نوع مقاله : مقاله پژوهشی

نویسندگان

1 گروه ژنتیک و بیوتکنولوژی، دانشکده علوم زیستی، واحد ورامین- پیشوا، دانشگاه آزاد اسلامی، ورامین، ایران.

2 گروه زیست‌شناسی، دانشکده علوم زیستی، واحد ورامین- پیشوا، دانشگاه آزاد اسلامی، ورامین، ایران.

چکیده

گلومرولونفریت یک بیماری التهابی کلیوی است که توسط پاسخ های ایمنی ایجاد می‌شوند. در بسیاری از بیماری‌های التهابی اینفلامازوم‌ها نقش اساسی دارند. در واقع اینفلامازوم‌ها بخشی از سیستم ایمنی حاوی رسپتورها و سنسورها هستند که از طریق فعال کردن کاسپاز 1 باعث القای التهاب می‌شوند. مسیر اینفلامازوم‌ NPLR3 یکی از مسیرهای پاسخ های ایمنی می‌باشد که ژن‌های P2RX7 و IL-18 به ترتیب نقش گیرنده غشایی و فاکتور التهابی را بر عهده‌دارند. هدف از این پژوهش بررسی میزان بیان دو ژن مذکور در خون بیماران مبتلا به گلومرولونفریت و مقایسه آن با افراد سالم بود. ازاین‌رو نمونه‌ی خون افراد در دو گروه که هر گروه شامل 28 نفر بودند، جمع‌آوری و پس از تخلیص RNA و سنتز cDNA بیان دو ژن P2RX7 و IL-18 دخیل در اینفلامازوم‌ با روش Real Time PCR مورد بررسی قرارگرفت. نتایج نشان دادند که بیان ژن P2RX7 در افراد مبتلا به بیماری به میزان 7/0 برابر نسبت به افراد شاهد کاهش‌یافته بود. در مقابل ژن IL-18 به میزان 5 برابر نسبت به افراد شاهد افزایش‌یافته بود. این پژوهش مشخص کرد که ژن IL-18 نقش حیاتی در پاسخ التهابی این بیماری دارد ولی احتمالاً مسیر سیگنالینگ این بیماری در مسیری جدا از P2RX7 می‌باشد.

کلیدواژه‌ها

عنوان مقاله [English]

A comparative study on the expression of the P2RX7 and IL-18 genes in blood samples of Glomerulonephritis disorders and normal persons

نویسندگان [English]

  • Ayda Ghadri 1
  • fahimeh baghbani-arani 1
  • Maasoumeh Mahdavi-Ourtakand 2

1 Department of Genetics and Biotechnology, School of Biological Science, Varamin-Pishva Branch, Islamic Azad University, Varamin, Iran.

2 Department of Biology, School of Biological Science, Varamin-Pishva Branch, Islamic Azad University, Varamin, Iran.

چکیده [English]

Glomerulonephritis is acute inflammation of the kidney, caused by an immune response. In the many of inflammatory diseases, the inflammasome plays key role. The inflammasomes are innate immune system receptors and sensors that regulate the activation of caspase-1 and induce inflammation. NLRP3 inflammasome pathway is a main pathway during inflammatory responses. The IL-18 and P2RX7 genes are respectively, an inflammatory factor and membrane receptor. The aim of this study is evaluation of IL-18 and P2RX7 genes expression in the glomerulonephritis patients and healthy individuals (control group) to determine the role of inflammasome in glomerulonephritis. Therefore, the blood samples of both groups (each group contains 28 samples) were collected. then the expression of the IL-18 and P2RX7 genes was studied by Real-Time PCR technique. The results indicated that expression of P2RX7 gene decreased at about 70% in comparison with the control group. In contrast, expression of IL-18 gene increased at about 5 fold in comparison with control. This study revealed that the IL-18 gene has a critical role in the inflammatory response of glomerulonephritis but its signaling pathway is independence from P2RX7 pathway.

کلیدواژه‌ها [English]

  • Glomerulonephritis
  • IL-18
  • P2RX7
  • Inflammasome

بررسی بیان ژنهای P2RX7 و IL-18 در نمونه خون افراد مبتلا به بیماری گلومرولونفریت و مقایسه آن با افراد سالم

آیدا قدری1، فهیمه باغبانی آرانی1* و معصومه مهدوی اورتاکند2

1 ایران، ورامین، دانشگاه آزاد اسلامی، واحد ورامین- پیشوا، دانشکده علوم زیستی، گروه ژنتیک و بیوتکنولوژی

2 ایران، ورامین، دانشگاه آزاد اسلامی، واحد ورامین- پیشوا، دانشکده علوم زیستی، گروه زیست‌شناسی

تاریخ دریافت: 15/5/97                تاریخ پذیرش: 25/10/97

چکیده

گلومرولونفریت یک بیماری التهابی کلیوی است که توسط پاسخهای ایمنی ایجاد می‌شوند. در بسیاری از بیماریهای التهابی اینفلامازومها نقش اساسی دارند. در واقع اینفلامازومها بخشی از سیستم ایمنی حاوی رسپتورها و سنسورها هستند که از طریق فعال کردن کاسپاز 1 باعث القای التهاب می‌شوند. مسیر اینفلامازوم‌ NPLR3 یکی از مسیرهای پاسخهای ایمنی می‌باشد که ژنهای P2RX7 و IL-18 به ترتیب نقش گیرنده غشایی و فاکتور التهابی را بر عهده‌دارند. هدف از این پژوهش بررسی میزان بیان دو ژن مذکور در خون بیماران مبتلا به گلومرولونفریت و مقایسه آن با افراد سالم بود. ازاین‌رو نمونه خون افراد در دو گروه که هر گروه شامل 28 نفر بودند، جمع‌آوری و پس از تخلیص RNA و سنتز cDNA بیان دو ژن P2RX7 و IL-18 دخیل در اینفلامازوم‌ با روش Real Time PCR مورد بررسی قرارگرفت. نتایج نشان دادند که بیان ژن P2RX7 در افراد مبتلا به بیماری به  میزان 7/0 برابر نسبت به افراد شاهد کاهش‌یافته بود. در مقابل ژن IL-18 به میزان 5 برابر نسبت به افراد شاهد افزایش‌یافته بود. این پژوهش مشخص کرد که ژن IL-18 نقش حیاتی در پاسخ التهابی این بیماری دارد ولی احتمالاً مسیر سیگنالینگ این بیماری در مسیری جدا از P2RX7 می‌باشد.

واژه های کلیدی: گلومرولونفریت، ژن P2RX7، ژن IL-18 و اینفلامازوم

* نویسنده مسئول، تلفن: ۳۶۷۲۵۰۱۱- 021، پست الکترونیکی: f[email protected]

مقدمه

 

گلومرولونفریت یک بیماری کلیوی است که براثر التهاب شبکه‌های مویرگی موجود در کلیه‌ها به نام گلومرولها به وجود می‌آید. در حال حاضر سرکوب غیراختصاصی سیستم ایمنی بدن یکی از راهکارهای درمانی این بیماری به شمار می‌رود که اثرات جانبی فراوانی دارد. در برخی موارد آنتی‌بادیها یا پادتنهایی که برای ایمنی بدن در مقابل عوامل خارجی مانند برخی از عفونتها و یا آسیبهای بافتی تولید می‌شوند موجب التهاب گلومرولها می‌گردند (6).

از آنجائی که بیماری گلومرولونفریت یک بیماری التهابی می‌باشد، می‌تواند با مسیرهای مولکولی در بیماریهای التهابی، مرتبط باشد. اینفلامازومها گیرنده‌های داخل سلولی (سیتوزولی) هستند که توانایی شناسایی پاتوژنهای میکروبی و سیگنالهای خطرناک درون‌زاد حاصل از استرس یا آسیب سلولی را دارند. کمپلکس  اینفلامازوم‌ بعد از تشکیل باعث فعال شدن پروتئازی به نام کاسپاز یک می‌شود و آن نیز باعث فعال کردن فاکتورهای پیش التهابی مانند اینترلوکین یک و 18 خواهد شد. بنابراین فعالیت اینفلامازوم باعث فراخوانی سلولهای ایمنی مانند ماکروفاژها به بافت موردنظر شده که می‌تواند پاسخهای التهابی زیادی را وساطت نماید (2 و 15).

NLRP3 یک اینفلامازوم است که در بسیاری از بیماریهای عفونی فعال و موجب پاسخهای التهابی می‌شود. بیش تنظیمی اینفلامازوم NLRP3  و پرواینترلوکین-1 بتا (IL-1β) به وسیله عوامل نسخه‌برداری NF-kB در طی پاسخ به سیتوکینهای خارجی و همچنین عوامل میکروبی مشاهده‌ شده است. از طرف دیگر عواملی همچون برخی از محرکها مانند ATP و RNAی ویروسی، اینفلامازوم NLRP3 را فعال می‌کنند. بسیاری از محرکهای فعال‌سازی NLRP3 موجب خروج یونهای پتاسیم از سلول می‌شوند که برای فعال‌سازی NLRP3 ضروری می‌باشد. همه این عوامل موجب تبدیل پرو اینترلوکینهای 1-بتا و 18 به اینترلوکینهای 1- بتا و 18 می‌شوند که متعاقباً موجب پاسخهای التهابی در بدن بیمار خواهند شد (13).

P2X7 یک گیرنده غشایی می باشد که در سلولهای ایمنی به فراوانی وجود دارد. وقتی لیگاند به P2X7 متصل می‌شود این گیرنده باعث راه‌اندازی چندین آبشار سیگنالی پایین‌دست خواهد شد که این سیگنالهای داخل سلولی می‌توانند باعث تشکیل گونه‌های فعال اکسیژن (ROS)، فعال‌سازی پروتئازها و آنزیمها، آزاد کردن پروتئوگلاندینها، انتشار گلوتامات به خارج سلول، فعال کردن بسیاری از فاکتورهای رونویسی، تکثیر سلول، فاگوسیتوز و غیره شود (5). با توجه به عملکردهای مختلف، P2X7 نقش مهمی در شرایط بیماری و سلامت بر عهده دارد. تاکنون نقش این ژن در بیماریهای مختلفی مانند آلزایمر، هانتینگتون، ایسکمی، التهاب، ، گلومرولونفریتها و سرطان گزارش‌شده است (4). یکی از مهم‌ترین عملکردهای P2X7، نقش آن در تنظیم ترشح IL-1β و IL-18 می‌باشد که این عمل را با فعال کردن کمپلکس اینفلامازومی NLRP3 انجام می‌دهد. فعال شدن گیرنده P2X7 با ATP خارج سلولی (که براثر عواملی مختلفی مانند بیماری‌زایی ایجاد می‌شود) باعث باز شدن کانال یونی پانکسین 1 می‌شود که منجر به ورود Ca2+ و Na+ به داخل سلول و خروج K+ از سلول می‌گردد. این تغییرات منجر به فعال شدن چندین مسیر داخل سلولی می‌گردد. کاهش غلظت پتاسیم داخل سلولی باعث فعال شدن کمپلکس اینفلامازوم و به دنبال آن کاسپاز یک  می‌شود که این پروتئاز باعث تبدیل pro-IL-1β و pro-IL-18 به IL-1β و IL-18 فعال می‌شود. اینترلوکینهای 1β و 18 توسط سلولها به خارج سلول ترشح‌شده و می‌تواند پاسخ التهابی را ایجاد کنند (4، 7 و 16).

اینترلوکین ۱۸ به عنوان فاکتور القاکننده اینترفرون گاما شناخته می‌شود. این پروتئین متعلق به سوپر خانواده اینترلوکین یک می‌باشد. اینترلوکین ۱۸ در فرم بیولوژیکی به صورت یک پـیش ساز غیرفعال ساخته‌شده و بعد از اینکه به وسیله کاسپاز ۱ یا دیگر کاسپازها شکسته شد به فـرم فعـال تبدیل می‌شود. به‌طورکلی اینترلوکین ۱۸ می‌تواند بر روی سلولهای T کمکی نوع یک، سلولهای کشنده طبیعی، سلولهای B و سلولهای دندریتیک اثر کرده و این سلولها را در حضور اینترلوکین ۱۲ وادار به تولید اینترفـرون گامـا نمایـــد. ازآنجایی‌که اینترلوکین 18 می‌تواند پاسخهای التهابی شدیدی را ایجاد کند، نقش مهمی در بی‌نظمیهای التهابی بر عهده دارد (9).

از آنجایی که گلومرولونفریت یک بیماری التهابی است، می‌تواند با برخی از عواملی که موجب بروز پاسخهای التهابی می‌شوند در ارتباط باشد. ازاین‌رو درک بهتر مکانیسمهای مولکولی درگیر در مسیر بروز پاسخهای التهابی، می‌تواند افقهای جدیدی در درمان این بیماریها داشته باشد. لذا در این پژوهش فرض بر این شد که در یک مسیر سیگنالینگ پاسخ التهابی، شناسایی عوامل موجود در ابتدا (گیرنده‌های سلولی) و انتهای مسیر (عوامل بروز پاسخ التهابی) و بررسی بیان ژنهای مرتبط با این عوامل می‌تواند مکانیسم بروز پاسخهای التهابی را آشکار سازد. هدف از این پژوهش بررسی بیان ژن P2RX7 (که یک گیرنده می‌باشد) و IL-18 (که یک اینترلوکین است و موجب پاسخ التهابی می‌شود) در بیماران مبتلا به بیماری کلیوی گلومورنفریت و مقایسه آن با افراد سالم بود.

مواد و روشها

جامعه آماری: جمعیت مورد مطالعه در این تحقیق 56 نفر، شامل 28 نفر بیمار مبتلا به گلومرولونفریت و 28 نفر افراد نرمال (عدم ابتلا به گلومرولونفریت) بودند. برای نمونه‌گیری ابتدا اطلاعات پرسشنامه‌ای بیماران مورد نظر بررسی و جهت مطالعات بعدی رضایت‌نامه کتبی از آنها گرفته‌ شد. بعد از جمع‌آوری نمونه‌ها، متخصص اورولوژی صحت آنها را تأیید کرد. اطلاعات مربوط به C-reactive protein (CRP) که بیانگر التهاب می‌باشد از پرونده بیماران استخراج گردید.

نمونه‌گیری: در ابتدا از افراد مورد مطالعه 5 میلی‌لیتر خون محیطی گرفته شد. نمونه‌های جمع‌آوری‌شده بلافاصله برای آنالیز به آزمایشگاه منتقل شدند. به منظور استخراج PBMC  ابتدا بر روی دو میلی‌لیتر خون مقدار دو میلی‌لیتر PBS اضافه و بخوبی مخلوط گردید. سپس به هر نمونه سه میلی‌لیتر فایکول افزوده و به مدت 25 دقیقه با دور g 2300 سانتریفیوژ شد. نمونه حاضر بعد از سانتریفیوژ به ترتیب از پایین به بالا شامل خون، فایکول، PBMC و پلاسما می‌باشد (11)

استخراج RNA و سنتز cDNA: استخراج RNA از سلولهای خونی  با استفاده از ترایزول و طبق پروتکل استاندارد صورت پذیرفت (10). برای بررسی کمیت و کیفیت RNA استخراج‌شده، میزان جذب نوری آن  با استفاده از دستگاه نانودراپ (کیاژن) در دو طول‌ موج 260 و 280 نانومتر سنجش و نسبت جذب نوری در 260 به 280 نانومتر محاسبه گردید. همچنین برای بررسی کیفیت RNA استخراج‌ شده، مقدار 3 میکرولیتر از نمونه‌ها در ژل آگارز 1 درصد با ولتاژ 100 ولت الکتروفورز گردید. وجود باندهای s18 و s28 مربوط به ‌RNA ریبوزومی به ترتیب در موقعیتهای 800 و 1500 نشان‌دهنده کیفیت خوب RNA استخراج‌شده بود.

‌به منظور سنتز cDNA، ابتدا RNA استخراج‌شده با آنزیم DNase I (محصول شرکت فرمنتاز) تیمار و سپس حجم نهایی به 10 میکرولیتر رسانده و به مدت 30 دقیقه در دمای 37 درجه سانتی‌گراد انکوبه شد. جهت سنتزcDNA از کیت PrimScript RT reagent شرکت تاکارا استفاده شد. مقدار دو میکرولیتر بافر X5 PrimeScript™، 5/0 میکرولیتر آنزیم PrimeScript™ RT، 5/0 میکرولیتر پرایمر الیگو dT و 5/0 نانوگرم RNA باهم مخلوط و حجم نهایی با آب عاری از RNase به 10 میکرولیتر رسانده شد. جهت شروع نسخه‌برداری معکوس، نمونه به مدت 15 دقیقه در دمای 37 درجه سانتی‌گراد نگهداری و سپس با استفاده از تیمار حرارتی (85 درجه سانتی‌گراد به مدت 5 ثانیه) آنزیم نسخه‌برداری معکوس غیرفعال گردید. نمونه‌ها تا زمان انجام PCR در دمای 20- درجه سانتی‌گراد نگهداری شدند.

واکنش Real-Time PCR : برای طراحی پرایمرهای اختصاصی موردنظر، ابتدا توالی ژنهای P2RX7 و (Interluekin 18) IL-18 از سایت NCBI به دست آمد و سپس با استفاده از نرم‌افزار ABI طراحی پرایمر انجام گردید (جدول 2). به منظور بررسی اختصاصی بودن پرایمرهای طراحی‌شده، پرایمرهای با نرم‌افزار Primer BLAST در سایت NCBI مورد بررسی قرار گرفتند.

برای انجام واکنش RT-PCR ابتدا برنامه زمانی واکنش طراحی و سپس دستگاه ترموسایکلر (ABI 7500, USA) مطابق برنامه تنظیم گردید. اجزای واکنش تکثیر در حجم نهایی 5/1 میکرولیتر شامل 5/7 میکرولیتر سایبرگرین، 1 میکرولیتر (10 پیکو مول) آغازگرهای واکنش، 3 میکرولیتر (10 نانو گرم) از cDNA های سنتز شده و 5/3 میکرولیتر آب مقطر بوده است. برنامه حرارتی تکثیر ژنهای ZEB1 و GAPDH به شرح مقابل است: 1 چرخه در دمای 95 درجه سانتی‌گراد به مدت 30 ثانیه برای واسرشته سازی اولیه،40 چرخه در دمای 95 درجه به مدت 15 ثانیه برای اتصال پرایمرها و 40 چرخه در دمای 60 درجه سانتی‌گراد برای تکثیر.

 

جدول 2- توالی پرایمر ژنهای P2X7، IL-18 و GAPDH

اندازه قطعه تکثیر در PCR

توالی

نام ژن

246 bp

F: GCATCACCACCTCAGAGCTGT

R: ACTGCCCTTCACTCTTCGGAA

P2X7

60 bp

F: TGACCAAGTTCTCTTCATTGACCA

R:CTCACACTTCACAGAGATAGTTACAGCC

IL-18

74 bp

F: CCCACTCCTCCACCTTTGAC

R: CATACCAGGAAATGAGCTTGACAA

GAPDH

 

برای تأیید نهایی محصولات RT-PCR از آنالیز منحنی ذوب استفاده گردید .همچنین برای بررسی نتایج بیان این ژنها بین گروه بیمار و کنترل از نرم‌افزار  REST   بر مبنای فرمول-ΔΔ2  2استفاده شد .

تمام آنالیزهای آماری این پروژه با استفاده از نرم‌افزار Microsoft Excel 2010 و  SPSS ver.22 انجام شد. به منظور آنالیز نتایج ‌به دست ‌آمده، از تستهای ANOVA و T-test استفاده شد. در تمامی موارد، مقدار p کمتر از 05/0 به عنوان اختلاف معنی‌دار درنظرگرفته شد.

نتایج

مشخصات نمونه ها: در این مطالعه 56 نفر در دو گروه کنترل سالم  (28 نفر) و افراد بیمار (28 نفر) بررسی گردیدند.از نظر جنسیتی، افراد گروه شاهد شامل 18 نفر زن و 10 نفر مرد و افراد گروه مبتلا به بیماری شامل 14 نفر زن و 14 نفر مرد بودند. مشخصات شاخص CRP هر دو گروه در جدول 1 ارایه شده است.

جدول 1- پراکندگی میزان CRP و سن در نمونه‌های موردمطالعه

بیمار

کنترل

پارامتر

71/2±285/11

42/1±46/4

CRP

53/13±57/39

31/10±46/39

سن

آنالیز منحنی ذوب در واکنش Real Time PCR: نمودار آنالیز ذوب برای هر یک از ژنها نشان داد که برای هر ژن تنها یک پیک وجود دارد (شکل 1). وجود یک پیک برای هر ژن در نقطه ذوب، نشان‌دهنده عدم آلودگی، وجود محصول غیراختصاصی و دایمر پرایمر می‌باشد.

 

 

شکل 1- منحنی ذوب در واکنش Real Time PCR برای هر یک از ژنها: الف) P2RX7 ب) IL-18 و ج) GAPDH


بیان ژنهای P2RX7و IL-18  : بیان ژنهای هدف برای همه نمونه‌های مورد آزمایش مثبت بود. به عبارتی همه نمونه‌ها بیان ژنهای P2RX7، IL-18 و GAPDH را نشان دادند. ژن GAPDH به عنوان نمونه مناسبی از کنترل داخلی استفاده‌شده بود که بر اساس بیان این ژن، بیان نسبی ژنهای هدف با استفاده از رابطه Ct ΔΔ محاسبه گردید.

نتایج مربوط به بیان ژنهای P2RX7و IL-18نشان داد که ژن P2RX7در بیماران مبتلا به گلومرولونفریت ‌به صورت معنی‌دار (p≤0.05) و به‌اندازه 70 درصد نسبت به افراد سالم (شاهد) کاهش‌یافته بود (شکل 2). در مقابل ژن IL-18 در افراد مبتلا به بیماری گلومرولونفریت به‌اندازه 5 برابر نسبت به افراد سالم افزایش‌یافته بود (p≤0.05) (شکل 3).

 

شکل 2- بیان ژن P2RX7 در دو گروه بیماران به گلومرولونفریت و افراد سالم

 

 

شکل 3- بیان ژن IL-18 در دو گروه بیماران به گلومرولونفریت و افراد سالم

 

بحث

گلومرولونفریت، التهاب گلومرولها در کلیه‌ها می‌باشد که کار اصلی این گلومرولها انتقال مایعات اضافی، الکترولیتها و مواد زائد از جریان خون به ادرار است. این بیماری ممکن است حاد باشد و به صورت حمله التهابی بروز کند. التهاب شدید و طولانی‌مدت در ارتباط با گلومرولونفریت باعث آسیب به کلیه‌ها می‌شود. چند سال اخیر مطالعات بسیار زیادی بر روی بیماریهای التهابی جهت تعیین مکانیسم آن انجام‌یافته است. یکی از مسیرهای مولکولی که در التهاب موردتوجه قرارگرفته است کمپلکس اینفلامازوم می‌باشد. مشخص‌شده است که اغلب بیماریهای التهابی با کمپلکس اینفلامازوم در ارتباط هستند؛ بنابراین احتمال وجود نقش این کمپلکس در التهابهای بیماران گلومرولونفریت وجود دارد (3).

از آنجایی که بیماری گلومرولونفریت نیز یک بیماری التهابی می‌باشد و نقش گیرنده P2X7 و ارتباط آن با اینفلامازومها و فاکتورهای التهابی در ایجاد بیماریهای التهابی شناخته‌شده است، چنین فرض شده بود که این دو ژن احتمالاً در بیماری گلومرولونفریت و ایجاد پاسخهای التهابی در طی این بیماری نقش به سزایی دارند.

نتایج آزمایشها بیان ژن در دو گروه بیمار و افراد سالم نشان داد که بیان ژن P2X7 در بیماران مبتلا به گلومرولونفریت نه‌تنها افزایش نیافته، بلکه به شدت کاهش‌یافته بود. نتایج حاضر مشخص نمود که احتمالاً گیرنده‌های غشایی دیگری در طی بیماری گلومرولونفریت نقش دارند و مسیر دیگری مستقل از P2X7 برای راه‌اندازی پاسخهای التهابی در این بیماری وجود دارد. با این‌حال مشخص گردید که مسیر پاسخ التهابی در این بیماری به فاکتور اینترلوکین 18 منتهی می‌شود و نقش این فاکتور در ایجاد پاسخ التهابی در بیماری گلومرولونفریت به وضوح مشخص گردید. بهرحال برخی از نتایج مربوط به پژوهشهای دیگر با نتایج این تحقیق همسو نبودند. در مطالعه‌ای مشخص‌شده است که در موشهای مبتلا به گلومرولونفریت mRNA‌های مربوط به ژن P2X7 نسبت به افراد شاهد افزایش‌یافته بود (1). یکی از دلایلی که می‌تواند عدم تطابق نتایج این تحقیق را با پژوهش‌ ذکرشده توجیه کند، احتمالاً مدل حیوانی متفاوت در دو مطالعه می‌باشد. همچنین برخی از تحقیقات پیشین نشان داده‌اند که در بیماریهای التهابی بیان ژن IL-18 افزایش‌یافته است. اکثر این پژوهشها تأیید کننده نتایج پژوهش حاضر می‌باشند (در مورد ژن IL-18). به‌عنوان‌مثال، در پژوهشی نقش فعالیت کمپلکس اینفلامازوم NLRP3 در سلولهای تک‌هسته‌ای محیطی بیماران همودیالیزی کلیوی، مشخص‌شده است که بیان ژن اینترلوکین 18 در افراد بیمار نسبت به افراد شاهد افزایش‌یافته است. نتایج این پژوهش مشخص کرده است که اینترلوکین 18 نقش به سزایی در التهاب شدید بیماران کلیوی دارد (8).  نقش اینترلوکین 18 در ایجاد بیماری کلیوی در موشها نیز مورد بررسی قرارگرفته و مشخص‌شده است که در جهش‌یافته‌هایی که فاقد ژن IL-18 بودند، کلیه‌ها عملکرد بهتری نسبت افراد شاهد از خود نشان می‌دهند (12). همچنین افزایش بیان ژن IL-18  بهمراه یک ژن دیگر موجب القای تکثیر و نفوذ سلولهای التهابی و پیشرفت بیماری و متعاقباً آسیب به کلیه‌ها می‌شود (1). نقش IL-18 در التهاب گلومورونفریت ثابت‌شده است ‌به طوری‌که افزایش بیان ژن IL-18 موجب پیشرفت بیماری و آسیب بیشتر به کلیه‌ها می‌گردد (14).

نتایج پژوهش حاضر مشخص کرد که اگرچه ژن IL-18 در بیماران مبتلا به گلومرولونفریت در مقایسه با افراد شاهد به شدت بیان می‌شود ولی شاید نتواند ‌به عنوان مشخصه فعالیت اینفلامازوم باشد. با این‌حال استفاده فاکتورهای بازدارنده IL-18 می‌تواند در کاهش اثرات آن بر بیماریهای التهابی بسیار مفید باشد. در همین راستا، تحقیقات بیشتر می‌تواند مسیرهای سیگنالینگ و همچنین گیرنده‌های اختصاصی این بیماری را مشخص نماید.

نتیجه‌گیری

نتایج پژوهش حاضر مشخص کرد که فاکتور IL-18 نقش مهمی در بیماری گلومرولونفریت دارد زیرا در بیماران مبتلا به این بیماری در مقایسه با افراد شاهد به شدت بیان‌شده بود. در مقابل ژن P2RX7 نه‌تنها در این بیماران بیش بیانی نداشت بلکه روند کاهشی نشان داد که نشان‌دهنده‌ این بود که این ژن دخیل در سیگنالینگ اینفلامازوم در این بیماری نقش ندارد. البته درک بهتر نقش این ژن در این بیماری نیازمند مطالعه بیشتر می‌باشد.

1-      Bartlett R, Stokes L, Sluyter R. 2014. The P2X7 Receptor Channel: Recent Developments and the Use of P2X7 Antagonists in Models of Disease. Pharmacol Rev 66(3):638–75.
2-      Cassel SL, Sutterwala FS. 2010.Sterile inflammatory responses mediated by the NLRP3 inflammasome. 40, European Journal of Immunology 40; 607–11.
3-      Garcia GE, Xia Y, Ku G, Johnson RJ, Wilson CB, Feng L. 2003. IL-18 translational inhibition restricts IFN-γ expression in crescentic glomerulonephritis. Kidney Int 64(1):160–9.
4-      Granata S, Masola V, Zoratti E, Scupoli MT, Baruzzi A, Messa M, et al. 2015.NLRP3 inflammasome activation in dialyzed chronic kidney disease patients. PLoS One 10(3): e0122272.
5-      He Y, Franchi L, Nunez G.2013. TLR Agonists Stimulate Nlrp3-Dependent IL-1 Production Independently of the Purinergic P2X7 Receptor in Dendritic Cells and In Vivo. J Immunol 190(1):334–9.
6-      He Y, Hara H, Núñez G. 2016. Mechanism and regulation of NLRP3 inflammasome activation. Trens Biochem Sci 41(12): 1012-1021.
7-      Kitching AR. 2005. IL-12p40 and IL-18 in Crescentic Glomerulonephritis: IL-12p40 is the Key Th1-Defining Cytokine Chain, Whereas IL-18 Promotes Local Inflammation and Leukocyte Recruitment. J Am Soc Nephrol 16(7):2023–33.
8-      Miller CM, Boulter NR, Fuller SJ, Zakrzewski AM, Lees MP, Saunders BM, et al. 2011. The role of the P2X7 receptor in infectious diseases. PLoS Pathog 7(11):e1002212.
9-      Okamura H, Tsutsui H, Kashiwamura S-I, Yoshimoto T, Nakanishi K. 1998. Interleukin-18: A Novel Cytokine That Augments Both Innate and Acquired Immunity. In: Advances in Immunology. Academic Press  281–312.
10-   Peirson SN, Butler JN. 2007. RNA Extraction from Mammalian Tissues. In: Methods in molecular biology 315–27.
11-   Puren AJ, Fantuzzi G, Dinarello CA. 1999. Gene expression, synthesis, and secretion of interleukin 18 and interleukin 1 are differentially regulated in human blood mononuclear cells and mouse spleen cells. Proc Natl Acad Sci. 96(5):2256–61.
12-   Schroder K, Tschopp J. 2010. The Inflammasomes. Cell. Cell Press 140; 821–32.
13-   Schwarz N, Drouot L, Nicke A, Fliegert R, Boyer O, Guse AH, et al. 2012. Alternative splicing of the N-terminal cytosolic and transmembrane domains of P2X7 controls gating of the ion channel by ADP-ribosylation. Zhang Z, editor. PLoS One 7(7): e41269.
14-   Strowig T, Flavell RA. 2012. Inflammasomes in inflammatory bowel disease. In: Crohn’s Disease and Ulcerative Colitis: From Epidemiology and Immunobiology to a Rational Diagnostic and Therapeutic Approach 111–8.
15-   Turner CM, Tam FWK, Lai P-C, Tarzi RM, Burnstock G, Pusey CD, et al. 2007. Increased expression of the pro-apoptotic ATP-sensitive P2X7 receptor in experimental and human glomerulonephritis. Nephrol Dial Transplant 22(2):386–95.
16-   Wu H, Craft ML, Wang P, Wyburn KR, Chen G, Ma J, et al. 2008. IL-18 Contributes to Renal Damage after Ischemia-Reperfusion. J Am Soc Nephrol. American Society of Nephrology 19(12):2331–41.