفقیت انجام شد. طول این قطعه 461 جفت باز بود که در بررسی باندهای حاصل از الکتروفورز محصولات PCR، نزدیک به باند 500 نشانگر مولکولی bp100 قرار گرفتند (شکل 2). شکل 2- الکتروفورزمحصولات PCR شامل بخشی از اینترون 4 ، کل اگزون 5 و بخشی از ناحیه 3′ UTR به‌طولbp461 بر روی ژل آگارز یک و نیم درصد. ستون اول از سمت چپ(ستونM) نشانگر bp 100 DNA و بقیه ستون‌ها (با شماره‌های 1,2,3,4,5) باند به دست آمده از تکثیر نمونه های مورد بررسی می باشد. پس از بررسی نتایج حاصل از توالی‌یابی‌، یک مورد چندشکلی تک نوکلئوتیدی و یک مورد اضافه شدن یک تک نوکلئوتید در نمونه‌های مورد بررسی مشاهده شد (شکل 3). این چندشکلیها در نوکلئوتیدهای شماره 338و 374 قطعه تکثیر شده (نوکلئوتید 2846 و 2882 توالی GH) قرار داشتند و به ترتیب سبب تغییر نوکلئوتید T به C و اضافه شدن نوکلئوتید A به توالی شدند. هر دوی این چندشکلیها در ناحیه غیر کدکننده اگزون 5 واقع شده‌اند. همانطور که در شکل3 مشاهده می‌شود در جایگاه نوکلئوتیدی 2846، ژنوتیپهای TT و TC مشاهده شد. لازم به ذکر است که در این جایگاه در نمونه های مورد بررسی ژنوتیپ CC مشاهده نشد. جدول 1، فراوانی ژنوتیپی و آللی چندشکلیهای مشاهده شده و وضعیت تعادل هاردی- واینبرگ را نشان می‌دهد. فراوانی آللی و ژنوتیپی درگروههای افشاری خالص، نسل F2 و F5 متفاوت بود. بیشترین فراوانی آلل جهشی SNP2846 T>C در نسل F2 (48/16 درصد) مشاهده شد. شکل3- بررسی توالی محصولات PCR . A: پلی مورفیسم تک نوکلئوتیدی در نوکلئوتید شماره 2846 قطعه تکثیر شده: توالی ردیف اول و دوم ژنوتیپ TT را دارند ولی توالی ردیف سوم ژنوتیپ TC را دارد. B: اضافه شدن تک نوکلئوتید(Insertion) در محل نوکلئوتید شماره 2882 (بین نوکلئوتید 2881 و 2882): در توالی ردیف دوم اضافه شدن تک نوکلئوتید A مشاهده می‌شود که به‌صورت هموزیگوت است. فراوانی این آلل در دو گروه افشاری خالص (77/5 درصد) و نسل F5 (55/4 درصد) مشابهت زیادی داشت. در مورد SNP2881_2882insA ، بیشترین فراوانی آلل جهشی در گروه افشاری خالص (31/42 درصد) و سپس نسل F5 (18/18 درصد) مشاهده شد. نسل F2 کمترین فراوانی را دارا بود (08/2 درصد). در این جایگاه، آلل A به صورت هموزیگوت مشاهده شد (AA) و ژنوتیپ هتروزیگوت مشاهده نشد. میزان فراوانی آللی در گروههای افشاری خالص و F5 ، در هر دو SNP ، مشابه هم بود. دلیل این تشابه، می‌تواند مشابهت بالای ترکیب ژنتیکی نسلF5 با نژاد خالص افشاری باشد. جدول1- فراوانی ژنوتیپی، فراوانی آللی و وضعیت SNPها از لحاظ تعادل هاردی-واینبرگ به تفکیک گروه ژنتیکی SNP گروه ژنتیکی تعداد ژنوتیپ فراوانی ژنوتیپی درصد فراوانی ژنوتیپی آلل درصد فراوانی آللی کای اسکور وضعیت تعادل 2846 T>C افشاری 26 TT 23 46/88 T 23/94 38/6 در حالت تعادل TC 3 54/11 C 77/5 F2نسل 96 TT 59 05/67 T 52/83 29/3 در حالت تعادل TC 29 95/32 C 48/16 F5نسل 11 TT 10 91/90 T 45/95 00/0 در حالت تعادل TC 1 09/9 C 55/4 2881_2882insA افشاری 26 __ 15 69/57 _ 69/57 094/27 عدم تعادل AA 11 31/42 A 31/42 F2نسل 96 __ 94 92/97 _ 92/97 34/127 عدم تعادل AA 2 08/2 A 08/2 F5نسل 11 __ 9 82/81 _ 82/81 12/14 عدم تعادل AA 2 18/18 A 18/18 تحقیقات متعددی با هدف شناسایی پلی‌مورفیسم ژن GH در نژادهای مختلف گوسفند انجام شده است. در بیشتر آنها که از روش PCR-SSCP استفاده شده، تنها گروههای ژنوتیپی، مورد شناسایی قرار گرفته‌اند ولی SNP مسئول و محل دقیق چندشکلی (موقعیت آن) شناسایی نشده ‌است از جمله: باستوس و همکاران (2001) در بررسی پلی مورفیسم ژنوتیپی ناحیه اگزون4 و 5 ژن GH در گوسفند بومی پرتقالی، به ترتیب دو و پنج الگوی ژنوتیپی (10) و شیری و همکاران (2006) سه الگوی ژنوتیپی را در اگزون 4 گوسفند کردی (19) شناسایی نمودند. طهمورث پور و همکاران (2011) در بررسی پلی مورفیسم ژنوتیپی ناحیه اگزون 5 ژن GH در گوسفند بلوچی موفق به شناسایی 3 الگوی ژنوتیپی (G1,G2,G3) شدند (21). بهرامی و همکاران (2015) دو الگوی ژنوتیپی را در اگزون 4؛ و 5 الگوی ژنوتیپی را در اگزون 5 گوسفند مهربان شناسایی نمودند (9). در مواردی، SNPهای مسئول این پلی‌مورفیسم‌ها نیز شناسایی شده اند. جیا و همکاران (2014) در بررسی چندشکلی تک نوکلئوتیدی این ژن در چند نژاد گوسفند، موفق به شناسایی سه SNP شدند که یکی از آنها در ناحیه پایین دست3′ قرار داشت (14). عثمان و همکاران (2015) قطعه‌ای 422 جفت بازی از نواحی اگزون 2 و 3 این ژن را در نژادهای نشخوارکنندگان کوچک مصر تکثیر نموده و دو الگوی ژنوتیپی (SSCP) مختلف را شناسایی نمودند. توالی‌یابی ژنوتیپهای مختلف نشان داد که SNP مسئول این تنوع(A>G)، در موقعیت 55 قطعه تکثیرشده قرار داشت (16). مشخصات و ویژگیهای دو SNP شناسایی شده در تحقیق حاضر نشان می دهد که هر دو مورد جدید بوده و برای اولین بار گزارش می‌شوند. تجزیه کوواریانس صفات: نتایج حاصل از تجزیه کوواریانس داده‌ها، حاکی از معنی دار بودن بعضی اثرات ثابت در صفات مورد بررسی بود (جدول 2). جدول 2- تجزیه کوواریانس صفات مورد بررسی صفات میانگین انحراف استاندارد خطا مقادیر P (سطح معنی‌داری) منابع تغییر گروه ژنتیکی سن مادر تیپ تولد جنس وزن تولد* سن بره* UBF 49/3 2/1 0478/0 741/0 9537/0 7824/0 1093/0 0951/0 ULMD 31/23 02/3 0001/0› 8814/0 2141/0 0319/0 0082/0 0601/0 وزن لاشه 68/24 39/3 0001/0› 3418/0 007/0 0638/0 0001/0 0006/0 وزن ران 63/7 10/1 0001/0› 8084/0 0351/0 1559/0 0015/0 005/0 وزن سردست 20/4 85/0 0001/0› 7113/0 0636/0 1425/0 0006/0 0034/0 وزن قلوه‌گاه 10/4 7/0 0001/0› 2587/0 0095/0 1055/0 0008/0 0056/0 وزن دنبه 35/1 41/0 0012/0 0771/0 0585/0 1849/0 0114/0 0112/0 ارتفاع جدوگاه 29/71 85/2 0001/0 0023/0 5124/0 0001/0› 0006/0 0046/0 دور سینه 48/99 29/6 0001/0› 1648/0 3098/0 0036/0 0001/0› 0013/0 طول بدن 47/48 34/3 0024/0 3475/0 0976/0 0017/0 0333/0 2992/0 1 واحد اندازه‌گیری دو صفت UBF و ULMD بر حسب سانتیمتر، صفات وزن لاشه و یایر قطعات لاشه بر حسب کیلوگرم و صفات ارتفاع جدوگاه، دورسینه و طول بدن نیز بر حسب سانتیمتر می باشد. *متغیرهای هم‌بسته(کوواریت) اثر متغیرهای پیوسته وزن تولد و سن در زمان رکوردبرداری نیز (که به صورت کوواریت در مدل وارد شده بودند) بر بیشتر صفات معنی‌دار بود. همان طور که در جدول3 مشاهده می‌شود اثر گروه ژنتیکی بر تمام صفات معنی دار است. اثر سن مادر بر ارتفاع جدوگاه معنی دار و بر وزن دنبه در آستانه معنی داری بود (0771/0 P=). تیپ تولد باعث ایجاد تفاوت معنی‌داری در صفات لاشه شد ولی در مورد صفات بیومتری و صفات اندازه گیری شده از طریق سونوگرافی اثر معنی‌داری نداشت. جنس بره‌ها نیز اثر معنی‌داری را در صفات بیومتری و نیز سونوگرافی ضخامت عضله راسته ایجاد کرد. اثر تغییرات نوکلئوتیدی روی صفات مختلف: به دلیل تفاوت معنی‌دار میانگین تمام صفات در گروههای ژنتیکی متفاوت، تجزیه کوواریانس مجدد داده‌ها، به‌تفکیک گروه ژنتیکی، انجام شد. بر اساس نتایج این تجزیه کوواریانس، ژنوتیپهای مختلف تفاوت معنی‌داری (یا نزدیک به سطح معنی داری) را در صفات ضخامت چربی پشت، عمق عضله راسته، طول بدن و صفات لاشه در بعضی گروههای ژنتیکی نشان دادند. جدول 3- ارتباط ژنوتیپهای مختلف SNPهای شناسایی شده ژن هورمون رشد با صفات بیومتری و سونوگرافی به تفکیک گروه ژنتیکی* 1 . صفات (سانتی‌متر) گروه ژنتیکی 2846 T>C 2881_2882insA TT TC -- AA ارتفاع جدوگاه افشاری 59/75 96/74 85/75 00/75 نسل F2 64/71 06/72 78/70 91/72 نسل F5 26/75 14/79 90/70 50/83 طول بدن افشاری a 65/49 b 25/55 29/52 60/52 نسل F2 90/47 38/47 78/46 50/46 نسل F5 60/38 58/38 38/52 82/24 دورسینه افشاری 63/100 47/96 64/97 46/99 نسل F2 33/98 0/100 41/99 02/98 نسل F5 23/84 36/76 74/94 86/65 UBF افشاری a26/2 b304/0 † 94/0 †62 /1 نسل F2 15/3 18/3 44/3 90/2 نسل F5 01/3 29/3 58/3 72/2 ULMD افشاری †79/25 †05/22 †94/24 †90/22 نسل F2 65/20 36/21 †93/22 †08/19 نسل F5 †58/21 †69/16 94/18 32/19 1: مقادیر داخل جدول میانگینهای تصحیح شده صفات (Least Square Means) هستند. *: سطح معنی‌داری(05/ 0= α) است و در هر صفت، گروههای ژنوتیپی که تفاوت معنی‌داری باهم داشتند با حروف مختلف(a,b) علامت گذاری شده‌اند. گروههایی که تفاوت میانگین صفات در آنها نزدیک به سطح معنی داری بود(12/0 pvalue<)، با علامت " † " مشخص شدند. مقایسه میانگینهای تصحیح شده (نسبت به متغیرهای همبسته) ژنوتیپها، به روش توکی انجام شد. نتایج مقایسه میانگین صفات بیومتری و صفات اندازه‌گیری شده با سونوگرافی در ژنوتیپهای مختلف در جدول 3 و صفات لاشه در جدول 4 آمده است. همان‌گونه که در این جداول مشاهده می‌شود، در ژنوتیپهای مربوط به :SNP2846T>C درگروه افشاری، از بین صفات بیومتری مورد مطالعه، در صفت طول بدن تفاوت معنی-داری مشاهده شد (05/0= α) به‌طوری‌که ژنوتیپ TC، طول بدن بیشتری نسبت به ژنوتیپ TT داشت ( جدول 3). در تحقیقات دیگری نیز نشان داده شده است که تغییرات نوکلئوتیدی در این ژن با صفات بیومتری و رشد ارتباط دارد. برای نمونه، هوآ و همکاران (2009) با تعیین ژنوتیپ به‌شیوه RFLP نواحی اگزون 2 و4 در بز Boer و شناسایی دو SNP، مشاهده نمودند که بعضی ژنوتیپها تفاوت معنی‌داری را در صفات میزان دور سینه در زمان تولد، وزن از شیرگیری و ارتفاع بدن در زمان از شیرگیری نشان می‌دهند (13). جیا و همکاران(2014) نیز ارتباط معنی‌داری بین ژنوتیپهای ناحیه UTR 5′، با صفات دور سینه، طول و وزن بدن و همچنین بین ژنوتیپهای ناحیه اگزون 4 و ناحیه 3′ UTR، با صفات طول بدن، ارتفاع جدوگاه، دور سینه و وزن بدن مشاهده کردند (14). تفاوت بین ژنوتیپهای SNP 2846T>C در صفت سونوگرافی شده ضخامت چربی پشت، در گروه افشاری معنی‌دار و در مورد عمق عضله راسته، در دو گروه افشاری و F5 نزدیک به سطح معنی‌داری بود (1170/0 p=)(جدول 3). همانطور که در جدول 3 مشاهده می‌شود، ژنوتیپ TC، در گروه افشاری، طول بدن بیشتر و ضخامت چربی پشت کمتری نسبت به ژنوتیپ TT دارد. در مورد صفات لاشه مورد مطالعه ( شامل: وزن لاشه، ران، سردست، قلوه‌گاه و دنبه)، تفاوت بین ژنوتیپها، هر چند در سطح 5 درصد معنی دار نبود اما در دامهای گروه افشاری خالص و نتاج F5 به سطح معنی‌داری نزدیک بودند (1170/0 p=). مقدار این صفات در ژنوتیپTC کمتر از ژنوتیپ TT بود. میانگین این صفات در بین ژنوتیپهای گروه F2 تفاوت معنی داری نداشت (جدول 4). به نظر می رسد با توجه به اینکه نسل F5 به افشاری خالص از لحاظ ژنتیکی نزدیک‌تر است، به همین دلیل خصوصیات لاشه آنها نیز با هم شباهت بیشتری دارد. در مورد ژنوتیپهای SNP2881_2882insA: در گروه F2، تنها در صفت وزن ضایعات تفاوت آماری معنی‌داری مشاهده شد. در گروه افشاری، صفات سونوگرافی ضخامت چربی پشت، عمق عضله راسته و نیز کلیه صفات لاشه و در گروه F5، سونوگرافی عمق عضله راسته، تفاوتی نزدیک به سطح معنی داری داشتند. در هر دو گروه ژنتیکی مذکور، ژنوتیپ معمول(--) ضخامت چربی پشت کمتر و عمق عضله بیشتری داشتد. همچنین در گروه ژنتیکی افشاری، این ژنوتیپ(--) از لحاظ وزن قطعات لاشه نیز مقدار بالاتری نسبت به ژنوتیپ AA داشتند (11/0 p=). در بررسی پلی‌مورفیسم تک نوکلئوتیدی گاوهای سیاه ژاپنی، دو SNP شناسایی شده در ناحیه کدکننده اگزون شماره 5 ارتباط معنی‌داری با صفات کیفیت گوشت و وزن لاشه در گاو سیاه ژاپنی نشان دادند (5). اینSNPها سبب تغییر اسیدآمینه لوسین (CTG) به والین (GTG) و ترئونین (ACG) به متیونین (ATG) به ترتیب در کدونهای 127 و 172 شدند (11). لی و همکاران (2013) نیز ارتباط معنی‌داری بین SNP 2258C>T واقع در اگزون 5 گاو بومی کره و وزن لاشه مشاهده نمودند (15). در بررسی که برروی گاوهای بومی کره‌ای صورت گرفت، مشاهده گردید که SNPهای 303C>T و 559G>A در ناحیه پروموتر به ترتیب با وزن 6 ماهگی و ناحیه عضله راسته، 2141C>T و 2258C>T در ناحیه اگزون 5 به ترتیب با افزایش وزن روزانه و وزن لاشه ارتباط معنی داری داشتند (15). ریبکا و همکاران (2014) در بررسی تأثیر پلی‌مورفیسم 10 ژن کاندید و از جمله GH بر صفات لاشه و کیفیت گوشت در گاو Piemontese ، مشاهده کردند که تنوع ژن GH با تنوع در صفات لاشه (وزن لاشه، افزایش وزن روزانه و اسکور لاشه) مرتبط است (17). جیا و همکاران (2014) در مطالعه‌‌ای که برروی چهار نژاد گوسفند انجام دادند، سه SNP (در نواحی UTR 5′، اگزون 4 و 3′ UTR) شناسایی نمودند و ارتباطاتی بین این SNPها و صفات مورد نظر مشاهده نمودند. آنها گزارش کردند که ژنوتیپهای ناحیه UTR 5′، ارتباط معنی‌داری با صفات دور سینه، طول و وزن بدن و ژنوتیپهای ناحیه اگزون 4 و ناحیه 3′ UTR، تفاوت معنی‌داری را در صفات طول بدن، ارتفاع جدوگاه، دور سینه و وزن بدن ایجاد کرده‌اند (14). جدول 4- ارتباط ژنوتیپهای مختلف SNPهای شناسایی شده ژن هورمون رشد با صفات لاشه به تفکیک گروه ژنتیکی* 1. صفات (کیلوگرم) گروه ژنتیکی 2846T>C 2881_2882insA TT TC -- AA وزن لاشه افشاری †15/27 †56/23 †34/26 †38/24 نسل F2 07/24 85/23 64/23 28/24 نسل F5 †11/23 †41/18 58/20 94/20 وزن ران افشاری †25/8 †31/7 †04/8 †53/7 نسل F2 0/8 72/7 55/7 17/8 نسل F5 †19/7 †97/5 54/6 63/6 وزن سردست افشاری †73/4 †93/3 †55/4 †12/4 نسل F2 29/4 19/4 19/4 30/4 نسل F5 †83/3 †80/2 27/3 36/3 وزن قلوه‌گاه افشاری †73/4 †93/3 †57/4 †87/3 نسل F2 22/4 38/4 06/4 54/4 نسل F5 †79/3 †87/2 29/3 36/3 وزن دنبه افشاری †58/1 †24/1 †50/1 †32/1 نسل F2 24/1 18/1 298/1 12/1 نسل F5 †20/1 †76/0 96/0 991/0 وزن ضایعات افشاری نسل F2 †766/0 †67/0 a 89/0 b 54/0 نسل F5 1: مقادیر داخل جدول میانگینهای تصحیح شده صفات (Least Square Means) هستند. *: اعداد با این علامت † نزدیک به سطح معنی داری قرار دارند(12/0 pvalue<) دارند. به طور کلی، نتایج این بررسی نشان داد که تغییراتی در ناحیه غیر کد کننده اگزون 5 این ژن در بین دامهای مورد مطالعه وجود دارد. هرگونه ارتباط معنی‌دار بین SNPها و صفات می تواند نشان‌دهنده تأثیر این SNPها در نوع بیان ژن مربوطه باشد. تاکنون گزارشی در مورد اینکه آیا این تغییرات نوکلئوتیدی منجر به تغییر در بیان این ژن خواهند شد یا خیر؛ در دسترس نیست. با توجه به اینکه در برخی از گروههای بررسی شده تعداد دامها محدود بود، نیاز است که ارتباط بین این پلی مورفیسم و خصوصیات لاشه در آزمایشهای جداگانه دیگری نیز مورد بررسی قرار گیرد. در صورتی که این ارتباطات مورد تأیید واقع گردد، این SNP ها می توانند در روش انتخاب به کمک مارکرها در برنامه های اصلاح نژادی گوسفند مورد استفاده قرار گیرند.

1-      خالداری، م. 1393. اصول پرورش گوسفند و بز. نشر جهاددانشگاهی واحد تهران.
2-      محمدآبادی، م. تنوع آللی ژن کالپاستاتین در گوسفند سنجابی. پژوهشهای سلولی و ملکولی. 28 (3): 395-402.
3-      نظام­آبادی، م.، هرکی­نژاد، ط.، شهیر، م. ح.، خرمتایی، ر.، اسکندری نسب، م. پ.، دانش مقدم، ل و رستمخانی، ر. 1394. ارتباط پلی­مورفیسم5'UTR  ژن تیروگلوبولین با خصوصیات لاشه در بره­های آمیخته افشاری× برولا مرینو. پژوهشهای سلولی و ملکولی. 28 (3): 420-429.
 
4- Adams, N. R., and Briegelet, J. R. 2005. Multiple effects of an additional growth hormone gene in adult sheep. Journal of Animal Science 83: 1868-74.
5- Ardiyanti A, Abe F, Kobashikawa H, Hirayama T, Sugino T, Suzuki K, and Katoh K. 2009. Plasma hormone and metabolite concentrations involved in the somatotropic axis of Japanese Black heifers in association with growth hormone gene polymorphism. Domestic animal endocrinology 37: 243-9.
6- Ardiyanti, A., Abe, T., Tameoka, N., Kobayashi, E., Shoji, N., Ohtani, Y., Suzuki, K., Roh, S. and Katoh K. 2012. Effects of growth hormone gene polymorphism on lipogenic gene expression levels in diaphragm tissues of Japanese black heifers. Asian-Australasian journal of animal sciences 25: 1055-62.
7- Ardiyanti, A., Oki, Y., Suda, Y., Suzuki, K., Chikuni, K., Obara, Y. and Katoh, K. 2009. Effects of GH gene polymorphism and sex on carcass traits and fatty acid compositions in Japanese Black cattle. Animal Science Journal 80: 62-9.
8- Ayuk, J. and Sheppard, M.C. 2006. Growth hormone and its disorders. Postgraduate Medical Journal 82: 24-30.
9- Bahrami, A., Miraei-Ashtiani, S.R., Mehrabani-Yeganeh, H., Banani-Rad, H. and Behzadi S. 2015. The association between polymorphism of the GH1 gene and changes in protein structure and carcass traits in Mehraban sheep (Ovis aries). Animal Production Science 55: 661-5.
10- Bastos, E., Cravador, A., Azevedo, J. and Guedes-Pinto, H. 2001. Single strand conformation polymorphism (SSCP) detection in six genes in Portuguese indigenous sheep breed'Churra da Terra Quente'. Biotechnologie, Agronomie, Société et Environnement 5: 7-15.
11- Chikuni, K., Tanabe, R., Muroya, S., Fukumoto, Y. and Ozawa S. 1997. A simple method for genotyping the bovine growth hormone gene. Animal Genetics 28: 230-2.
12- De, S., MacNeil, M., Wu, X., Michal, J., Xiao, Q., Garcia, M., Griffin, K., Gaskins, C., Reeves, J. and Busboom, J. Detection of quantitative trait loci for marbling and backfat in Wagyu x Limousin F2 crosses using a candidate gene approach. Proc. Journal of Animal Science, 2004, 82:111-: Amer SOC Animal Science 2441 Village Green Place, Champaign, IL 61822 USA.
13- Hua, G., Chen, S., Yu, J., Cai, K., Wu, C., Li, Q,, Zhang, C., Liang, A., Han, L. and Geng, L. 2009. Polymorphism of the growth hormone gene and its association with growth traits in Boer goat bucks. Meat science 81: 391-5.
14- Jia, J.L., Zhang, L.P., Wu, J.P., Ha, Z.J. and Li, W.W. 2014. Study of the correlation between GH gene polymorphism and growth traits in sheep. Genetics and molecular research : GMR 13: 7190-200.
15- Lee, J-H., Lee, Y-M., Lee, J-Y., Oh, D-Y., Jeong, D-J. and Kim, J-J. 2013. Identification of Single Nucleotide Polymorphisms (SNPs) of the Bovine Growth Hormone (bGH) Gene Associated with Growth and Carcass Traits in Hanwoo. Asian-Australasian journal of animal sciences 26: 1359.
16- Othman, O.E., Alam, S.S., El-Kader, H.A.A. and Abd-El-Moneim, O.M. 2015. Genotyping of Growth Hormone Gene in Egyptian Small Ruminant Breeds. Biotechnology 14:136.
17- Ribeca, C., Bonfatti, V., Cecchinato, A., Albera, A., Gallo, L. and Carnier, P. 2014. Effect of polymorphisms in candidate genes on carcass and meat quality traits in double muscled Piemontese cattle. Meat science 96:1376-83.
18- Sambrook, J. and Maniatis, T. 2009. Molecular Cloning: A Laboratory Manual (Second Edition). Cold Spring Harbor Laboratory.
19- Shiri, S., Saghi, D., Nasiri, M., Emrani, H., Montazer Torbati, F. and Mohammadzade M. 2006. Survey of genetic diversity growth hormone and growth hormone receptor genes in Iranian indigenous sheep breed (kordian sheep) using a nonradioactive SSCP. Proc. 57th Ann. Meet. Europ. Asso. Anim. Prod. Antalya, Turkey: 21-8.
20- Smithz, M., Dolezal, H., Gill, R. and Behrens, B. 1992. Evaluation of Ultrasound for Prediction of Carcass Fat Thickness and Longissimus Muscle Area in Feedlot Steers1. J. Anim. Sci 70: 29-37.
21- Tahmoorespur, M., Taheri, A., Gholami, H. and  Ansary, M. 2011. PCR-SSCP variation of GH and STAT5A genes and their association with estimated breeding values of growth traits in Baluchi sheep. Animal biotechnology 22: 37-43.
22- Tatsuda, K., Oka, A., Iwamoto, E., Kuroda, Y., Takeshita, H., Kataoka, H. and Kouno, S. 2008. Relationship of the Bovine Growth Hormone Gene to Carcass Traits in Japanese Black Cattle. Journal of Animal Breeding and Genetics 125: 45-9.