مطالعه تغییرات بیان ژن Zrt1 در مخمر ساکارومایسس سرویزیه تحت تاثیر غلظت های مختلف روی در محیط

نوع مقاله : مقاله پژوهشی

نویسندگان

1 دپارتمان میکروب شناسی، دانشگاه آزاد اسلامی واحد کرج، کرج ایران

2 دپارتمان میکروبیولوژی، دانشکده علوم، دانشگاه آزاد اسلامی واحد ساوه، ساوه، ایران

3 دپارتمان بیوتکنولوژی میکروبی، دانشکده علوم زیستی، دانشگاه آزاد اسلامی واحد تهران شمال، تهران، ایران

چکیده

مقدمه:مخمر S. cerevisiae ، اثر مهمی در جذب فلزات سمی دارد. پروتئین ناقل روی Zrt1به جذب روی خارج سلولی توسط مخمر کمک می کند. بنابرین، تغییرات بیان ژن Zrt1. مخمرS. cerevisiae به عنوان یک سویه مهم صنعتی، تحت تاثیر غلظت های مختلف روی مورد بررسی قرار گرفت. مواد و روش: ابتدا از نمونه حاصل از پسماند کارخانه تولید الکل، مخمر S. cerevisiae با استفاده از روش PCR و تعیین توالی DNA و رسم درخت فیلوژنی شناسایی شد. سپس، میزان رشد این مخمر در حضور روی و در فواصل 24 ساعته با استفاده از روش جذب نوری بررسی شد. از روش qRT-PCR نیز برای تعیین میزان بیان ژنZrt1 در مخمر تحت تاثیر غلظت های مختلف روی موجود در محیط کشت، انجام شد. در نهایت، با STRING و نرم افزار بیوانفورماتیکی Cytoscape شبکه پروتئینی مربوط به ژن Zrt1 ترسیم و آنالیز شد. نتایج: در شرایطی که غلظت روی به مقدار 25 mg/ml در مدت 24 ساعت از انکوباسیون، S. cerevisiae حداکثر سرعت رشد و میزان بیان ژن Zrt1 را به عنوان ناقل روی نشان می دهد. آنالیز شبکه پروتئینی نیزZrt1 به عنوان مهمترین پروتئین موجود در این شبکه در مسیر سیگنالدهی درون سلولی در جذب روی شناخته شد. بحث: ژن Zrt1 اهمیت زیادی در جذب روی توسط مخمر S. cerevisiae به ویژه در شرایط کمبود روی در محیط داردو نیز می توان از پساب های صنعتی برای به دست آوردن میکروارگانیسم هایی با توانایی جذب فلزات در جذب پاکسازی محیط زیست و حتی تولید بیومس غنی شده با این فلزات استفاده کرد

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

In search of Zrt1 gene expression changes in Saccharomyces cerevisiae under different concentrations of zinc in medium

نویسندگان [English]

  • Forough saraei 1
  • kumarss Amini 2
  • Azam Haddadi 1
  • mohaddeseh Larypoor 3

1 Department of Microbiology, karaj Branch, Islamic Azad University, Karaj,Iran.

2 Department of Microbiology, Faculty of Sciences, Saveh Branch, Islamic Azad University, Saveh,Iran

3 Department of Microbial biotechnology, Faculty of biological Sciences, Tehran north Branch, Islamic Azad University, Tehran,Iran

چکیده [English]

Background: The S. cerevisiae is a unique microorganism in toxic metals biosorption. The extracellular uptake of zinc in S. cerevisiae mediated by the high-affinity Zrt1 protein as zinc transporter. The aim of current study was to examination of Zrt1 gene expression level in the presence of zinc metal, in S. cerevisiae as an industrially important yeast strain. Methods: Yeast isolates, obtained from alcohol factory’s effluent were filtered and grown in YPD (yeast extract-peptone-dextrose) medium as a specific medium for yeast growth. The PCR method and DNA sequencing was employed to identify S. cerevisiae yeasts strains. Then, growth rate of this yeast in present of different concentration of Zn2+, was examined at 24-hour intervals (0, 24, 48, and 72 h), using spectrophotometry. The qRT-PCR technique was carried out to quantified expression level of Zrt1 in yeast cells under these conditions. Also, the protein-protein interaction (PPI) network of Zrt1 and its closely interacting genes, obtained from STRING database were analyzed using Network Analyzer (plugged in Cytoscape v3.7.0) to identify the most potentially effective genes. Results: In optimum conditions of 25 µg/ml of zinc after 24 h incubation, S. cerevisiae showed the maximum growth rate and expression level of Zrt1 as Zn transporter. Also, bioinformatics analyses identified Zrt1 as crucial gene in cell signaling pathway for zinc absorption by S. cerevisiae. Discussion: our study demonstrated that S. cerevisiae, obtained from industrial effluents, can be used to produce Zn-enriched biomass.

کلیدواژه‌ها [English]

  • S. cerevisiae
  • Zinc
  • Zrt1
  • Biosorption

مطالعه تغییرات بیان ژن Zrt1 در مخمر ساکارومایسس سرویزیه تحت تاثیر غلظت های مختلف روی در محیط

فروغ سرائی1، کیومرث امینی2*، اعظم حدادی1 و محدثه لاری پور3

1 ایران، کرج، دانشگاه آزاد اسلامی واحد کرج، دپارتمان میکروبیولوژی

2 ایران، ساوه، دانشگاه آزاد اسلامی واحد ساوه، دانشکده علوم، دپارتمان میکروبیولوژی

3 ایران، تهران، دانشگاه آزاد اسلامی، واحد تهران شمال، دانشکده علوم زیستی، دپارتمان میکروبیولوژی

تاریخ دریافت: 24/12/1399          تاریخ پذیرش: 09/02/1400

چکیده

مخمر ساکارومایسس سرویزیه (Saccharomyces cerevisiae)، اثر مهمی در جذب فلزات سمی دارد و پروتئین ناقل روی Zrt1 به جذب روی خارج سلولی توسط مخمر کمک می کند. بنابرین، تغییرات بیان ژن Zrt1. مخمرS. cerevisiae به عنوان یک سویه مهم صنعتی، تحت تاثیر غلظت های مختلف روی در مطالعه حاضر مورد بررسی قرار گرفت. ابتدا از نمونه حاصل از پسماند کارخانه تولید الکل، مخمر S. cerevisiae با استفاده از روش PCR و تعیین توالی DNA و رسم درخت فیلوژنی شناسایی شد. سپس، میزان رشد این مخمر در حضور روی و در فواصل 24 ساعته با استفاده از روش جذب نوری بررسی شد. از روش qRT-PCR نیز برای تعیین میزان بیان ژنZrt1 در مخمر تحت تاثیر غلظت های مختلف روی موجود در محیط کشت، استفاده شد. در نهایت، با STRING و نرم افزار بیوانفورماتیکی Cytoscape شبکه پروتئینی مربوط به ژنZrt1 ترسیم و آنالیز شد. در شرایطی که غلظت روی در محیط به مقدار 25 µg/ml مدت گرماگذاری 24 ساعت بود، S. cerevisiae حداکثر سرعت رشد و میزان بیان ژن Zrt1 را به عنوان ناقل روی نشان داد. با آنالیز شبکه پروتئینی نیزZrt1 به عنوان مهمترین پروتئین موجود در این شبکه در مسیر سیگنالدهی درون سلولی در جذب روی شناخته شد. ژن Zrt1 اهمیت زیادی در جذب روی توسط مخمر S. cerevisiae به ویژه در شرایط کمبود روی در محیط دارد و نیز می توان از پساب های صنعتی برای بدست آوردن میکروارگانیسم هایی با توانایی جذب فلزات در پاکسازی محیط زیست و حتی تولید توده زیستی غنی شده با این فلزات استفاده کرد.

واژگان کلیدی: مخمر ساکارومایسس سرویزیه، فلز روی، جذب زیستی، ژن  Zrt1

* نویسنده مسئول، تلفن: 08642433342، پست الکترونیکی: [email protected]

مقدمه

 

با سرعت گرفتن رشد صنعت در جهان، کیفیت آب، غذا، خوراک و آب و هوا نیز تحت تأثیر قرار گرفته است، که این امر در نتیجه رها شدن مقادیر بالایی از آلاینده ها، حاصل از صنایع مختلف به محیط زیست می باشد. در این میان، فلزات سنگین به عنوان نوع اصلی این آلاینده ها به دلیل تجمع در آب و غذا و در نتیجه تأثیر بر اندام ها و بافت های انسانی، بطور قابل توجهی ایمنی غذا را تهدید می کنند (13, 18).

از میان فلزات سنگین که به سه دسته فلزات سمی، فلزات گرانبها و رادیونوکلئیدها طبقه بندی می شوند، فلز روی(Zinc) از جمله فلزات سمی به شمار می رود که نقش مهمی در آلودگی آب دارد(25). از آنجا که این فلز به عنوان عنصری اساسی در بخش های صنعتی متعددی مورد استفاده است، مقادیر زیادی از این فلز سنگین در پساب های صنعتی تخلیه می شود. فلز روی از نظر زیستی نیز دارای اهمیت بسیاری است. این فلز به عنوان یون اصلی در ساختار موتیف های پروتئینی، عامل کاتالیستی در بسیاری از آنزیم ها و عامل ساختاری و عملکردی  در اسیدنوکلئیک ها و پروتئین ها ایفای نقش می کند. فلز روی همچنین در بیان بسیاری از ژن ها و نیز توسعه سیستم ایمنی بدن دخالت دارد. بنابراین، کمبود روی به اختلال در عملکرد ایمنی ذاتی و عملکرد سلول های کشنده طبیعی منجر می شود (9, 28, 3).

میکروارگانیسم ها نیز همانند انسان، برای واکنش های حیاتی خود به سطح مناسب روی وابسته اند. به طوری که تحقیقات نشان می دهد حدود 400 ژن دخیل در رشد میکروارگانیسم وابسته به روی است. تحقیقات متعددی به طور عمده در مخمر ساکارومایسس سرویزیهSaccharomyces cerevisiae) ( انجام شده است، که بیانگر نیاز به هموستاز روی در رشد و متابولیسم این مخمر است(17, 3). به طور کلی دو گروه اصلی ناقلین روی یوکاریوتی در S. cerevisiae وجود دارد، شامل: گروه پروتئین های ZIP Zrt1) ،Zrt2 و (Zrt3 و گروه تسهیل کننده انتشار کاتیونیZrc1) ،Cot1، Msc2 وZrg1 (. در شرایط محدودیت شدید روی، جذب روی خارج سلولی در S. cerevisiae با واسطه پروتئین Zrt1با تمایل بالا به جذب روی صورت می گیرد، که در این شرایط بیان ژن Zrt1 تا 30 برابر نیز افزایش می یابد(29, 7, 30)

با وجود ظرفیت متوسط، S. cerevisiae یک میکروارگانیسم منحصر به فرد در جذب فلزات سنگین است، که در سال های اخیر بمنظور حل مشکل آلودگی فلزات سنگین و در نتیجه اصلاح محیط زیست، مورد توجه محققان قرار گرفته است(2). از آنجا که این مخمر دارای قابلیت کشت آسان در مقیاس بزرگ و دستکاری در سطح مولکولی می باشد و همچنین توانایی تولید بیومس فراوان دارد، از دیدگاه تولید مواد زیستی مورد توجه قرار گرفته است(26).

مخمرها می توانند محصولات فرعی آلی صنعتی ارزان قیمت و در دسترس را به پروتئین و لیپیدهای با کیفیت بالا تبدیل کنند، که در خوراک دام و مصرف انسانی کارآمد هستند(24). بعلاوه، به دلیل توانایی مخمر در اتصال به یون های فلزی موجود در محیط کشت، می توان از آنها به عنوان منبع تولید پروتئین غنی شده با مواد معدنی استفاده کرد، تا به راحتی توسط انسان قابل مصرف باشند(1). در مطالعه حاضر با استفاده از مخمرS. cerevisiae به عنوان یک سویه مهم صنعتی، به دست آمده از فاضلاب کارخانه تولید الکل، به بررسی بیان ژن Zrt1 که نقش اصلی را در جذب روی توسط این مخمر دارد، می پردازیم. در این مطالعه تغییرات بیان این ژن در مخمر مورد نظر تحت تاثیر غلظت های مختلف روی موجود در محیط کشت بررسی می شود.

مواد و روشها

جمع آوری نمونه و کشت مخمرهای جداسازی شده: نمونه های به دست آمده از فاضلاب صنعتی کارخانه تولید الکل سیمین تاک (قزوین، ایران) در ظروف شیشه ای استریل جمع آوری و درب ظروف محکم بسته شد و برای بررسی های بیشتر به آزمایشگاه منتقل شد. بمنظور جداسازی میکروارگانیسم ها ابتدا نمونه های پساب با عبور از کاغذ فیلتر با اندازه منافذ 45/0 میکرومتر فیلتر شدند. سپس کاغذهای فیلتر که اکنون حاوی میکروارگانیسم های پساب بودند، به محیط کشت مایع SDB (Sabouraud Dextrose Broth)  که محیط مایع مخصوص رشد قارچ هاست و حاوی پپتون قارچی و دکستروز می باشد، انتقال داده شدند. محیط کشت SDB پس از آماده سازی، به کمک اتوکلاو در دمای 121درجه سلسیوس به مدت 15 دقیقه استریل گردید. این محیط کشت به منظور رشد مخمر و عدم رشد باکتری ها و جداسازی نمونه ها تهیه شد. پس از قرار دادن فیلتر در این محیط کشت، محیط در دمای 35 درجه سلسیوس مدت 3 روز گرماگذاری گردید (تصاویر مربوط به نمونه های فاضلاب جداسازی شده و کشت داده شده در شکل1آمده است). در مرحله بعد، مخمرها که به کمک محیط کشت SDB جداسازی و رشد داده شده بودند، در پلیت های حاوی محیط کشت (Yeast Extract Peptone Dextrose Medium) YPD حاوی کلرامفنیکل، گلوکز، پپتون سویا، استروپتومایسن سولفات و عصاره مخمر کشت داده شدند. محیط کشت  YPDمحیطی مغذی برای رشد مخمرها می باشد که به علت وجود کلرامفنیکل مانع از رشد ارگانیسم ها به جز قارچ ها (از جمله مخمرها) می شود. محیط کشت جامد ساخته شد و در دمای121 درجه سلسیوس و به مدت 15 دقیقه در اتوکلاو استریل گردید. پس از کشت نمونه ها در این محیط، محیط کشت در دمای 35 درجه سلسیوس و به مدت 3 روز انکوبه گردید.

شکل 1- نمونه های فاضلاب جداسازی شده و کشت داده شده. : A نمونه فاضلاب جداسازی شده،به رنگ کدر وقهوه ای مشخص است: B   جداسازی مخمرها از نمونه فاضلاب به روش فیلتراسیون ، :C قرار دادن فیلتر در محیط SDB جهت رشد مخمرهای موجود در فاضلاب

شناسایی مخمر S. cerevisiae از میان نمونه های کشت داده شده: بمنظور شناسایی و جداسازی مخمر S. cerevisiae از بررسی های مورفولوژیکی، بیوشیمیایی و ملکولی استفاده شد.

بررسی مورفولوژیکی مخمر. شناسایی مخمرها براساس استاندارد مرجع شناسایی مخمرها یعنی چاپ پنجم کتاب'The Yeasts, A Taxonomic Study' انجام شد(10). در بررسی مورفولوژیکی کلنی، ویژگی هایی چون رنگ و شکل کلنی، بافت و حاشیه کلنی و همچنین شکل سلول مخمر مشخص گردد. برای بررسی مورفولوژیکی کلنی مخمر، مخمرها بر روی محیط YPD جامد کشت داده شدند و سپس ویژگی های ظاهری کلنی ها در پلیت بررسی شدند. همچنین برای بررسی شکل سلول مخمر، مخمر توسط رنگ آمیزی ساده کریستال ویوله رنگ آمیزی شد و از لحاظ مرفولوژی سلول بررسی گردید.

بررسی بیوشیمیایی مخمر. از آنجا که مخمرها در توانایی تخمیر قندها با هم متفاوتند، در شناسایی بیوشیمیایی مخمر S. cerevisiae قابلیت تخمیر قندها مورد بررسی قرار گرفت. تخمیر قندها به وسیله تولید گاز دی اکسید کربن و تجمع آن در داخل لوله دورهام اندازه گیری شد. به این ترتیب که ابتدا جهت تهیه سوسپانسیون، یک لوله آزمایش محتوی محیط YPD مایع آماده و یک کلنی از YPD جامد در آن تلقیح گردید. سپس در داخل انکوباتور به مدت 24ساعت قرار داده شد تا رشد کند و به عنوان محیط تلقیح مورد استفاده قرار گیرد. تهیه لوله های آزمایش محتوی محیط کشت YEP  حاوی قند های مختلف جهت بررسی تخمیر قندها به این صورت انجام شد که ابتدا به تعداد قندهای مورد بررسی، لوله های آزمایش فراهم شد و 2 گرم از قندهای مورد آزمایش، شامل:

-D مالتوز،-L آرابینوز،-D گالاکتوز، سوکروز، -D زایلوز،-D مانیتول، لاکتوز و D- سلبیوز و-D رافینوز

(به جز رافینوز کهg 4 می باشد، چون برخی سویه ها فقط قسمتی از این مولکول را مصرف می کنند) به همراه 1 گرم از عصاره مخمر  و 2 گرم پپتون در100 میلی لیتر آب مقطر حل شد و توسط فیلتر استریل گردید. سپس لوله های دورهام کوچک به صورت وارونه در داخل محیط قرار گرفت و در دمای 110 درجه سلسیوس به مدت10دقیقه اتوکلاو شد، تا لوله های دورهام به پایین بروند و در ته قرار بگیرند. به لوله های محتوی محیط قندی به میزان 1% از محیط کشت YPD مایع که حاوی سویه های کشت داده شده بود، تلقیح گردید. لوله ها در دمای 25 درجه سلسیوس برای مدت زمان 28روز انکوبه شدند و در این مدت کدورت محیط و لوله های دورهام از نظر تجمع گاز داخل آنها بررسی شدند. سپس نتایج به صورتی که در ادامه آمده است، خوانده شدند(10):

  • مثبت قوی: لوله دورهام پر شده از گاز تا 7 روز
  • مثبت تاخیری: لوله دورهام پر شده از گاز به صورت سریع پس از 7 روز
  • مثبت کم: لوله دورهام پر شده از گاز به آرامی پس از7 روز
  • مثبت ضعیف: کمتر از 3/1 لوله دورهام با گاز پر شده
  • منفی: لوله دورهام بدون پر شدن گاز
  • متغیر: برخی سویه ها + و برخی دیگر - هستند

بررسی ملکولی مخمر. برای شناسایی دقیق تر مخمر S. cerevisiae از روش شناسایی ملکولی مخمر و رسم درخت فیلوژنی استفاده شد. به این ترتیب که ابتدا DNA مخمرها توسط کیت اختصاصی استخراج DNA قارچ و مخمر با نام تجاری (PGA No. PF230-050) PGA Yeast and Fungi DNA Extraction kit طبق مراحل گفته شد در کیت، استخراج شد. سپس از روش متداول واکنش PCR به کمک پرایمرهای ITS1 و ITS4(تهیه شده از شرکت سیناکلون) برای تکثیر ژن 18srRNA مخمر استفاده گردید(14). ترکیبات ویال واکنش PCR در حجم 50 میکرولیتر آماده شد که شامل25 میکرولیتر از مستر میکس فیوژن 2x، 1 میکرولیتر ازDNA نمونه و 1 میکرولیتر از هر یک از پرایمرهای ITS1 و ITS4  و 22 میکرولیتر        آب  DEPC بود.

پس از آماده سازی ترکیب، میکروتیوب های آماده شده در دستگاه (Eppendorf AG22331) برای انجام واکنش PCR قرار گرفت. مراحل واکنش برای تکثیر ژن 18srRNA در شرایط فعال سازی اولیه در دمای 94 درجه سلسیوس به مدت 5 دقیقه، در 35 سیکل (شامل واسرشت سازی در دمای 94 درجه سلسیوس به مدت 1دقیقه، اتصال پرایمرها در دمای 55 درجه سلسیوس به مدت1دقیقه و بسط در دمای72 درجه سلسیوس به مدت2 دقیقه) و در نهایت بسط نهایی در دمای 72 درجه سلسیوس به مدت10دقیقه تنظیم شد. برای مشاهده محصول PCR ، ابتدا 2/0گرم از پودر آگارز (Merck, Germany) در 20 میلی لیتر از محلول 5x TBE حل شد و پس از حرارت و انحلال کامل، با کاهش دمای ژل، 1 میلی لیتر از محلول DNA Safe Stain به منظور مشاهده باندها در مقابل اشعه فراء بنفش به ژل افزوده شد. به این ترتیب ژل آگارز 1% تهیه و نمونه ها بر روی این ژل به کمک تانک الکتوفورز لود شدند. در نهایت نتیجه با دستگاه Gel-Documentation مورد بررسی قرار گرفت. پس از مشاهده باند مورد نظر، محصول PCR برای تعیین توالی به شرکت Bioneer در کشور کره ارسال شد. توالی خوانش شده از طریق بانک اطلاعاتی (National Center for Biotechnology Information )NCBI با سایر ژن های موجود مقایسه شد و توالی مشابه یافت شد و برای رسم درخت فیلوژنی مخمرهای شناسایی شده به عنوان S. cerevisiae نیز از نرم افزار MEGA7.0براساس روشNeighbour-joining  استفاده شد(5).

بررسی تاثیر غلظت های مختلف فلز روی بر میزان رشد

مخمر: پس از شناسایی مخمر مورد نظر، تأثیر غلظت های مختلف روی بر میزان جذب روی توسط مخمر و همچنین میزان بهره وری از آن در جهت تولید توده زیستی از مخمر در حال رشد، مورد بررسی قرار گرفت. ابتدا محلول ZnSO4 ، با استفاده از محلول استوک استریل سولفات هپتاهیدرات روی (Merck, Germany) تهیه شده با غلظت 1000 میلی گرم بر لیتر، آماده سازی شد. سپس از استوک آماده شده رقت های مختلفی به ارلن مایرهای حاوی 200 میلی لیتر محیط کشت SDB ، اضافه شد. بطوریکه غلظت روی در ارلن های مختلف شامل0 ، 25 ، 50 و 100 میکروگرم بر میلی لیتر در محیط کشت تنظیم گردید. سپس 1 میلی لیتر از سوسپانسیون مخمر حاوی مقدار تقریبی107× 5/1 سلول بر میلی لیتر به این محیط های کشت حاوی روی تلقیح شدند. محتوای کلیه ارلن ها (کنترل و آزمایش) در شیکر انکوباتور با دمای 28 درجه سلسیوس و سرعت 200 دور در دقیقه برای مدت 72  ساعت گرماگذاری شدند. pH پایه محیط نیز بر روی 8/5 تنظیم شده بود.

در طول کشت مخمر با حضور روی، رشد مخمر در فواصل 24 ساعته (0، 24، 48 و 72) مورد سنجش قرار گرفت. چگالی نوری (Optical Density: OD) سوسپانسیون هر ارلن (ترکیبی از محیط کشت SDB حاوی روی به همراه مخمر) با استفاده از روش طیف سنجی در طول موج 600 نانومتر اندازه گیری شد. همچنین 10 میلی لیتر از این سوسپانسیون در دمای 20 درجه سلسیوس با سرعت 4000 دور در دقیقه به مدت 10 دقیقه سانتریفوژ شد. سپس محلول روئی دور ریخته شد و رسوب باقیمانده سه مرتبه با آب دوبار تقطیر شستشو داده شد تا باقیمانده محیط کشت و روی باند شده به سطح سلول، حذف شود. پس از آن، برای تعیین وزن بیومس خشک، از یک روش خشک کردن دو مرحله ای استفاده گردید. بدین ترتیب که ابتدا نمونه ها به مدت 2 ساعت تحت دمای 60 درجه سلسیوس قرار گرفتند و سپس در دمای 105 درجه سلسیوس تا رسیدن به وزن ثابت نگهداری شدند(12). در پایان توده زیستی خشک وزن شد و بعنوان وزن خشک سلول (Cell Dry Weight :CDW) در نظر گرفته شد. بازده توده زیستی سلول های مخمر براساس گرم وزن خشک در لیتر محیط کشت گزارش می شود (ما نیز نتایج را بر اساس 200 میلی لیتر محیط کشت گزارش کردیم). بدین ترتیب تاثیر غلظت های مختلف فلز روی بر میزان رشد مخمر مورد ارزیابی قرار گرفت.

بررسی تاثیر روی جذب شده بر بیان ژن Zrt1 در مخمر با استفاده از روش qRT-PCR

استخراج RNA. در این مرحله برای بررسی تاثیر روی جذب شده بر میزان بیان ژن Zrt1 در مخمر ابتدا استخراج RNA از مخمرهای هر گروه با استفاده از کیت استخراج RNA قارچی با نام تجاریEZ-10 Spin Column Fungal RNA Mini-Preps Kit (Bio Basic, BS91915) برطبق مراحل ذکر شده در کیت، انجام شد.

ارزیابی کمّی  RNAو ساخت cDNA. برای اندازه گیری کمّی RNA به دست آمده از دستگاه نانودراپ با نام تجاریDenovix استفاده شد. این دستگاه میزان جذب نوری پروتئین، اسید نوکلئیک و فنول را بترتیب در طول موج های 280، 260 و230 نانومتر نشان می دهد. از نسبت طول موج های 230/ 260 و 280/260 برای بررسی میزان خلوص هر نمونه استفاده می شود. 5/1 میکرولیتر ازRNA  بدست آمده توسط این دستگاه مورد ارزیابی قرار گرفت و با توجه به اینکه نسبت جذب در 260 به جذب در280 نانومتر برای نمونه ها در محدوده تقریبی 8/1 تا 1/2 بود، از خلوص RNA استخراج شده اطمینان حاصل شد. سپس برای ساخت cDNA ازTetro cDNA Synthesis Kit  (BIO-65042 Bioline) استفاده شد. به این ترتیب که 3 میکرولیتر از RNA با افزودن 17 میکرولیترآب DEPC به حجم 20 میکرولیتر رسانده شد و سپس محلول حاصل به میکروتیوب موجود در کیت که حاوی دیگر مواد لازم جهت سنتز cDNA بود، افزوده شد. با چندین مرتبه پیپت کردن، محتویات میکروتیوب به خوبی با هم مخلوط شد و سپس ترکیب حاصل به مدت 10 دقیقه در دمای 37 درجه سلسیوس قرار داده شد. پس از این مدت میکروتیوب در دستگاهPalm-Cycler  که بر روی دمای45 درجه سلسیوس و مدت زمان60 دقیقه تنظیم شده بود، قرار داده شد. cDNA سنتز شده در مرحلهqRT-PCR مورد استفاده قرار گرفت(20).

واکنشqRT-PCR   برای بررسی میزان بیان ژن Zrt1 . بررسی بیان ژن Zrt1 به کمک واکنش qRT-PCR انجام شد. جفت پرایمر:

 Forward: 5′ AAATGCACTAGAACATGGCG 3′

Reverse: 5′ TTCATGACTATTTAAATGCCTT 3′

به عنوان پرایمرهای اختصاصی ژن Zrt1 به کار برده شد. همچنین از جفت پرایمر:

Forward: 5' AAACGGCTACCACATCCAAG 3'

Reverse: 5' CCCATCCCAAGGTTCAACTA 3'

برای تکثیر ژن18SrRNA بعنوان ژن کنترل داخلی در واکنش qRT-PCR استفاده شد. در واقع کنترل داخلی ژنی است که به دلیل پایداری و میزان بیان ثابتی که دارد، برای نرمال کردن داده ها مناسب است. محتویات میکروتیوب جهت انجام واکنش  qRT-PCR در حجم نهایی 25 میکرولیتر آماده شد. میکروتیوب های آماده شده در دستگاهCorbett Rotor-Gene (6000 HRM)  برای انجام واکنش qRT-PCR قرار گرفت. مراحل واکنش برای تکثیر ژنZrt1 در شرایط فعال سازی اولیه در دمای 95 درجه سلسیوس به مدت10دقیقه، در 40 سیکل (شامل واسرشت سازی در دمای 95 درجه سلسیوس به مدت20 ثانیه، اتصال پرایمرها در دمای 60 درجه سلسیوس به مدت30 ثانیه و بسط در دمای72 درجه سلسیوس به مدت20 ثانیه) و در نهایت بازه دمایی60 تا 95 درجه سلسیوس جهت تشکیل منحنی ذوب تنظیم شد. در انتها، آنالیز منحنی ذوب به منظور بررسی عملکرد اختصاصی پرایمرها برای تولید محصول مورد نظر و همچنین عدم شکل گیری پرایمر-دایمر در نظر گرفته شد. تمام واکنش ها بصورت سه بار تکرار انجام شد و نتایج براساس مقادیر سیکل آستانهCt) ) تجزیه و تحلیل شد. محتویات ویال مورد استفاده در واکنش qRT-PCR شامل5/12 میکرولیترمسترمیکس سایبرگرین، 2 میکرولیتر نمونه cDNA،5/8 میکرولیتر آب  DEPC، 1 میکرولیتر از هر یک از پرایمرهای Forward و   Reverse  بود .

رسم شبکه پروتئینی برای شناسایی ژن های مرتبط با ژن Zrt1: برای بررسی بیشتر ژن Zrt1 در مخمر S. cerevisiae در مرحله آخر به کمک نرم افزارهای بیوانفورماتیک، شبکه پروتئینی مربوط به S. cerevisiae که در آن ژن کدکننده پروتئینZrt1 بهمراه پروتئین های دیگر که نزدیک ترین رابطه همکاری در واکنش های سیگنالدهی سلولی را با پروتئینZrt1 دارند، شناسایی شد. سپس آنالیزهای نهایی بر روی این شبکه انجام گرفت.

رسم شبکه پروتئینی. برای بدست آوردن شبکه پروتئینی از پایگاه داده (http://string-db.org) STRING  استفاده شد. به این ترتیب که ابتدا صفحه مورد نظر بر روی بخش شناسایی تک پروتئین تنظیم شد، سپس اسم پروتئین مورد نظر یعنی پروتئینZrt1 در بخش مربوطه نوشته شد و قسمت انتخاب ارگانیسم بر روی S. cerevisiae تنظیم شد. پس از این مرحله و شناسایی پروتئین مورد نظر توسط پایگاه داده در انتها شبکه پروتئینی مربوط به Zrt1 به دست آمد. شکل مربوط به شبکه ذخیره شد. همچنین فایل مربوط به آنالیز شبکه با فرمت tsv ذخیره شد تا برای آنالیزهای بعدی استفاده گردد.

آنالیز شبکه. فایل tsv به دست آمده از مرحله قبل در نرم افزار Cytoscape v3.7.0 (http://cytoscape.org/) قرار داده شد تا به کمک برنامه های متنوع موجود در آن آنالیز شبکه صورت گیرد. در این بخش، برنامه Network Analyzer که یک برنامه بارگذاری شده در نرم افزار Cytoscape می باشد، برای آنالیز شبکه به کار برده شد. به این ترتیب که ابتدا در قسمت بالای صفحه در بخش tools برنامه Network Analyzer را انتخاب کرده و با روشن کردن گزینهNetwork  Analyze و سپس انتخاب گزینه treat the network as undirected نتایج آنالیز شبکه براساس پارامترهای مختلف ارائه می شود، که معمولا از دو پارامتر اصلی Degree و Betweeness centrality برای بررسی نتایج استفاده می گردد.

خوشه بندی شبکه. برای خوشه بندی شبکه مورد نظر از Clustervizکه یکی دیگر از برنامه های بارگذاری شده در نرم افزار Cytoscape می باشد، استفاده شد. این نرم افزار براساس الگوریتم MCODE موجود در Cytoscape شبکه را به خوشه های کوچکتری تقسیم می کند تا پروتئین های مهم موجود در شبکه با دقت بیشتری تعیین شود. بعد از آنالیز شبکه با این روش عموما خوشه های موجود در شبکه به همراه پروتئینی که نقش هسته اصلی را در خوشه مورد نظر دارد، براساس پارامترهای تعریف شده در الگوریتم نشان داده می شود.

آنالیز آماری: در مطالعه حاضر، تمام اندازه گیری ها سه بار انجام شد و نتایج بدست آمده میانگین این سه تکرار بوده است. برای تجزیه و تحلیل اولیه داده های Ct از نرم افزار REST 2009 استفاده شد. همچنین نرم افزارGraphPad Prism 8 برای آنالیز جامع داده ها بکار برده شد. آنالیز داده ها با روش ANOVA مورد تجزیه و تحلیل قرار گرفت و داده های عددی به صورت میانگین ± انحراف معیار گزارش شد. همچنین مقادیر معناداری p بصورت زیر نمایش داده شدند:

*p < 0.05, **p < 0.01, and ***p < 0.001

نتایج

شناسـایی مورفولوژیکی، بیوشیمیایی و ملکـولی مخمـر

  1. cerevisiae : از فاضلاب کارخانه الکل سازی سیمین تاک در سه نوبت نمونه برداری شد تا بدین ترتیب خطای در نمونه گیری کمتر و اماکن جمع آوری مخمر مورد نظر بیشتر باشد. نمونه فاضلاب جمع آوری شده که مراحل جداسازی، فیلتراسیون و کشت بر روی دو محیط YPD و SDB را طی کرده بودند، برای جداسازی و بررسی مورفولوژیکی و بیوشیمیایی مخمر S. cerevisiae استفاده شدند. کلنی های مخمرها از نظر سطح و شکل ظاهری مورد توجه قرار گرفتند، همچنین پس از رنگ آمیزی با کریستال ویوله، در زیر میکروسکوپ نیز تصویر مخمرها مشاهده شد. در بررسی بیوشیمیایی مخمرها نیز، قابلیت تخمیر قندهای گلوکز، آرابینوز، مالتوز، رافینوز، گالاکتوز و سوکروز و همچنین عدم تخمیر قندهای لاکتوز، مانیتول، زایلوز و سلبیوز مورد توجه قرار گرفت و نتایج براساس اطلاعات موجود در کتاب تاکسونومی مخمرها بررسی شد (10). سپس برای تایید بیشتر نمونه ها از بررسی ملکولی استفاده شد.

پس از بررسی مورفولوژیکی و بیوشیمیایی مخمر برای شناسایی دقیق تر مخمر S. cerevisiae، روش شناسایی ملکولی مخمر و رسم درخت فیلوژنی بکار گرفته شد. ابتدا واکنش PCR به کمک پرایمرهای ITS1 و ITS4 برای تکثیر ژن 18srRNA مخمر استفاده شد. نتایج نشان داد که 3 مخمر شناسایی شده در بررسی  مورفولوژیکی و بیوشیمیایی بعنوان مخمر S. cerevisiae الگوی باند مربوط به ژن18srRNA  را نشان دادند (باند مورد نظر در محدوده 500-1000 bp مشاهده شد). محصول PCR این 3 مخمر توسط شرکت Bioneer در کشور کره توالی یابی شد و توالی خوانده شده در بخش بلاست پایگاه اطلاعاتی NCBI مورد تجزیه و تحلیل قرار گرفت. نتایج نشان داد که توالی قطعه 18srRNA در 2 نمونه از این 3 مخمر بیشترین مشابهت را با مخمر S. cerevisiae دارند و این 2 نمونه مخمر، هر دو سویه یکسانی از مخمر  S. cerevisiae بودند، لذا ادامه مراحل کار بر روی این سویه از مخمر S. cerevisiae انجام شد)شکل 2).

 

شکل2- A الگوی باند ژن 18srRNA بر روی ژل آگارز. M: مارکر، 3-1: شماره نمونه های مخمر که همگی الگوی باند مورد نظر را نشان دادند.B تصویر درخت فیلوژنی از 3 نمونه مخمر تعیین توالی شده. نمونه 2 و 3 یه عنوان سویه ای از مخمر S. cerevisiae شناسایی شدند

 

بررسی میزان رشد مخمر S. cerevisiae تحت تاثیر غلظت های مختلف فلز روی: مخمرهای بدست آمده از پساب کارخانه تولید الکل که با بررسی مورفولوژیکی، بیوشیمیایی و ملکولی به عنوان سویه ای از S. cerevisiae شناخته شدند، در بررسی اثر غلظت های مختلف روی بر میزان رشد و تولید بیومس مخمر S. cerevisiae ، مورد مطالعه قرار گرفتند.

به محیط های کشت SDB که با غلظت های مختلف ZnSO4 شامل0 ، 25 ، 50 و 100 میکروگرم برمیلی لیتر تیمار شده بودند، سوسپانسیون S. cerevisiae حاوی مقدار تقریبی107× 5/1 سلول در میلی لیتر (مخمرها در این مرحله در فاز لگاریتمی از رشد خود قرار داشتند) تلقیح شدند. در حالی که کلیه محیط های کشت در شیکر انکوباتور با دمای 28 درجه سلسیوس و سرعت 200 دور در دقیقه برای مدت 72 ساعت گرماگذاری شده بودند، رشد مخمر در فواصل 24 ساعته (0، 24، 48 و 72) تخمین زده شد. OD سوسپانسیون هر محیط کشت (ترکیبی از محیط کشت SDB حاوی روی به همراه مخمر) با استفاده از روش طیف سنجی در طول موج 600 نانومتر اندازه گیری شد، تا میزان رشد مخمر در زمان معین مشخص شود. نتایج نشان داد که بیشترین رشد در محیط کشت تیمار شده با 25 میکروگرم بر میلی لیتر از غلظت ZnSO4  و در مدت زمان 24 ساعت گرماگذاری پس از تلقیح مخمر اتفاق افتاده است. در واقع نتایج گویای این مطلب بود که رشد مخمر S. cerevisiae در محیط کشت حاوی غلظت های مختلف روی در طی مدت24ساعت گرماگذاری، پس از تلقیح مخمر به محیط کشت، به صورت تدریجی افزایش یافت. اما پس از عبور از زمان 24ساعت روند رشد به صورت یکنواخت باقی ماند و افزایش زمان گرما گذاری بر میزان رشد مخمر تاثیرگذار نبود. این در حالی بود که بیشترین میزان رشد در زمان 24 ساعت گرماگذاری پس از تلقیح مخمر و در حضور 25 میکروگرم بر میلی لیتر روی در محیط مشاهده شد.  نتایج نشان داد که بیشترین میزان وزن مرطوب و خشک مربوط به نمونه تیمار شده با 25 میکروگرم بر میلی لیتر از غلظت روی در زمان 24ساعت گرماگذاری پس از تلقیح مخمر بوده است و این مشاهده نتایج طیف سنجی را تایید کرد.

بدین ترتیب با استفاده از طیف سنجی و اندازه گیری بازده وزنی توده زیستی، تاثیر غلظت های مختلف فلز روی بر میزان رشد S. cerevisiae مورد ارزیابی قرار گرفت (جدول 1).

بررسی تغییرات بیان ژن Zrt1 در مخمر S. cerevisiae تحت تاثیر روی جذب شده: از آنجا که برآورد نرخ رشد و سنجش محتوای توده زیستی خشک، در طی رشد در غلظت های مختلف روی موجود در محیط کشت، نشان داد که بیشترین میزان رشد مخمر در مدت 24ساعت گرماگذاری پس از تلقیح مخمر اتفاق می افتد.

 

جدول 1- OD بدست آمده از غلظت های مختلف فلز روی در طول موج 600 نانومتر و بازده وزنی  S. cerevisiaeدر حجم200  میلی لیتر از محیط کشت در غلظت های مختلف روی

OD بدست آمده از غلظت های مختلف فلز روی

72 ساعت

48 ساعت

24 ساعت

0 ساعت

ZnSO4

میکروگرم

بر میلی لیتر

0

985/1

996/1

947/1

014/0

440/2

450/2

520/2

020/0

25

070/2

000/2

005/2

024/0

50

035/2

010/2

005/2

030/0

100

بازده وزنی  S. cerevisiae در غلظت های مختلف روی

72ساعت

48 ساعت

24ساعت

ZnSO4

میکروگرم

بر میلی لیتر

وزن

خشک

وزن

مرطوب

وزن

خشک

وزن

مرطوب

وزن

خشک

وزن

مرطوب

0057/0

39/0

0055/0

39/0

0051/0

34/0

0

0061/0

41/0

0099/0

58/0

0103/0

61/0

25

0075/0

42/0

0086/0

55/0

0080/0

46/0

50

0079/0

44/0

0087/0

56/0

0089/0

47/0

100

 

 

لذا به بررسی تغییرات بیان ژن Zrt1 تحت تاثیر غلظت های مختلف روی در زمان 24 ساعت گرماگذاری پس از تلقیح مخمر پرداخته شد. به این ترتیب که پس از استخراج RNA از مخمرهای هر گروه و طی کردن مراحل سنتز cDNA ، تاثیر روی جذب شده بر میزان بیان ژن مورد نظر در مخمر S. cerevisiae با روش qRT-PCR مورد بررسی قرار گرفت. نتایج نشان داد که بیان ژن Zrt1 تحت تاثیر غلظت های مختلف روی موجود در محیط کشت، در مدت 24 ساعت گرماگذاری پس از تلقیح مخمر، در مقایسه با گروه کنترل (گروهی که غلظت روی در محیط کشت صفر بوده است به عنوان گروه کنترل در نظر گرفته شد)، بیان متفاوتی داشته است. این تفاوت در هر3 گروه نسبت به گروه کنترل معنادار بوده و مقادیر pدر غلظت های 25، 50 و 100 میکروگرم بر میلی لیتر به ترتیب 001/0>، 01/0>  و05/0> بود. با وجود افزایش بیان معنادار ژن Zrt1 در هر3 گروه آزمایشی نسبت به گروه کنترل، بیشترین افزایش بیان این ژن در غلظت 25 میکروگرم بر میلی لیتر مشاهده شد و با دو برابر شدن غلظت روی در محیط کشت، بیان این ژن کاهش یافت. این گونه نتیجه گرفته شد که بیشترین میزان بیان ژنZrt1 در زمانی اتفاق می افتد که محدودیت روی محیطی وجود دارد و با افزایش غلظت روی در محیط میزان بیان آن کاهش می یابد(شکل3).

شکل3- تغییرات بیان ژن Zrt1 تحت تاثیر غلظت های مختلف روی (0 ، 25 ، 50 و 100 میکروگرم بر میلی لیتر) موجود در محیط کشت. غلظت 0 به عنوان گروه کنترل در نظر گرفته شده است *p < 0.05, **p < 0.01, ***p < 0.001)

از مجموع این مشاهدات این گونه نتیجه گرفته شد که غلظت روی موجود در محیط کشت، همان طور که بر میزان نرخ رشد و بیومس به دست آمده از سلول مخمر موثر بوده است، بر میزان بیان ژن های مرتبط با روی از جملهZrt1 که از ناقلان روی در سلول مخمر می باشد، تاثیر گذار است. در واقع در شرایط افزایش روی محیطی بیان این ژن افزایش می یابد تا با تولید پروتئین ناقل، جذب روی محیطی توسط مخمر افزایش یاید. اما این افزایش کاملا به میزان غلظت روی محیطی وابسته است و همان طور که در شکل3 مشاهده شد، این افزایش بیان در محدود 25 میکروگرم بر میلی لیتر، توسط مخمر قابل قبول بود. ولی افزایش بیشتر غلظت روی محیطی نه تنها اثر افزاینده ای بر بیان این ژن نداشته است، بلکه سبب کاهش بیان آن نیز شده است.

بررسی شبکه پروتئینی مرتبط با ژن Zrt1  موجود در مخمر S. cerevisiae : پس از اندازه گیری تغییرات بیان ژن Zrt1 در مخمر S. cerevisiae تحت تاثیر غلظت های مختلف روی محیطی، برای بررسی بیشتر این ژن، مطالعه بیوانفورماتیک شبکه پروتئینی مربوط به S. cerevisiae در ارتباط با پروتئینZrt1 صورت گرفت. به این ترتیب که ابتدا شبکه پروتئینی مورد نظر از پایگاه داده STRING استخراج شد (شکل4) و سپس به کمک نرم افزار Cytoscape با استفاده از برنامه Network Analyzer آنالیز شبکه صورت گرفت. نتایج آنالیز شبکه براساس دو پارامتر اصلی Degree و Betweeness centralityارائه شد. در پایان نیز برای تقسیم بندی دقیق تر ژن ها خوشه بندی شبکه به کمک الگوریتم MCODE صورت گرفت.

 

شکل 4- A شبکه پروتئینی پیش بینی شده برای ژن Zrt1. B. خوشه به دست آمده از شبکه پروتئینی. ژن نشان داده شده با رنگ زرد به عنوان هسته مرکزی خوشه شناسایی شده است.

 

همان طور که در شکل4 A.نشان داده شده است، شبکه به دست آمده دارای 11 ژن بود. هر گلوله در شکل نشان دهنده یک ژن و هر خط میان دو ژن نشان دهنده یک ارتباط میان این دو ژن است. در تعریف شبکه پروتئینی هر ژن یک گره و هر خط ارتباط، یک یال نامیده می شود. بنابراین هرچه تعداد گره ها در شبکه بیشتر باشد، نشان دهنده اینست که در شبکه پروتئینی مورد بررسی ژن های بیشتری نقش دارند و هرچه تعداد یال های میان ژن ها بیشتر باشد، به معنای ارتباط تنگاتنگ میان ژن ها در شبکه است. خوشه بندی شبکه با استفاده از الگوریتم MCODE و براساس 3 پارامتر (Degree Cutoff: 2, K-Core: 2, Node Score Cutoff: 0.2)، نشان داد که این شبکه پروتئینی دارای یک خوشه تشکیل شده از 10 ژن (گره) می باشد که در میان آنها ژن ZRC1 بعنوان هسته مرکزی خوشه شناخته می شود (شکل4.B). آنالیز شبکه به کمک برنامه Network Analyzer ژن های موجود در شبکه را براساس پارامترهایDegree  و Betweeness centralityترتیب بندی کرد، که این ترتیب بندی ها نشان دهنده درجه اهمیت ژن ها در شبکه است. به کمک پارامتر Degree 10 درصد اول ژن های موجود در این ترتیب بندی بعنوان Hub شناخته می شوند و براساس پارامتر Betweeness centrality 10 درصد اول ژن های موجود در این ترتیب بندی بعنوان Bottleneck شناخته می شوند. Hub در شبکه به ژن هایی گفته می شود که بیشترین ارتباط را با ژن های دیگر دارند و Bottleneck به ژن هایی گفته می شود که در کوتاه کردن مسیر برای ارتباط میان سیگنالدهی های مختلف نقش دارند. لذا برای بررسی یک شبکه پروتئینی هر دو پارامتر در نظر گرفته می شود. چرا که بسته به نوع شبکه ممکن است میزان اهمیت هرکدام از این دو پارامتر متفاوت باشد. با توجه به نتایج ارائه شده در جدول2 براساس آنالیز به دست آمده، و نیز تعریف Hub و Bottleneck در شبکه پروتئینی، ژن Zrt1 از هر دو نظر دارای بیشترین امتیاز بود، که نشان دهنده اهمیت پروتئین آن در مسیر سیگنالدهی مربوط به انتقال روی محیطی به داخل سلول در مخمر S. cerevisiae می باشد.

جدول 2- ترتیب بندی ژن های موجود در شبکه پروتئینی براساس پارامترهای اصلی

نام ژن

Degree

نام ژن

Betweeness centrality

ZRT1

10

ZRT1

103915/0

ZAP1

10

ZAP1

103915/0

YKE4

9

YKE4

015026/0

ZRT3

9

ZRT3

015026/0

FET4

9

FET4

015026/0

ZRC1

8

MSC2

007407/0

MSC2

8

ZRG17

003175/0

ZRG17

8

ZRC1

003175/0

COT1

7

COT1

0

ZPS1

6

ZPS1

0

NRG2

2

NRG2

0

بحث و نتیجه گیری

در میان مطالعات انجام شده برای شناسایی هرچه بهتر میکروارگانیسم های مناسب با توانایی بالا در جذب زیستی فلزات و به دنبال آن رفع آلودگی پسماندها به منظور حفظ سلامت محیط زیست، مطالعات قابل توجهی بر روی مخمر S. cerevisiae صورت گرفته است، که نشان دهنده اهمیت آن برای رسیدن به این هدف می باشد. در مطالعه ای در سال 1987 نشان داده شد که این مخمر قادر به برداشت و جذب روی از محیط خارج سلولی و ذخیره و توزیع آن در ساختارهای سازمان یافته از جمله واکوئل ها می باشد. این مکانسیم عبور از غشای پلاسمایی و جداره واکوئل ها از طریق انتقال دهنده های خاص و وابسته به انرژی است و با این مکانیسم، مخمر قادر به مقاومت و کاهش سمیت روی در محیط حاوی روی نسبت به دیگر فلزات می باشد(27). مکانیسم جذب فلز در S. cerevisiae از طریق یک روند پیچیده، تحت شرایط خاصی اتفاق می افتد. پارامترهای بسیاری بر جذب روی توسط سلول های مخمر تأثیر گذار است. از این میان می توان به فیزیولوژی سلول، خصوصیات سطح سلول و همچنین شیمی یون های فلزی و اثرات فیزیکوشیمیایی محیط اشاره کرد(4). مطالعه انجام شده بر روی جذب فلزات سنگین از فاضلاب صنایع چرم سازی، توسط مخمر S. cerevisiae نشان داد که این مخمر چه بصورت زنده و چه بصورت غیرزنده قادر به جذب فلزات سنگین است. همچنین مشاهده شد که پارامترهای مهمی از جمله غلظت فلزات سنگین،pH  محیط کشت، مدت زمان گرماگذاری و حتی میزان تلقیح مخمر نقش حیاتی در کارایی جذب فلزات توسط مخمر دارند(19).

در یک مطالعه تاثیر سه نوع نمک روی شامل نیترات روی، سولفات روی و کلراید روی بر میزان بازده S. cerevisiae همچنین تفاوت جذب این سه نوع نمک توسط سلول های مخمر، مورد بررسی قرار گرفت. نتایج نشان داد که غلظت‍های 0، 100،50،25 میلی گرم از هر سه نوع نمک روی مذکور، میزان بازده توده زیستی مخمر را تغییر نمی دهد و میزان توده زیستس بدست آمده 99/0 - 19/1 گرم توده زیستی خشک مخمر در  100 میلی لیتر محیط YPDبود. در این تحقیق همچنین نشان داده شد که غلظت های بالای روی در حدود 200 و 300 میلی گرم منجر به مرگ سلول های مخمر می شود(21). آزاد و همکارانش در سال 2014، موفق به تولید توده زیستی S. cerevisiae غنی شده با روی جهت استفاده بعنوان مکمل غذایی برای انسان و حیوانات شدند. مشاهدات آنها نشان داد که غلظت سولفات روی افزوده شده به محیط رشد مخمر بطور مشخصی می تواند بر میزان تجمع روی در سلول ها و همچنین رشد سلول مخمر تاثیر بگذارد(4).

در مطالعه حاضر، ما از غلظت های مختلف فلز روی (0، 100،50،25 میکروگرم بر میلی لیتر) در محیط کشت SDB استفاده کردیم، تا غلظت اپتیمم روی را برای رسیدن به میزان بالایی از توده زیستی مخمر و جذب روی، بدست آوریم. بطور همزمان، اثر زمان گرماگذاری نیز بر رشد مخمر مورد بررسی قرار گرفت. نتایج نشان داد که افزایش زمان گرماگذاری بیش از 24 ساعت، تأثیر مثبتی بر جذب روی ندارد (جدول1). حداکثر میزان توده زیستی خشک و همچنین بیشترین سرعت رشد مخمر نیز در غلظت 25 میکروگرم بر میلی لیتر روی در محیط SDB و بعد از 24 ساعت گرماگذاری مشاهده شد (جدول1). بنابراین، این گونه نتیجه گرفته شد که مدت 24 ساعت گرماگذاری در حضور روی محیطی با غلظت 25 میکروگرم بر میلی لیتر زمان مناسب و غلظت اپتیمم روی برای رشد S. cerevisiae می باشد.

جذب روی به داخل سلول ها و انتقال آن به داخل و خارج اندامک های داخل سلولی نیاز به ناقلان پروتئینی دارد که به غشاهای این اندامک ها برای تسهیل در حرکت روی کمک می کنند. در مطالعه ای که بر روی جزئیات تنظیم مولکولی برداشت فلز روی در مخمر S. cerevisiae صورت گرفت، مشاهده شد که برداشت روی در مخمر وابسته به دو ژن Zrt1 و Zrt2 است، که هر دو متعلق به خانواده ZIP می باشند. همچنین مشاهده شد که Zrt1  در هنگام کمبود روی فعال می شود، ولی فعال شدنZrt2  هنگامی صورت می گیرد که میزان روی در محیط نرمال باشد. در این مطالعه تنظیمات مختلف این دو ژن در مقادیر مختلف روی نیز مورد بررسی قرار گرفت(27). در سال 2008آزمایشات Tamura و همکارانش نشان داد که حذف ژن Zrt1 به شدت رشد مخمر S. cerevisiae را در محیط کشت مهار می کند و این نقص را می توان با دو برابر کردن مقدار یون فلز روی در محیط برطرف کرد. آنها پیشنهاد کردند که فلز روی می تواند فاکتور محدود کننده رشد در جهش یافته های zrt1Δ و zrt1Δzrt2Δ باشد. همچنین این تحقیق نشان داد که Al3+ موجب افزایش تجمع فلز روی در موتانت zrt1Δ می شود و در فقدان  Al3+اضافی، کمبود روی در مخمر مشاهده می گردد (23).

ما نیز در مطالعه خود به بررسی تغییرات سطح بیانZrt1 بعنوان ناقل مهم روی، در پاسخ به غلظت روی محیطی و مدت زمان گرماگذاری 24 ساعته S. cerevisiae در محیط SDB، در مقایسه با محیط شاهد (محیط SDB فاقد روی) پرداختیم. نتایج بدست آمده نشان داد که حداکثر میزان بیان ژن Zrt1 نسبت به گروه های دیگر در غلظت 25میکروگرم بر میلی لیتر روی اتفاق می افتد. در واقع بیشترین میزان بیان ژن Zrt1 در زمانی اتفاق می افتد که محدودیت روی محیطی وجود دارد و با افزایش غلظت روی در محیط میزان بیان آن کاهش می یابد (شکل3). از این رو، مشاهدات ما مطابق با مطالعه قبلی است که بیان می کند، جذب روی خارج سلولی توسط S. cerevisiae در محدودیت شدید روی، با استفاده از ناقل روی با افینیتی بالا، یعنی Zrt1 صورت می گیرد(6).

در سال 2013 مطالعه ای بر روی Zrt1 به عنوان یکی از ژن های موثر در برداشت روی انجام شد. این مطالعه فراوانی و پلی مورفیسم غیرمترادف انواع ژن های دیگر موثر در برداشت روی و ایجاد تعادل در میزان روی در S. cerevisiae را نیز مورد بررسی قرار داد. نتایج نشان داد که در ایجاد تعادل درون سلولی، همچنین برداشت و انباشت فلز روی بیش از 5 ژن دخالت دارند، که به موجب آنها پلی مورفیسم های بسیاری در برداشت روی در این مخمر دخیل هستند. این ژن ها شاملZrt1، Zrt2، Fet4،Pho84 ،Cot1  و چندین ژن دیگر می باشند. در نهایت نتیجه گرفته شد که میزان فلز روی موجود در محیط، عاملی بالقوه در تخمین فراوانی انتخاب مثبت در بیان این ژن های مخمر می باشد(8). همچنین در تحقیق دیگری مشاهده شد که همانند دیگر ناقلان، Zrt1 هنگامی که S. cerevisiae در معرض غلظت بالای روی محیطی قرار می گیرد، از غشای پلاسمایی حذف می شود(20). در مطالعه حاضر ما نیز به کمک رسم شبکه پروتئینی توانستیم ژن های موجود در S. cerevisiae که نزدیک ترین رابطه را با پروتئین Zrt1 داشتند و در مسیرهای سیگنالدهی درون سلولی این مخمر ازجمله مسیرهای موجود جهت انتقال روی محیطی به داخل سلول شرکت داشتند، شناسایی کنیم (شکل4.A). نتایج آنالیز این شبکه پروتئینی نشان داد که Zrt1 دارای بیشترین درجه از لحاظ اهمیت و تقابل با دیگر پروتئین های موجود در شبکه بوده است. قابل ذکر است که Fet4 وCot1  که در مطالعه انجام شده در سال 2013 به عنوان ناقلان روی در S. cerevisiae گزارش شده بودند نیز در شبکه گفته شده مشاهده شدند. لذا پیشنهاد می شود تا در مطالعات بعدی جهت بررسی دقیق تر شرایط اپتیمم برای جذب روی بعنوان یکی از فلزات سنگین موجود در پسماندهای صنعتی، سایر ژن های این شبکه به ویژه Fet4 وCot1  و نیز Zrc1که به عنوان هسته اصلی در خوشه بندی از شبکه شناسایی شد (شکل4.B)، پرداخته شود.

علاوه بر توانایی و قابلیت میکروارگانیسم ها در جذب فلزات، تولید پروتئین تک یاخته توسط این میکروارگانیسم ها نیز توجه محققان را به خود جلب کرده است. در مطالعه ای که بر روی پساب حاوی نشاسته صورت گرفت، مشخص شد که می توان سویه های مخمر S. cerevisiae را از آن جداسازی کرد و این مخمر قادر به مصرف نشاستة محلول و خام است و می تواند از آنها برای تولید پروتئین تک یاخته استفاده کند(16). در مطالعه دیگری که به منظور استفاده از مخمرها در جهت تولید پروتئین تک یاخته از امعاء و احشاء ماهیان صورت گرفت، مشخص شد که مخمر S. cerevisiae موجود در باقیمانده امعاء و احشاء ماهیان می تواند جهت تولید پروتئین تک یاخته استفاده شود. الگوی کشت مورد استفاده در این تحقیق از نوع هوازی بود که در شرایط بسته و در دو مقیاس آزمایشگاهی و تخمیری انجام شد. نتایج نشان داد که شرایط مطلوب رشد مخمرها، همچنین استفاده از فرمانتور مناسب، سبب تولید درصد بالایی از پروتئین تک یاخته حاصل از پساب ضایعات ماهی می شود که بعنوان مکمل غذایی در غذای دام، طیور و آبزیان قابل استفاده است(22).

میکروارگانیسم ها به عنوان جاذب های زیستی به راحتی در دسترس هستند و برای جذب فلزات سنگین در غلظت های بسیار کم نیز کاملا کارآمد می باشند. منطق استفاده از میکروارگانیسم ها برای جذب فلزات سنگین اینست که آنها توده زیستی هستند که بطور گسترده قسمت زیادی از کره زمین را تشکیل می دهند، در حالی که از نظر اندازه بسیار کوچکند. همچنین میکروارگانیسم ها قابلیت رشد در شرایط کنترل شده را دارند و در مقابل تغییرات محیطی قابل انعطافند(15). همه این ویژگی ها در کنار توانایی میکروارگانیسم ها به ویژه مخمرها در استفاده از فلزات جذب شده توسط آنها در جهت تولید توده زیستی کارآمد که می تواند علاوه بر سم زدایی از پسماندها و پاکسازی محیط به عنوان بیومسی غنی از فلزات در جهت غنی سازی هدفمند غذای انسان ها و خوراک دیگر جانواران استفاده شود(11)، اهمیت مطالعاتی نظیر مطالعه حاضر را برای دست یابی به شرایط بهینه برای تولید بهینه چنین میکروارگانیسم هایی نشان می دهد. مطالعه حاضر بر روی مخمر S. cerevisiae بدست آمده از پساب کارخانه تولید الکل بمنظور بررسی شرایط بهینه رشد این مخمر در حضور فلز روی و با تاکید بر نقش پروتئین Zrt1 که یک پروتئین ناقل روی در شرایط کمبود روی می باشد، متمرکز شده بود. نتایج حاصل از مطالعه، قابلیت و اهمیت این پروتئین را در جذب روی به ویژه در شرایط کمبود روی محیطی نشان داد. پیشنهاد می شود برای نتیجه گیری بهتر در مطالعات بعدی مواردی نظیر: بررسی دیگر فاکتورهای موثر بر رشد مخمر و جذب روی توسط مخمر، مقایسه تاثیر شرایط هوازی و بی هوازی بر رشد مخمر و در نتیجه میزان تولید توده زیستی، بررسی تاثیر فاکتورهای مختلف بر بیان دیگر ژن های موثر در جذب روی از جمله  Zrt2و Pho84 و تاثیر آنها بر رشد مخمر، تهیه پروتئین تک یاخته غنی شده با روی و آهن توسط مخمر S. cerevisiae و بررسی کارایی مخمر S. cerevisiae برای جذب روی در فاضلاب حاوی عناصر مختلف، مورد توجه قرار گیرد.

1- شیخی، رستمی، آذین، اسداللهی، ابراهیمی. بهبود تولید و مقاومت به اتانل در مخمر ساکارومایسس سرویزیه با راهبرد مهندسی تکاملی با استفاده از تنش 1-بوتانل. پژوهش‌های سلولی و مولکولی (مجله زیست شناسی ایران). 2021.
2- فرامرزی، انزابی، یونس، مالمیری ج، هدا. اثر تغییرات مقدار ملاس و سلنیوم بر رشد مخمر ساکارومایسس سروزیه و میزان بیو‌اتانول تولیدی. پژوهش‌های سلولی و مولکولی (مجله زیست شناسی ایران). 2020، 33(4): 626-39.
 
3- Andreini C, Banci L, Bertini I, Rosato A. Zinc through the three domains of life. Journal of proteome research. 2006;5(11):3173-8.
4- Azad SK, Shariatmadari F, Torshizi MK. Production of zinc-enriched biomass of Saccharomyces cerevisiae. Journal of Elementology. 2014;19(2)
5- Cerezer VG, Bando SY, Pasternak J, Franzolin MR, Moreira-Filho CA. Phylogenetic analysis of Stenotrophomonas spp. isolates contributes to the identification of nosocomial and community-acquired infections. BioMed research international. 2014;2014.
6- Eide DJ. Zinc transporters and the cellular trafficking of zinc. Biochimica et Biophysica Acta (BBA)-Molecular Cell Research. 2006;1763(7):711-22.
7- Ellis CD, MacDiarmid CW, Eide DJ. Heteromeric protein complexes mediate zinc transport into the secretory pathway of eukaryotic cells. Journal of Biological Chemistry. 2005;280(31):28811-8.
8- Engle EK, Fay JC. ZRT1 harbors an excess of nonsynonymous polymorphism and shows evidence of balancing selection in Saccharomyces cerevisiae. G3: Genes, Genomes, Genetics. 2013;3(4):665-73.
9- Gerwien F, Skrahina V, Kasper L, Hube B, Brunke S. Metals in fungal virulence. FEMS microbiology reviews. 2018;42(1): fux050.
10- Kurtzman C, Fell JW, Boekhout T. The yeasts: a taxonomic study: Elsevier; 2011.
11- Lavens P, Sorgeloos P. The history, present status and prospects of the availability of Artemia cysts for aquaculture. Aquaculture. 2000;181(3-4):397-403.
12- Li E, Mira de Orduña R. A rapid method for the determination of microbial biomass by dry weight using a moisture analyser with an infrared heating source and an analytical balance. Letters in applied microbiology. 2010;50(3):283-8.
13- Massoud R, Hadiani MR, Hamzehlou P, Khosravi-Darani K. Bioremediation of heavy metals in food industry: Application of Saccharomyces cerevisiae. Electronic Journal of Biotechnology. 2019;37:56-60.
14- Mello A, Napoli C, Murat C, Morin E, Marceddu G, Bonfante P. ITS-1 versus ITS-2 pyrosequencing: a comparison of fungal populations in truffle grounds. Mycologia. 2011;103(6):1184-93.
15- Mishra V. Biosorption of zinc ion: a deep comprehension. Applied Water Science. 2014;4(4):311-32.
16- Nahvi I, Shafiei R. Single cell protein production from raw starch in fed_batch culture by coculture of Cryptococcus aerius and Saccharomyces cerevisiae. Pajouhesh And Sazandegi. 2008.
17- North M, Steffen J, Loguinov AV, Zimmerman GR, Vulpe CD, Eide DJ. Genome-wide functional profiling identifies genes and processes important for zinc-limited growth of Saccharomyces cerevisiae. PLoS Genet. 2012;8(6): e1002699.
18- Owolabi J, Hekeu M. Heavy metal resistance and antibiotic susceptibility pattern of bacteria isolated from selected polluted soils in Lagos and Ota, Nigeria. International Journal of Basic & Applied Sciences. 2014;14(6):6-12.
19- Porwal H, Mane A, Velhal S. Biodegradation of dairy effluent by using microbial isolates obtained from activated sludge. Water Resources and Industry. 2015;9:1-15.
20- Schothorst J, Zeebroeck GV, Thevelein JM. Identification of Ftr1 and Zrt1 as iron and zinc micronutrient transceptors for activation of the PKA pathway in Saccharomyces cerevisiae. Microbial Cell. 2017;4(3):74.
21- Sillerová S, Lavová B, Urminská D, Poláková A, Vollmannová A, Harangozo L. Preparation of zinc enriched yeast (Saccharomyces cerevisiae) by cultivation with different zinc salts. The Journal of Microbiology, Biotechnology and Food Sciences. 2012;1:689-95.
22- Suman G, Nupur M, Anuradha S, Pradeep B. Single cell protein production: a review. Int J Curr Microbiol App Sci. 2015;4(9):251-62.
23- Tamura S, Yoshimura E. Promotion of Zn 2+ Uptake by Al 3+ in a Saccharomyces Cerevisiae Mutant that Lacks the ZRT1 Gene Encoding a High-Affinity Zn Transporter. Biological trace element research. 2008;124(3):262.
24- Ugalde U, Castrillo J. Single cell proteins from fungi and yeasts.  Applied mycology and biotechnology. 2: Elsevier; 2002. p. 123-49.
25- Wang J, Chen C. Biosorbents for heavy metals removal and their future. Biotechnology advances. 2009;27(2):195-226.
26- Wang J, Chen C. Biosorption of heavy metals by Saccharomyces cerevisiae: a review. Biotechnology advances. 2006;24(5):427-51.
27- WHITE C, GADD GM. The uptake and cellular distribution of zinc in Saccharomyces cerevisiae. Microbiology. 1987;133(3):727-37.
28- Yamasaki S, Sakata-Sogawa K, Hasegawa A, Suzuki T, Kabu K, Sato E, et al. Zinc is a novel intracellular second messenger. The Journal of cell biology. 2007;177(4):637-45.
29- Zhao H, Eide D. The yeast ZRT1 gene encodes the zinc transporter protein of a high-affinity uptake system induced by zinc limitation. Proceedings of the National Academy of Sciences. 1996;93(6):2454-8.
30- Zhao H, Eide D. The ZRT2 gene encodes the low affinity zinc transporter in Saccharomyces cerevisiae. Journal of Biological Chemistry. 1996;271(38):23203-10
دوره 34، شماره 3
مهر 1400
صفحه 397-411
  • تاریخ دریافت: 24 اسفند 1399
  • تاریخ پذیرش: 09 اردیبهشت 1400
  • تاریخ اولین انتشار: 13 مرداد 1400