نوع مقاله : مقاله پژوهشی

نویسندگان

1 گروه زیست شناسی سلولی و مولکولی، دانشکده علوم و فناوری زیستی، دانشگاه شهید بهشتی، تهران، ایران

2 گروه ژنتیک، مرکز تحقیقات پزشکی تولیدمثل، پژوهشکده زیست شناسی و علوم پزشکی تولید مثل جهاد دانشگاهی، پژوهشگاه رویان، تهران، ایران

3 گروه سلول های بنیادی و زیست شناسی تکوینی، مرکز تحقیقات علوم سلولی، پژوهشکده زیست شناسی و فناوری سلول های بنیادی جهاد دانشگاهی، پژوهشگاه رویان، تهران، ایران

4 گروه ژنتیک، دانشگاه آزاد اسلامی واحد علوم پزشکی تهران، تهران، ایران

چکیده

ایجاد آنوپلوییدی طی کشت آزمایشگاهی، یکی از موانع کاربرد سلول‌های بنیادی جنینی انسانی (hESCs) است. گزارش‌هایی مبنی بر حساسیت بیشتر سلول‌های آنوپلویید به برخی داروهای ضدسرطان و احتمال کاهش میزان آنوپلوییدی وجود دارد.
hESC موزاییک با مخلوط کردن hESCs دارای تریزومی هم‌زمان 12 و 17 با hESCs طبیعی حاصل و تأثیر سه داروی ضدسرطان (برتزومیب، پاکلیتاکسل (تاکسول) و لاپاتینیب) بر وضعیت کروموزومی توسط روش‌ کاریوتایپ، ارزیابی حفظ بنیادینگی با آزمون آلکالین فسفاتاز و بررسی بیان ژن‌های پرتوانی با Real Time PCR صورت گرفت و گروه‌های تیمار و شاهد مقایسه شدند.
زنده‌مانی در گروه‌های تیمار 24 ساعته‌ی 01/0 میکرومولار برتزومیب و 2/0 میکرومولار لاپاتینیب و در گروه 28 ساعته‌ی 01/0 میکرومولار پاکلیتاکسل، اختلاف معنادار با گروه شاهد نداشت. پاکلیتاکسل در زمان‌های دیگر کشنده بود. سلول‌های آنوپلویید در گروه‌های تیمار و شاهد، جمعیت غالب شدند. سلول‌های تیمار در شرایط یادشده آلکالین فسفاتاز_مثبت بودند و از نظر کاریوتایپ و بیان ژن‌های پرتوانی با گروه شاهد اختلاف معناداری نداشتند.
تیمارهای دارویی انجام شده بر پرتوانی تاثیر منفی نداشتند. مهار نشدن آنوپلوییدی در گروه‌های تیمار، می‌تواند به خصوصیات ویژه‌ی رده‌ای در پاسخ به دارو و برتری تکثیری سلول‌های دارای تریزومی‌های 12 و 17 مربوط باشد.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

The effect of three anticancer drugs (Bortezomib,Paclitaxel and Lapatinib) on stemness and aneuploidy rate in human embryonic stem cells

نویسندگان [English]

  • Nazanin Khademi 1
  • ُShirin Farivar 1
  • Masood Bazrgar 2
  • Seyedeh-Nafiseh Hassani 3
  • Najmeh Sadat Masoudi 2
  • Fatemeh Kharrazi Tavakkol 4
  • Newsha Haghparast 3
  • Mehran Rezaei Larijani 3
  • Parnaz Borjian Boroujeni 2

1 Department of Molecular and Cell Biology, Faculty of Life Sciences and Biotechnology, Shahid Beheshti University, Tehran, Iran

2 Department of Genetics, Reproductive Biomedicine Research Center, Royan Institute for Reproductive Biomedicine, ACECR, Tehran, Iran

3 Department of Stem Cells and Developmental Biology, Cell Science Research Center, Royan Institute for Stem Cell Biology and Technology, ACECR, Tehran, Iran

4 Department of Genetics, Tehran Medical Sciences Branch, Islamic Azad University, Tehran, Iran

چکیده [English]

Aneuploidies following in vitro culture is one of the challenges for application of human embryonic stem cells (hESCs). There are reports that indicate more sensitivity of aneuploid cells to some anticancer drugs and probability of reduction of aneuploidy rate.
Mosaic hESCs was obtained by mixing of normal hESCs and trisomic hESCs for chromosomes 12 and 17. The effect of 3 anticancer drugs, Bortezomib, Paclitaxel (Taxol) and Lapatinib on chromosomal status was studied by karyotyping. Stemness characterization was performed using alkaline phosphatase test and expression analysis of pluripotency genes using Real Time PCR. All treated groups were compared with controls.
When cells treated with 0.01 μM of Bortezomib and 0.2 μM of Lapatinib for 24 hours, there was no significant difference between treated and the control groups. Paclitaxel treatment for 28 hours showed the most viability with no significant difference from control whilst shorter and longer exposure periods were cytotoxic. Treated and control groups did not have significant difference in karyotype and pluripotency genes expression. Aneuploid cells became dominant population in all of treated and control groups. All treated groups were alkaline phosphatase-positive.
Mentioned treatments did not affect pluripotency. Insensitivity of aneuploid cells to treated anticancer drugs could be due to specific characters of each cell line and proliferation dominance of cells with trisomies 12 and 17.

کلیدواژه‌ها [English]

  • Human Embryonic Stem Cells
  • Anticancer drugs
  • Aneuploidy
  • Stemness

تأثیر سه داروی ضدسرطان برتزومیب، پاکلیتاکسل و لاپاتینیب بر بنیادینگی و میزان آنوپلوییدی در سلولهای بنیادی جنینی انسانی

نازنین خادمی1، شیرین فریور1، مسعود بذرگر2*، سیده نفیسه حسنی3، نجمه سادات مسعودی2، فاطمه خرازی توکل4، نیوشا حق پرست3، مهران رضائی لاریجانی3 و پرناز برجیان بروجنی2

1 ایران، تهران، دانشگاه شهید بهشتی، دانشکده علوم و فناوری زیستی، گروه زیست شناسی سلولی و مولکولی

2 ایران، تهران، پژوهشگاه رویان، پژوهشکده زیست شناسی و علوم پزشکی تولید مثل جهاد دانشگاهی، مرکز تحقیقات پزشکی تولیدمثل، گروه ژنتیک

3 ایران، تهران، پژوهشگاه رویان، پژوهشکده زیست شناسی و فناوری سلولهای بنیادی جهاد دانشگاهی، مرکز تحقیقات علوم سلولی، گروه سلولهای بنیادی و زیست شناسی تکوینی

4 ایران، تهران، دانشگاه آزاد اسلامی واحد علوم پزشکی تهران، گروه ژنتیک

تاریخ دریافت: 14/8/1398            تاریخ پذیرش: 24/2/1399

چکیده

ایجاد آنوپلوییدی طی کشت آزمایشگاهی، یکی از موانع کاربرد سلولهای بنیادی جنینی انسانی (hESCs) است. گزارشهایی مبنی بر حساسیت بیشتر سلولهای آنوپلویید به برخی داروهای ضدسرطان و احتمال کاهش میزان آنوپلوییدی وجود دارد. hESC موزاییک با مخلوط کردن hESCs دارای تریزومی همزمان 12 و 17 با hESCs طبیعی حاصل و تأثیر سه داروی ضدسرطان (برتزومیب، پاکلیتاکسل (تاکسول) و لاپاتینیب) بر وضعیت کروموزومی توسط روش‌ کاریوتایپ، ارزیابی حفظ بنیادینگی با آزمون آلکالین فسفاتاز و بررسی بیان ژنهای پرتوانی با Real Time PCR صورت گرفت و گروههای تیمار و شاهد مقایسه شدند. زنده‌مانی در گروههای تیمار 24 ساعته 01/0 میکرومولار برتزومیب و 2/0 میکرومولار لاپاتینیب و در گروه 28 ساعته 01/0 میکرومولار پاکلیتاکسل، اختلاف معنادار با گروه شاهد نداشت.  پاکلیتاکسل در زمانهای دیگر کشنده بود. سلولهای آنوپلویید در گروههای تیمار و شاهد، جمعیت غالب شدند. سلولهای تیمار در شرایط یادشده آلکالین فسفاتاز_مثبت بودند و از نظر کاریوتایپ و بیان ژنهای پرتوانی با گروه شاهد اختلاف معناداری نداشتند. تیمارهای دارویی انجام شده بر پرتوانی تأثیر منفی نداشتند. مهار نشدن آنوپلوییدی در گروههای تیمار، می‌تواند به خصوصیات ویژه رده‌ای در پاسخ به دارو و برتری تکثیری سلولهای دارای تریزومیهای 12 و 17 مربوط باشد.

واژه های کلیدی: سلولهای بنیادی جنینی انسانی، داروهای ضدسرطان، آنوپلوییدی، بنیادینگی

* نویسنده مسئول، تلفن: 23562737-021، پست الکترونیکی: [email protected]

مقدمه

 

ایجاد آنوپلوییدی طی کشت آزمایشگاهی، یکی از موانع کاربرد سلولهای بنیادی جنینی است. دوام تومورها و خصوصاً متاستاز آنها وابسته به سلولهای بنیادی سرطانی دانسته می شود (1). مطالعات اخیر حاکی از حساسیت بیشتر سلولهای دارای آنوپلوییدی به برخی داروهای ضدسرطان در مقایسه با سلولهای طبیعی است که در ادامه به آنها پرداخته می شود.

Ben-David و همکارانش در سال 2014، تأثیر 89 داروی ضدسرطان روی لاین سلولهای بنیادی جنینی انسانی دارای تریزومی 12 و سلولهای بنیادی جنینی انسانی طبیعی را بررسی کردند. مقایسه توانایی تکثیر، تمایز و آپوپتوز بین سلولهای دیپلویید و آنوپلویید hPSCs نشان داد که تریزومی 12 به‌‌طور معناداری سرعت تکثیر را از طریق افزایش همانندسازی بالا می‌‌برد. از سوی دیگر تریزومی 12 سبب افزایش تومورزایی hPSCs می‌شود. از داروهای مورد بررسی، سلولهای دارای تریزومی 12 به پنج دارو، حساس‌تر از سلولهای طبیعی بودند (5).

Amano و همکارانش در سال 2015 از پروتئینی به‌نام ZSCAN4 که در سلولهای بنیادی بیان می‌شود، برای کاهش میزان آنوپلوییدی در سلولهای بنیادی جنینی موشی و سلولهای فیبروبلاستی انسانی استفاده کردند که از افراد دارای سندروم داون یا سندروم ادوارد گرفته شده بود. در این مطالعه، میزان سلولهای یوپلویید، در حضور این پروتئین افزایش یافت (3). Tang و همکارانش در سال 2011 نشان دادند که آنوپلوییدی منجر به پاسخ سلولی می‌شود و در سلولهای آنوپلویید، عدم تعادل استوکیومتری ترکیباتی مانند پروتئینها وجود دارد. این گروه از تیمار سه ترکیب شیمیایی در سلولهای آنوپلویید استفاده کردند: AICAR که یک ترکیب القاء کننده تنش انرژی است(21).

 17-AAGترکیبی شیمیایی که از تاخوردگی پروتئینها جلوگیری می‌کند و chloroquine که سازوکار عمل آن، القای تنش پروتئینی و جلوگیری از اتوفاژی است (28). با مسیرهایی که این ترکیبات شیمیایی در سلول فعال می‌کنند، سلولهای یوپلویید به تکثیر خود ادامه می‌دهند در حالی که تعداد سلولهای آنوپلویید کاهش می‌یابد. استفاده ترکیبی این ترکیبات شیمیایی منجر به تأثیرات چشم‌گیر‌تر و اثربخش‌تر بر کاهش سلولهای آنوپلویید در مقایسه با سلولهای طبیعی شد (18). Dobbelstein و همکارانش در سال 2014 نشان دادند داروهای ضدسرطان در سه گروه اصلی قرار می‌گیرند: گروه اول، با هدف قرار دادن همانندسازی و ترمیم DNA ایفای نقش می‌کنند یا با تداخل در پلیمریزاسیون و دپلیمریزاسیون توبولینها، تقسیم سلولی را هدف قرار می‌دهند. گروه دوم، آنهایی هستند که بر مسیرهای سیگنالینگ سلول تأثیر دارند و در عملکرد پذیرنده‌های غشاء سلولی و کینازهای داخل سلولی مداخله می‌کنند. گروه سوم، ماشینهای داخل سلولی را هدف قرار می‌دهند و روی پروتئازومها، چاپرونهای پروتئینی و تعدیل‌گرهای کروماتین تأثیر می‌گذارند (8).

پاکلیتاکسل، دارویی ضدمیتوز است که در گروه اول قرار می‌گیرد و به‌طور عمده با تأثیر روی میکروتوبولها، اثرات خود را در سلول اعمال می‌کند. مطالعات نشان می‌دهد سرعت بالای تقسیم از مشخصات مشترک بسیاری از سلولهای سرطانی و سلولهای بنیادی است؛ در نتیجه اسکلت سلولی به‌صورت مداوم در حال بازسازی است. پاکلیتاکسل با جلوگیری از این تغییر ساختار، بر فرایند تقسیم سلولی تأثیر می‌گذارد. تا زمانی که سلولهای آنوپلویید سرعت تقسیم بیشتری نسبت به سلولهای دیپلویید داشته باشند، نسبت به پاکلیتاکسل حساس‌ترند (17، 18 و 26). لاپاتینیب، مهارکننده برگشت‌پذیر دو تیروزین کیناز ErbB1 و HER2 است که در گروه دوم قرار می‌گیرد. مطالعات برون‌تنی روی رده‌های سلولی سرطان معده و سینه نشان داده که رده‌های سلولی که دچار افزایش بیان HER2 شده‌اند، نسبت به لاپاتینیب حساس‌ترند. لاپاتینیب به‌طور انتخابی سلولهای سرطانی را تحت تأثیر قرار می‌‌دهد که دارای تظاهر بیش از حد این گیرنده­ها هستند. در واقع لاپاتینیب روی رده‌های سلولی اثر دارد که ژن کدکننده پروتئین HER2 در آنها دچار افزایش بیان شده است. در سلولهای بنیادی جنینی انسانی (hESC) تریزومی کروموزوم 12 و 17، به فراوانی گزارش شده است. از آنجاکه ژن Survivin و HER2 روی کروموزوم 17 قرار دارد، این سلولها به داروی لاپاتینیب حساس‌ترند (19، 20 و 22). برتزومیب، مهارکننده قوی با ویژگی بالا برای پروتئازومهاست که در گروه سوم قرار می‌گیرد. محققان نشان داده‌اند که در سلولهای سرطانی بیان بالا و در نتیجه فعالیت بیش از حد پروتئازومها را شاهدیم. در سلولهای بنیادی جنینی نیز بیان پروتئازومها بالاست. در سلولهای آنوپلویید، عدم تعادل استوکیومتری ترکیباتی مانند پروتئین‌ها وجود دارد و در نتیجه پروتئازومها در تلاشند که این عدم تعادل را جبران کنند. این موضوع سبب حساسیت بیشتر سلولهای آنوپلویید به برتزومیب می‌شود(7، 19 و 27).

در این مطالعه، تأثیر سه داروی ضدسرطان برتزومیب، پاکلیتاکسل و لاپاتینیب بر پرتوانی و میزان آنوپلوییدی در hESC موزاییک و طبیعی مورد بررسی قرار گرفت.

مواد و روشها

این مطالعه در کمیته اخلاق پژوهش پژوهشگاه رویان با کد IR.ACECR.ROYAN.REC.1394.60 به تصویب رسید. در این مطالعه از hESC رده رویان H6 با کاریوتایپ طبیعی و موزاییک استفاده شد. برای ایجاد لاین موزاییک سلولهای طبیعی (هشتاد درصد) و سلولهای غیرطبیعی (بیست درصد) با یکدیگر ترکیب و رده سلولی مورد نظر ایجاد شد. به این ترتیب رده سلولی موزاییک دارای نسبت مشخصی از سلولهای طبیعی (هشتاد درصد) با کاریوتایپ (46,XY) و سلولهای غیرطبیعی (بیست درصد) با کاریوتایپ (48,XY,+12,+17) بود.

کشت بر بستر ماتریژل در محیط حاوی Knockout Serum Replacement (KOSR) انجام شد. در این مرحله برای پیدا کردن غلظت و زمان مناسب برای هر یک از داروها، سه تکرار انجام شد. دوز مؤثر هر دارو با استفاده از روشFluorescence-Activated Cell Sorting(FACS)  با سنجش Propidium Iodide (PI) مشخص شد. بر اساس مطالعات پیشین (4، 6، 9، 10، 12، 17، 23 و 24)، مرحله تأثیرگذاری دارو و نیز چرخه سلولی hESC،  برای داروی برتزومیب غلظتهای 1/0 ، 05/0 و 01/0 میکرومولار در زمان 24 ساعت و برای داروی پاکلیتاکسل به این دلیل که بر چرخه سلولی تأثیرگذار است، غلظت 01/0 میکرومولار در زمانهای مختلف (24، 26، 28، 30، 32، 34، 36 ساعت) و برای لاپاتینیب غلظتهای 2/0 و 5/0 میکرومولار در زمان 24 ساعت، از نظر زنده‌مانی با گروه شاهد مقایسه شدند. سپس بالاترین غلظتی که در آن زنده‌مانی تفاوت معناداری با زنده‌مانی گروه شاهد نداشت، به‌عنوان غلظت مناسب انتخاب شد.

پس از مشخص شدن غلظت و زمان مناسب برای هریک از داروها، به‌منظور ارزیابی حفظ بنیادینگی، شکل کلونیهای تیمار شده توسط میکروسکوپ فاز کنتراست، همچنین بیان آنزیم آلکالین فسفاتاز با استفاده از کیت آلکالین فسفاتاز (Sigma)، بررسی شد.

برای بررسیهای سیتوژنتیکی از بررسی گستره‌های متافازی استفاده شد. به این منظور بررسی رده سلولی موزاییک در آزمونهای زیر انجام شد: آزمون اول: سلولهایی که تنها یک بار با داروها تیمار شد؛ آزمون دوم: سلولهایی که یک بار با داروها تیمار و سه پاساژ بدون تیمار ادامه داده شد؛آزمون سوم: سلولهایی که یک بار با داروها تیمار و سه پاساژ با تیمار ادامه داده شد.

سلولهای تیمار شده با هر یک از داروها با سلولهای بدون تیمار (شاهد) بر اساس آزمون مربع کای مقایسه شدند.

برای استخراج RNA از کیت  بر اساس دستورالعمل شرکت سازنده  RNeasy Mini Kit (Qiagen) استفاده شد.

سنتز cDNA با استفاده از روش RT-PCR با استفاده از کیت First strand cDNA Synthesis kit (Fermentas)  بر اساس دستورالعمل شرکت سازنده انجام شد. برای انجام-Time PCR  Real، از  SYBRGreen (Takara)و پرایمرهای طراحی شده برای ژنهای پرتوانی شامل NANOG،SOX2  KLF4، OCT4 و GAPDH به‌عنوان ژن کنترل استفاده شد (جدول 1). واکنش­ها برای تمام پرایمرها در دمای اتصال 60 درجه سانتی گراد بهینه­سازی شدند. سطح بیان ژنهای مورد مطالعه در هر گروه تیمار، توسط روش محاسباتی 2-ΔΔCt   به‌دست آمد. نتایج حاصل با استفاده از آزمون آماری تحلیل واریانس یک طرفه بررسی شد.

 

جدول 1 - توالی پرایمرهای بررسی بیان ژن های پرتوانی

طول محصول(bp)

توالی پرایمر

ژن

151

F: 5'- GGGAAATGGGAGGGGTGCAAAAGAGG-3'

R:5'-TTGCGTGAGTGTGGATGGGATTGGTG -3'

SOX2

110

F: 5'- AAAGAATCTTCACCTATGCC -3

R: 5'- GAAGGAAGAGGAGAGACAGT -3'

NANOG

128

F: 5'- CTGGGTTGATCCTCGGACCT -3'

R: 5'-CACAGAACTCATACGGCGGG -3'

OCT4

153

F: 5'- ATTACCAAGAGCTCATGCCA -3

R: 5'- CCTTGAGATGGGAACTCTTTG -3'

KLF4

122

F: 5'- CTCATTTCCTGGTATGACAACGA -3

R: 5'- CTTCCTCTTGTGCTCTTGCT -3'

GAPDH

 

 

نتایج

در تعیین غلظت غیرسمی، برای داروی بورتزومیب فقط غلظت 01/0 میکرومولار، اختلاف معناداری با گروه شاهد نداشت (P>0.05). پاکلیتاکسل فقط در زمان 28 ساعت اختلاف معناداری با گروه شاهد نداشت (P>0.05)؛ در حالی‌که در زمانهای کمتر یا بیشتر، برای سلول سمی بود. برای لاپاتینیب فقط غلظت 2/0 میکرومولار اختلاف معناداری با گروه شاهد نداشت (P>0.05) (شکل 1).

 

شکل1- "انتخاب زمان و غلظت غیرسمی برای داروها". این انتخاب بر مبنای شرایطی که از نظر زنده مانی تفاوت معناداری با گروه کنترل نداشته باشد برای سه داروی برتزومیب(A)، پاکلیتاکسل(B) و لاپاتینیب(C) انجام شد. مواردی که با * مشخص شده­اند، دارای تفاوت معنادار بودند و آنهایی که باNS  مشخص شده­اند تفاوت معناداری مشاهده نشد.

 

در آزمون آلکالین فسفاتاز، سلولهای تیمارشده با غلظت و زمان انتخابی برای هریک از داروها همانند گروه شاهد، از نظر شکل رنگ گرفته و خاصیت بنیادینگی خود را حفظ کرده بودند. از نظر بیان ژنهای پرتوانی (SOX2, KLF4، NANOG,OCT4) بین گروههای تیمار و شاهد اختلاف معناداری وجود نداشت (P>0.05)(شکل 2).

در هیچ یک از آزمونها، از نظر میزان سلولهای طبیعی، تفاوت آماری معناداری بین گروههای تیمار داروها با شاهدهای مربوطه مشاهده نشد (شکل 3). نمونه­ای از کاریوتایپ سلولهای  غیرطبیعی (48,XY,+12,+17) در شکل 4 نشان داده­شده­است.

 

شکل2- "مقایسه بیان ژنهای پرتوانی (SOX2,NANOG, KLF4، OCT4) بین گروههای تیمار و شاهد" . این مقایسه برای هیچ یک از داروها اختلاف معناداری نشان نداد(P>0.05).

شکل3- "مقایسه نرخ سلولهای طبیعی بین گروه شاهد و تیمار در سه آزمون طراحی شده" Aآزمون اول، :Bآزمون دوم، :Cآزمون سوم. در هیچ یک از آزمونها بین گروههای تیمار داروها با شاهدهای مربوطه، تفاوت آماری معناداری نشان نداد.

شکل 4- "نمونه­ای از کاریوتایپ سلولهای  غیرطبیعی" چنان­که ملاحظه می شود در این سلولها تریزومی های 12 و 17 دیده­می شود (48,XY,+12,+17).

 

بحث

سلولهای بنیادی از پتانسیل درمانی بالایی برخوردارند(2) اما برای این کاربرد، حفظ تمامیت کروموزومی اهمیت ویژه­ای در کشت آزمایشگاهی سلول خصوصاً سلولهای بنیادی جنینی دارد. یک مطالعه اخیر از کشت روی لایه سلولی تغذیه­کننده مانند فیبروبلاست در این راستا بهره برده است(11) اما آنچه نباید از نظر دور داشت این است که حفظ پرتوانی سلولهای بنیادی جنینی نباید تحت تأثیر شرایط کشت تضعیف شود. از آنجا که کشت بر بستر ماتریژل خصوصاً در محیط حاوی  KOSR در این راستا بسیار مناسب است، در این مطالعه ما از این شرایط استفاده شده است. آنوپلوئیدی به دنبال تغییر در تعادل ژنی منجر به تغییر گرایش تمایزی در سلولهای پرتوان(13) و تنشهای مختلف از جمله در سوخت­وساز و نیز تقسیم سلولی می­شود(29). در این مطالعه بررسی در رده سلولی دارای آنوپلوییدی‌های 12 و 17 انجام شد، زیرا تریزومی کروموزوم 12 و 17 به‌صورت همزمان در بسیاری از کشتهای hESCs گزارش شده است. تریزومی کروموزوم 12 یا ایزوکروموزوم بازوی کوتاه کروموزوم 12 در اثر وجود ژن NANOG که یکی از عوامل مؤثر رونویسی اصلی دخیل در پرتوانی است، برای hESCs به فراوانی گزارش شده است. این ناهنجاریها در لوسمی لنفوسیتی مزمن و تومورهای سلولهای زایای اسپرم مشاهده‌ می‌شود. تریزومی 17 نیز به‌دلیل استقرار مهار کننده آپوپتوز Survivin در hESCs به فراوانی گزارش شده است.  Survivinرا در توسعه سرطان روده بزرگ دخیل می‌دانند. انکوژن ERBB2  بر کروموزوم 17 واقع شده است. رابطه مستقیم بین شیوع تریزومی 17 با تعداد پاساژ در hESCs وجود دارد. این تغییرات، برای رشد و تکثیر به سلولهای دارای این ناهنجاریها مزیت انتخابی می‌بخشد. گاهی این ناهنجاریها ابتدا به‌صورت موزاییک مشاهده می­شوند، سپس به‌سرعت تمام جمعیت را در بر می‌گیرند (9). چنین وضعیتی در این مطالعه نیز به‌خوبی مشهود بود، به‌گونه‌ای که با وجود اینکه در تولید رده موزاییک تنها بیست درصد سلولها آنوپلویید بودند، حتی در گروه اول که کمترین تعداد پاساژ را تا زمان تهیه کاریوتایپ پشت‌سر گذاشت، فراوانی سلولهای آنوپلویید به‌شدت بر سلولهای طبیعی غالب شد.

حضور برخی تغییرات کروموزومی از جمله تریزومی 12 و 17 علاوه بر ایجاد مزیت رشد انتخابی می تواند با تومورزایی نیز در سلولهای پرتوان در ارتباط باشد(25) از این­رو مهار رشد انتخابی یا حذف hPSCs ناهنجار، می‌تواند برای تکثیر hPSCs در کشت ارزشمند باشد؛ بنابراین، با توجه به شواهد اشاره شده در مقدمه، سه دارو با سه سازوکار مختلف داروهای ضدسرطان در این مطالعه بررسی شد. در بررسی Ben-David و همکارانش در سال 2014، تأثیر 89 داروی ضدسرطان روی سلولهای بنیادی پرتوان انسانی دارای تریزومی 12 ارزیابی شد. hPSCs درطول کشت به کسب ناهنجاریهای ژنتیکی تمایل دارند که شایع‌ترین آنها، تریزومی کروموزوم 12 است. همچنین تریزومی 12 رایج‌ترین ناهنجاری کروموزومی در تومورهای سلولهای جنسی است. این بررسی نشان داد که تریزومی 12 به‌طور قابل توجهی بر الگوی بیان ژن hPSCs تأثیر می‌گذارد و آنها را از نظر رونویسی به تومورهای سلولهای جنسی شبیه می‌کند. نکته قابل توجه این است که از بین این89 دارو، تنها پنج دارو خاصیت مهاری بیشتری برای سلولهای آنوپلویید داشتند (5).

در این پژوهش، سلولهای تیمار شده با غلظتهای انتخابی سه داروی مورد بررسی از نظر کاریوتایپ، اختلاف معناداری با گروه شاهد نداشتند. با توجه به اینکه در مطالعه Ben-David و همکارانش نیز سلولهای دارای آنوپلوییدی 12  تنها به پنج دارو از مجموع 89 دارو حساس بوده‌اند، در مطالعه حاضر که تنها سه دارو مورد بررسی قرار گرفته‌اند، شاید چندان دور از انتظار نباشد. علاوه بر این، عوامل دیگری از جمله ماهیت متفاوت رده‌های مختلف سلولی همچنین وجود دو آنوپلوییدی شایع به‌صورت همزمان می­توانند در پاسخ به دارو موثر باشند. گروه این تحقیق در مطالعه‌ای جداگانه، به بررسی همین داروها در سلولهای بنیادی جنینی موشی موزاییک پرداختند که نتایج گویای کاهش آنوپلوییدی در آنها بود (14). در سال 2013 مطالعه‌ای انجام شد که تأثیر 64 داروی ضدسرطان را روی 53 لاین سرطان سینه بررسی کردند. محققان نشان دادند که تفاوت بین داروهای مؤثر و آنهایی که بی‌تأثیرند یا تفاوت بین سلولهای مقاوم و حساس به دارو، به زمان و غلظت انتخابی دارو ارتباط دارد. همچنین زمان دو برابر شدن سلول باید درنظر گرفته شود (16) چراکه در سلولهای بنیادی عامل مهمی در ارزیابی زنده­مانی و قدرت تقسیم به حساب می­آید (15).

در پژوهش حاضر پس از مشخص شدن غلظت و زمان مناسب برای هریک از داروها و با افزودن آنها به محیط، برای ارزیابی بنیادینگی در سلولهای تیمار شده مورفولوژی کلونیهای تیمار شده توسط میکروسکوپ فاز کنتراست بررسی شد و آزمون آلکالین فسفاتاز در سلولهای تیمارشده مثبت بود. همچنین در بیان ژنهای پرتوانی بین گروههای تیمار و شاهد، اختلاف معناداری مشاهده نشد؛ بنابراین، به‌نظر می‌رسد که غلظتهای انتخابی بر پرتوانی تأثیر منفی نداشته‌اند.

تشکر و قدردانی

این مطالعه حاصل از پایان‌نامه مصوب و مشترک بین پژوهشگاه رویان و دانشگاه شهید بهشتی است که با حمایت مالی پژوهشگاه رویان و ستاد توسعه علوم و فناوریهای سلولهای بنیادی، انجام شده است.

  • متولی باشی م، کوه کن ف، حجتی ز. 1392 نقش سلولهای بنیادی سرطانی در افزایش ریسک ابتلاء به متاستاز و کاهش میزان بقای افراد مبتلا به سرطان پستان. مجله پژوهش‌های سلولی و مولکولی مجله زیست شناسی ایران.26(3), pp. 365-377.
  • طالب زاده ع. 1398 پتانسیل درمانی سلولهای بنیادی. مجله زیست شناسی ایران. 44-55 ,(5)3 .

 

  • Amano, T., Jeffries, E., Amano, M., Ko, A.C., Yu, H. and Ko, M.S., 2015. Correction of Down syndrome and Edwards syndrome aneuploidies in human cell cultures. DNA Research, 22(5), pp.331-342.
  • Atkinson, S.P., Collin, J., Irina, N., Anyfantis, G., Kyung, B.K., Lako, M. and Armstrong, L., 2012. A putative role for the immunoproteasome in the maintenance of pluripotency in human embryonic stem cells. Stem cells, 30(7), pp.1373-1384.
  • Ben-David, U., Arad, G., Weissbein, U., Mandefro, B., Maimon, A., Golan-Lev, T., Narwani, K., Clark, A.T., Andrews, P.W., Benvenisty, N. and Biancotti, J.C., 2014. Aneuploidy induces profound changes in gene expression, proliferation and tumorigenicity of human pluripotent stem cells. Nature communications, 5(1), pp.1-11.
  • Blagosklonny, M.V., Giannakakou, P., El-Deiry, W.S., Kingston, D.G., Higgs, P.I., Neckers, L. and Fojo, T., 1997. Raf-1/bcl-2 phosphorylation: a step from microtubule damage to cell death. Cancer research, 57(1), pp.130-135.
  • Chen, L. and Madura, K., 2005. Increased proteasome activity, ubiquitin-conjugating enzymes, and eEF1A translation factor detected in breast cancer tissue. Cancer research, 65(13), pp.5599-5606.
  • Dobbelstein, M. and Moll, U., 2014. Targeting tumour-supportive cellular machineries in anticancer drug development. Nature reviews Drug discovery, 13(3), pp.179-196.
  • Draper, J.S., Smith, K., Gokhale, P., Moore, H.D., Maltby, E., Johnson, J., Meisner, L., Zwaka, T.P., Thomson, J.A. and Andrews, P.W., 2004. Recurrent gain of chromosomes 17q and 12 in cultured human embryonic stem cells. Nature biotechnology, 22(1), pp.53-54.
  • Fallahi-Sichani, M., Honarnejad, S., Heiser, L.M., Gray, J.W. and Sorger, P.K., 2013. Metrics other than potency reveal systematic variation in responses to cancer drugs. Nature chemical biology, 9(11), p.708.
  • Guo, R., Ye, X., Yang, J., Zhou, Z., Tian, C., Wang, H., Wang, H., Fu, H., Liu, C., Zeng, M. and Yang, J., 2018. Feeders facilitate telomere maintenance and chromosomal stability of embryonic stem cells. Nature communications, 9(1), pp.1-16.
  • Hegde, P.S., Rusnak, D., Bertiaux, M., Alligood, K., Strum, J., Gagnon, R. and Gilmer, T.M., 2007. Delineation of molecular mechanisms of sensitivity to lapatinib in breast cancer cell lines using global gene expression profiles. Molecular cancer therapeutics, 6(5), pp.1629-1640.
  • Keller, A., Dziedzicka, D., Zambelli, F., Markouli, C., Sermon, K., Spits, C. and Geens, M., 2018. Genetic and epigenetic factors which modulate differentiation propensity in human pluripotent stem cells. Human reproduction update, 24(2), pp.162-175.
  • Mirzaei-Seresht B, Bazrgar M, Masoudi NS, Mollammohamadi S, Kharazi F, Hassani SN et al., 2016. Correction of Chromosomal Abnormalities following Treatment of Mosaic Mouse Embryonic Stem Cells with Lapatinib and Paclitaxel. Cell Journal, 18 Suppl 1:48.
  • Oliyai, M., Abnosi, M. and Momeni, H.R., 2017. Myo-inositol at High Concentration Reduced Viability and Proliferation of Rat Bone Marrow Mesenchymal Stem Cells via Electrolyte Imbalance and Elevation of Aerobic Metabolism. Journal of Genetic Resources, 3(1), pp.18-25.
  • O’Neill, F., Madden, S.F., Aherne, S.T., Clynes, M., Crown, J., Doolan, P. and O’Connor, R., 2012. Gene expression changes as markers of early lapatinib response in a panel of breast cancer cell lines. Molecular cancer, 11(1), p.41.
  • Orr, G.A., Verdier-Pinard, P., McDaid, H. and Horwitz, S.B., 2003. Mechanisms of Taxol resistance related to microtubules. Oncogene, 22(47), pp.7280-7295.
  • Priyadarshini, K. and Keerthi, A.U., 2012. Paclitaxel against cancer: a short review. Med chem, 2(7), pp.139-141.
  • Rastogi, N. and Mishra, D.P., 2012. Therapeutic targeting of cancer cell cycle using proteasome inhibitors. Cell division, 7(1), p.26.
  • Srivastava, R.K., Srivastava, A.R., Korsmeyer, S.J., Nesterova, M., Cho-Chung, Y.S. and Longo, D.L., 1998. Involvement of microtubules in the regulation of Bcl2 phosphorylation and apoptosis through cyclic AMP-dependent protein kinase. Molecular and cellular biology, 18(6), pp.3509-3517.
  • Tang, Y.C., Williams, B.R., Siegel, J.J. and Amon, A., 2011. Identification of aneuploidy-selective antiproliferation compounds. Cell, 144(4), pp.499-512.
  • Wainberg, Z.A., Anghel, A., Desai, A.J., Ayala, R., Luo, T., Safran, B., Fejzo, M.S., Hecht, J.R., Slamon, D.J. and Finn, R.S., 2010. Lapatinib, a dual EGFR and HER2 kinase inhibitor, selectively inhibits HER2-amplified human gastric cancer cells and is synergistic with trastuzumab in vitro and in vivo. Clinical Cancer Research, 16(5), pp.1509-1519.
  • Wang, H., 2014. Lapatinib for the treatment of breast cancer in the People’s Republic of China. OncoTargets and therapy, 7, p.1367.
  • Wang, T.H., Wang, H.S. and Soong, Y.K., 2000. Paclitaxel‐induced cell death: where the cell cycle and apoptosis come together. Cancer: Interdisciplinary International Journal of the American Cancer Society, 88(11), pp.2619-2628.
  • Weissbein, U., Peretz, M., Plotnik, O., Yanuka, O., Sagi, I., Golan-Lev, T. and Benvenisty, N., 2019. Genome-wide Screen for Culture Adaptation and Tumorigenicity-Related Genes in Human Pluripotent Stem Cells. iScience, 11, pp.398-408.
  • Xia W et al. Regulation of survivin by ErbB2 signaling: therapeutic implications for ErbB2-overexpressing breast cancers. Cancer Res 2006; 66.31640-1647..
  • Xia, W., Bisi, J., Strum, J., Liu, L., Carrick, K., Graham, K.M., Treece, A.L., Hardwicke, M.A., Dush, M., Liao, Q. and Westlund, R.E., 2006. Regulation of survivin by ErbB2 signaling: therapeutic implications for ErbB2-overexpressing breast cancers. Cancer research, 66(3), pp.1640-1647.
  • Yao, F., Wang, G., Wei, W., Tu, Y., Tong, H. and Sun, S., 2012. An autophagy inhibitor enhances the inhibition of cell proliferation induced by a proteasome inhibitor in MCF-7 cells. Molecular medicine reports, 5(1), pp.84-88
  • Zhu, J., Tsai, H.J., Gordon, M.R. and Li, R., 2018. Cellular stress associated with aneuploidy. Developmental cell, 44(4), pp.420-431.