نوع مقاله: مقاله پژوهشی

نویسندگان

1 دانشگاه ارومیه، گروه اصلاح و بیوتکنولوژی گیاهی

2 دانشگاه ارومیه

چکیده

آنتی‌بادی‌های مونوکلونال هترودایمرهای متشکل از چهار زنجیره پپتیدی، دو زنجیره سبک (L) یکسان و دو زنجیره سنگین (H) یکسان هستند. بیان همزمان مقدار برابر ژن‌های رمز کننده برای تولید پایدار و گردایش به صورت یک آنتی‌بادی کارکردی ضروری است. به منظور بیان هم‌زمان چندین ژن، سیستم‌های مختلفی از جمله وکتورهای مبتنی بر جایگاه میانی ورود ریبوزوم (IRES) توسعه یافته‌اند. در مطالعه حاضر، یک حامل دی‌سیسترونیک برای بیان هم‌زمان ژن‌های رمز کننده زنجیره‌های سنگین و سبک آنتی‌بادی ضد سرطان سینه trastuzumab (Herceptin®) با استفاده از توالی IRES از فاکتور پروتئین شوک حرارتی-1 Nicotiana tabacum (NtHSF1) ساخته شد. کارایی دستواره در Nicotina tabacum به روش آگرواینفیلتراسیون ارزیابی شد. بیان دی‌سیسترونیک تراژن‌ها در سطح رونوشت RNA با آنالیز RT-PCR نیمه کمّی مشخص شد. آنالیز وسترن بلات بیان کارآمد فرم تترامر trastuzumab را در بافت برگی توتون مورد تایید قرار داد و محتوی آنتی‌بادی 7 روز پس از اینفیلتراسیون 44/0 درصد پروتئین کل محلول برآورد شد. نتایج مطالعه حاضر نشان دهنده کارایی عناصر IRES گیاهی برای بیان دی‌سیسترونیک پروتئین‌های هترومولتی‌مر در گیاهان است.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Bicistronic expression of the genes encoding the trastuzumab monoclonal antibody in tobacco using an internal ribosome entry site sequence

نویسنده [English]

  • Morad Jafari 1

چکیده [English]

Monoclonal antibodies are heterotetramers consisting of four peptide chains—two identical light (L) chains and two identical heavy (H) chains and simultaneous equimolar expression of the corresponding genes is required to stable produce and assembly into a functional antibody. In order to co-express of multiple genes, different systems have been developed such as internal ribosome entry site (IRES) based vectors. IRES sequences are genetic elements that can drive cap-independent translation initiation of cistrons located downstream of the element. In this study, we constructed a bicsitronic vector for co-expression of genes encoding the H and L chains of the anti-breast cancer antibody trastuzumab (Herceptin®) using an IRES sequence derived from the Nicotiana tabacum heat-shock factor 1 (NtHSF1). The effectiveness of construction was evaluated in Nicotina tabacum using agroinfiltration method. Bisictronic expression of transgenes at the RNA transcription level was detected by semi-quantitative RT-PCR analysis. Western blot analyses revealed the efficient accumulation of tetrameric form of trastuzumab in tobacco leaf tissues and antibody content were ca. 0.44% of total soluble protein within 7 days after infiltration. The results of this study demonstrate the efficacy of a plant derived IRES element for bicistronic expression of heteromultimeric proteins.

کلیدواژه‌ها [English]

  • monoclonal antibody trastuzumab
  • bicistronic expression
  • tobacco heat-shock factor-1
  • internal ribosomal entry site (IRES)

بیان دو سیسترونی ژنهای رمز کننده آنتی‌بادی مونوکلونال trastuzumab در توتون با استفاده از یک توالی جایگاه میانی ورود ریبوزوم

مراد جعفری2,1* و مریم احساسات وطن1

1 ارومیه، دانشگاه ارومیه، دانشکده کشاورزی، گروه اصلاح و بیوتکنولوژی گیاهی

2 ارومیه، دانشگاه ارومیه، پژوهشکده زیست‌فناوری، گروه بیوتکنولوژی کشاورزی

تاریخ دریافت:12/1/94                 تاریخ پذیرش: 3/7/94

چکیده

آنتی‌بادیهای مونوکلونال هترودایمرهای متشکل از چهار زنجیره پپتیدی، دو زنجیره سبک (L) یکسان و دو زنجیره سنگین (H) یکسان هستند. بیان همزمان مقدار برابر ژنهای رمز کننده برای تولید پایدار و گردایش به صورت یک آنتی‌بادی کارکردی ضروری است. به منظور بیان همزمان چندین ژن، سیستمهای مختلفی از جمله وکتورهای مبتنی بر جایگاه میانی ورود ریبوزوم (IRES) توسعه یافته‌اند. در مطالعه حاضر، یک حامل دی‌سیسترونیک برای بیان همزمان ژنهای رمز کننده زنجیره‌های سنگین و سبک آنتی‌بادی ضد سرطان سینه trastuzumab (Herceptin®) با استفاده از توالی IRES از فاکتور پروتئین شوک حرارتی-1 توتون (Nicotiana tabacum) (NtHSF1) ساخته شد. کارآیی دستواره در توتون به روش آگرواینفیلتراسیون ارزیابی شد. بیان دی‌سیسترونیک تراژنها در سطح رونوشت RNA با آنالیز RT-PCR نیمه کمّی تشخیص داده شد. آنالیز وسترن بلات بیان کارآمد فرم تترامر trastuzumab را در بافت برگی توتون مورد تأیید قرار داد و محتوی آنتی‌بادی 7 روز پس از اینفیلتراسیون 44/0 درصد پروتئین کل محلول برآورد شد. نتایج مطالعه حاضر نشان دهنده کارآیی عناصر IRES گیاهی برای بیان دی‌سیسترونیک پروتئینهای هترومولتی مر در گیاهان است.

واژه های کلیدی: آنتی‌بادی مونوکلونال trastuzumab، بیان دو سیسترونی، فاکتور شوک حرارتی-1 توتون، جایگاه‌ میانی ورود ریبوزوم (IRES) 

* نویسنده مسئول، تلفن: ۰۴۴۳۱۹۴۳۱۴۹، پست الکترونیکی: m.jafari@urmia.ac.ir

مقدمه


آنتی‌بادیهای نوترکیب یکی از ابزارهای زیستی بسیار پرکاربرد در تحقیقات، تشخیصها و درمان بسیاری از بیماریها از جمله سرطانها هستند. بیش از 30 درصد داروهای زیستی (Biopharmaceuticals) آنتی‌بادیهای نوترکیب هستند (39). بازار فروش جهانی آنتی‌بادیهای مونوکلونال یکی از بخشهای سریع رو به رشد صنعت داروسازی است. در سال 2013، فروش جهانی آنتی‌بادیهای مونوکلونال 75 میلیارد دلار بوده است و پیش بینی می­شود این رقم تا سال 2020 به 125 میلیارد دلار برسد (17). یکی از پرفروش‌ترین آنتی‌بادیهای نوترکیب، trastuzumab (Herceptin®) یک آنتی‌بادی مونوکلونال انسانی ضد HER2/Neu مورد استفاده در درمان سرطان پستان است که در سیستم پستانداری (سلولهای تخمدان همستر چینی، CHO) تولید می‌شود (21)، که بسیار گران‌قیمت می­باشد. کشاورزی مولکولی (Molecular farming) چشم‌اندازی نوین در حوزه بیوتکنولوژی برای تولید بیومولکولهای نوترکیب دارویی فراهم کرده است (2 و 6). پیشرفتهای اخیر در مهندسی ژنتیک گیاهی بیان و تولید پروتئینهای نوترکیب پیچیده مانند آنتی‌بادیهای مونوکلونال انسانی را در گیاهان نیز امکان‌پذیر ساخته است (40)، که عملکرد نسبتاً بالا، هزینه‌های بسیار پایین تولید و افزایش سریع مقیاس تولید از مهمترین مزایای سیستمهای گیاهی می‌باشد (1).

در بسیاری از موارد، تولید آنتی‌بادیهای IgG (Immunoglobulin G) شامل بیان حداقل دو ژن ‌می‌باشد. حتی در مواردی که آنتی‌بادیهای تک زنجیره‌ای در گیاهان بیان می‌شوند، بیان همزمان ژنهای چاپرونین‌های اختصاصی (پروتئین شوک حرارتی، ایزومرازهای دی‌سولفات پروتئین) برای تا خوردگی و تجمع فرم صحیح آنتی‌بادی همراه با ژن‌ رمزکننده آنتی‌بادی بسیار مفید خواهد بود (46). استفاده از راهکار بیان پلی­سیسترونی برای تولید این مولکولهای چند زنجیره‌ای در سیستم گیاهی می‌تواند بسیار جالب و قابل توجه باشد. به طور کلی راهکارهایی که برای بیان همزمان چندین ژن خارجی در گیاهان مورد استفاده قرار می‌گیرند به دو گروه تقسیم می‌شوند: 1) راهکارهایی که شامل انتقال و بیان تعداد مورد نظر از واحدهای رونویسی (هر یک شامل راه‌انداز، ناحیه رمز کننده و سیگنال پلی‌آدنیلاسیون، همراه با سایر عناصر سیس با کاربردهای مورد نظر) می‌باشند (20 و 49)، که شامل تراریختی مجدد، تجمع چندین تراژن توسط انتقال پی در پی ژنهای منفرد به گیاهان تراریخته (45 و 47)، ترانسفورماسیون همزمان، انتقال ترکیبی چندین تراژن در یک آزمایش تراریختی (5 و 35) و تلاقیهای جنسی بین گیاهان تراریخته حامل تراژنهای مختلف (37، 38 و 53) هستند و 2) راهکارهایی که چندین ناحیه رمز کننده پروتئین را در یک دستواره پلی‌ژنیک (پلی‌سیسترونی) ترکیب می‌کنند از جمله، پروتئین همجوشی، راه‌اندازهای دو طرفه و جایگاههای میانی ورود ریبوزوم (Internal Ribosome Entry Sites; IRESs) که می‌توانند برای بیان همزمان چندین نسخه از یک ژن و یا چندین ژن از طریق یک واحد رونویسی مورد استفاده قرار گیرند (9).

در 30 سال گذشته اعتقاد بر این بود که تقریباً تمام mRNAهای یوکاریوتی دارای مکانیسم بیان ژن تک سیسترونی هستند که برای هر ژن نیاز به یک راه‌انداز دارد، امروزه مشخص شده است که بیش از 3 درصد mRNA های مهره‌داران و شاید سایر یوکاریوت‌ها در 5′ UTR خود دارای IRES هستند (28). عناصر IRES توالیهای نوکلئوتیدی هستند که اغلب در 5′ UTR برخی mRNAها قرار دارند و ریبوزومهای یوکاریوتی را برای آغاز ترجمه پروتئین در وسط مولکول mRNA بدون نیاز به کلاهک 5′ که به طور طبیعی برای شروع ترجمه نیاز است، به کار می‌گیرند (30، 42 و 50) و برای بیان دو ژن به شکل یک پیام دو ‌سیسترونی استفاده می‌شوند (7، 23 و 44). هنگامی که IRES بین چندین چارچوب قرائت باز (ORF) قرار می‌گیرد، ORF اول با مکانیسم استاندارد وابسته به کلاهک ترجمه می‌شود، در حالی که ترجمه ORF بعدی از طریق مکانیسم مستقل از کلاهک و به صورت وابسته به IRES انجام می‌شود (23 و 41). ترجمه مستقل از کلاهک (Cap-independent translation) اولین بار در یک IRES پولیوویروس کشف شد (50). از آن زمان به بعد ناقلهای دو سیسترونی به طور گسترده‌ای برای کاربردهای in vitro و in vivo مورد استفاده قرار گرفتند (19، 28، 34، 36 و 51). تا به امروز بیش از 40 توالی IRES از طریق آنالیزهای in silico ساختار ثانویه mRNA انواع ویروسهای جانوری و گیاهی از جمله ویروس خراشک توتون (TEV) (11)، توباموویروس آلوده کننده کروسیفر (crTMV) (48) و وﯾﺮوس ﻟﮑﻪ ﺣﻠﻘﻮی ﮐﻠﺮوﺗﯿﮏ ﻫﯿﺒﯿﺴﮑﻮس (HCRSV) (29)، گزارش شده است. در گیاهان نیز مکانیسم ترجمه وابسته به IRES در mRNAهای سلولی رمز کننده پروتئین شوک حرارتی Nicotiana tabacum (NtHS) (16)، پروتئین شوک حرارتی HSP101 در ذرت (15)، پروتئین ریبوزومی S18 (RPS18) در Arabidopsis (47) و همچنین ژن رمز کننده پروتئین الکل دهیدروژناز (ADH) در ذرت (39) شناسایی شده است.

بیان پلی‌سیسترونی پروتئینهای چند زنجیره‌ای مانند آنتی‌بادیها به واسطه IRES به طور گسترده‌ای در سلولهای پستانداری مورد مطالعه قرار گرفته است (3، 4، 5، 6، 24، 34)، همچنین از توالیهای IRES گیاهی برای بیان دو سیسترونی ژنهای گزارشگر (Reporter genes) استفاده شده است (15، 16، 39 و 52)، با این حال، بر اساس منابع علمی قابل دسترس گزارشی در مورد استفاده از عناصر IRES گیاهی برای بیان پلی‌سیسترونی پروتئینهای نوترکیب در گیاهان وجود ندارد. در مطالعه حاضر همسانه‌سازی یک توالی‌ IRES گیاهی از منشاء توتون و استفاده از آن برای بیان دو سیسترونی آنتی‌بادی مونوکلونال trastuzumab در سیستم گیاهی برای اولین بار گزارش می‌شود.

مواد و روشها

مواد گیاهی: بذور گیاه توتون رقم Gewone groene (تهیه شده از مرکز تحقیقات توتون تیرتاش، مازندران) تحت شرایط گلخانه‌ای کشت شدند. گیاهان گلخانه‌ای حاصل در جداسازی ژن و تراریختی ژنتیکی مورد استفاده قرار گرفتند.  

جداسازی توالی 5′ UTR NtHSF1: توالی mRNA بخش 5′ UTR فاکتور شوک حرارتی 1 توتون (NtHSF-1)، که قبلا فعالیت IRES آن گزارش شده است (14)، از پایگاه اطلاعاتی EMBL (European Molecular Biology Laboratory) به دست آمد و یک جفت آغازگر اختصاصی (UTRHSF-Fwd و UTRHSF-Rev، جدول 1) با استفاده از نرم افزار Oligo 7 برای تکثیر یک قطعه bp 453 طراحی شد. برای همسانه‌سازی آسان قطعه 5′ UTR NtHSF1-IRES، جایگاههای برشی آنزیمهای محدود کننده XhoI و BamHI. به ترتیب در توالیهای آغازگرهای رفت و برگشت اضافه شدند. DNA ژنومی از برگ گیاهان گلخانه‌ای دو هفته‌ای به روش CTAB (8) استخراج شد و در واکنش PCR برای تکثیر قطعه مورد نظر استفاده شد. واکنشهای PCR با حجم کلی µl 25 شامل بافر 10X PCR به میزان μl 5/2، (mM 25) MgCl2 µl 5/1، (mM 10)dNTPs  µl 1، آغازگرهای رفت و برگشت (μM 10) هر کدام µl 5/0، (ng/μl 100) DNA ژنومی µl 1، آنزیم (U/µl 5/2) Pfu DNA Polymerase µl 1 و آب مخصوص PCR µl 1 تهیه شدند. واکنش PCR در دستگاه ترموسایکلر طبق برنامه یک چرخه واسرشت‌سازی اولیه 94 درجه سانتی گراد به مدت 4 دقیقه، 35 چرخه شامل واسرشت‌سازی 94 درجه سانتی گراد به مدت 40 ثانیه، اتصال آغازگر 60 درجه سانتی گراد به مدت 50 ثانیه و بسط 72 درجه سانتی گراد به مدت 80 ثانیه و سپس یک چرخه بسط نهایی 72 درجه سانتی گراد به مدت 10 دقیقه انجام شد و محصولات PCR پس از الکتروفورز در ژل آگارز 8/0 درصد در دستگاه Gel Doc مورد مشاهده و عکسبرداری قرار گرفتند.


جدول 1- آغازگرهای مورد استفاده در تحقیق

آغازگر

توالی ′3-′5

طول محصول (bp)

 

UTR-HSF-Fwd

UTR-HSF-Rev

AAGTCTCGAGGGCACGAGGCTCCCA

GAGCGGATCCCTTGTTTTTCCCCTG

453

LC-Fwd1

LC-Fwd1

GCTCGGATCCATGGATATTCAGATGACCC

TGCCTAAGATCTGCTTGGCCTCTGGATCTTGG

 

 

LC-Fwd2

LC-Rev2

CTGAACACCGAATGAACAAGTAC

ACTAAGTCGCGGGCGAGACGTG

 

615

HC-Fwd

HC-Rev

GACATATCCATTGCCAGGAAGCG

GCTAACGTCAACCACCACGCATG

 

718

 

Forward; Reverse

 


محصول PCR پس از خالص‌سازی با کیتHigh Pure PCR Product Purification  (Roche، آلمان)، جهت توالی‌یابی (شرکت Bioneer، کره) ارسال شد. انطباق و تعیین مشابهت توالی به دست آمده از طریق الگوریتم BLASTn در پایگاه اطلاعاتی NCBI صورت گرفت و هم‌ترازی چندگانه توالیها و آنالیز فیلوژنتیکی توسط نرم افزار CLC Sequence Viewer 6 انجام گرفت. پس از تأیید درستی توالی قطعه تکثیر شده، محصول PCR در تهیه دستواره نوترکیب مورد استفاده قرار گرفت.

تهیه دستواره نوترکیب دی‌سیسترون: به منظور ساخت دستواره‌ مولکولی دی‌سیسترون حاوی ژنهای رمزکننده زنجیرۀ سنگین (HC) و زنجیره سبک (LC) آنتی‌بادی مونوکلونال trastuzumab، از پلاسمیدهای pBIN19-TrasHC و pBIN19-TrasLC حاوی توالیهای بهینه شده (بر اساس کدونهای ترجیحی توتون) ژنهای HC و LC (18) استفاده شد. توالی 5′ UTR NtHSF1 پس از برش با آنزیمهای XhoI و BamHI در پلاسمید pBIN19-TrasHC طی فرآیند اتصال با استفاده از آنزیم T4 DNA ligase درج شد. سپس توالی ژن LC از پلاسمید pBIN19-TrasLC توسط آغازگرهای LC-Fwd1 و LC –Rev1 (جدول 1) حاوی جایگاه برش آنزیمی BamHI تکثیر شد و پس از خالص‌سازی و برش با آنزیم مذکور در دستواره نوترکیب اولیه درج شد (43). برای جلوگیری از خود اتصالی حامل، برداشتن فسفات از انتهای 5′ با استفاده از آلکالین‌ فسفاتاز (FastAP، Fermentas) انجام شد. بدین ترتیب دستواره نوترکیب دی‌سیسترون حاوی ژن رمز کننده زنجیره H به عنوان سیسترون اول، ژن رمز کننده زنجیره L به عنوان سیسترون دوم و توالی 5′ UTR NtHSF1-IRES در بین سیسترون‌ها برای بیان آنتی‌بادی trastuzumab ساخته شد و به صورت pBIN19-Tras-HSFIRES نام‌گذاری شد. دستواره‌ نوترکیب با روش ذوب و انجماد (39) به آگروباکتری Agrobacterium tumefaciens سویه LBA4404‌ انتقال یافت و کلنیهای نوترکیب بر اساس کشت در محیط انتخابی حاوی کانامایسین و همچنین از طریق Colony PCR غربال شدند. همچنین ساختار مولکولی دستواره با برش آنزیمی بررسی شد. در نهایت کلنی‌ مورد تأیید آگروباکتری در تراریختی توتون استفاده شد.

تراریختی گیاه توتون با روش آگرواینفیلتراسیون: برای تراریختی به روش آگرواینفیلتراسیون مطابق با روش Leuzinger و همکاران (2013) با اندکی تغییر به شرح زیر عمل شد (32): ابتدا کشت شبانه از دو نوع کلنی اگروباکتریوم سویه LBA4404، هر کدام حاوی دستواره نوترکیب pBIN19-Tras-IRESHSF یا pCAMBIA1302 (حاوی ژن گزارشگر mgfp) در ml 30 محیط LB مایع حاوی آنتی‌بیوتیکهای کانامایسین (mg/l 50) و ریفامپسین (mg/l 50) انجام شد. کشت شبانه باکتری در rpm 4000 به مدت 5 دقیقه سانتریفیوژ شد. رسوب هر دو نوع باکتری در ml 30 محیط القاء (K2HPO4 g/l 5/10، KH2PO4 g/l 5/4، (NH4)2SO4 g/l 1، NaCitrate g/l 5/0، glycerol g/l 4، glucose g/l 1، MgSO4 mM 1، MES mM 10، 5/5=pH) غنی شده با سینامیک ‌اسید (Mµ 150)، کانامایسین (mg/l 50) و ریفامپسین (mg/l 50) حل شد و در دمای 28 درجه سانتی گراد و rpm 200 نگهداری شد. پس از 5 ساعت هر دو نوع سوسپانسیون باکتری سانتریفیوژ شده و رسوبهای حاصل در بافر اینفیلتراسیون (MgSO4 mM 10؛ MES mM 10 و 5/5=pH) حاوی Mµ 150 سینامیک‌اسید حل شد و غلظت باکتری به 4/0 ~OD600 رسانده شد و به مدت 1 ساعت در دمای 22 درجه سانتی گراد و rpm 200 نگهداری شد. سوسپانسیون‌های‌ باکتری تهیه شده به طور جداگانه یا ترکیبی توسط سرنگ بدون سوزن به برگ گیاهان 6 هفته‌ای توتون تزریق شدند. همچنین تعدادی از برگها با بافر اینفیلتراسیون عاری از باکتری (شاهد منفی) تلقیح شدند. گیاهان تلقیح شده  به اتاقک رشد با دمای 2±24 درجه سانتی گراد منتقل شدند. 7 روز پس از اینفیلتراسیون، برگها برای آنالیزهای بعدی برداشت شدند. قبل از آنالیزهای مولکولی اساسی، تعدادی از برگهای تلقیح شده با ترکیبی از پلاسمیدهای pCAMBIA1302 + pBIN19-TrasHLC-IRESHSF برای ردیابی بیان پروتئین GFP و کارآمدی روش آگرواینفیلتراسیون استفاده شدند، بدین منظور علاوه بر تابش مستقیم نور UV بر برگها در تاریکخانه، به وسیله میکروسکوپ کونفوکال نیز ارزیابی شدند و عکس‌برداری از تشعشعات از طریق عبور از یک فیلتر nm 530-500 انجام شد.

آنالیز لکه‌گذاری نقطه‌ای (Dot blotting): بدین منظور DNA ژنومی از برگهای تلقیح شده به روش CTAB استخراج شد. در حدود µg 10 DNA ژنومی و همچنین غلظتهای مختلفی (pg 1000 ,500 ,100 ,10) از پلاسمید نوترکیب به عنوان شاهد مثبت پس از واسرشت‌سازی بر روی غشای نایلونی باردار مثبت (Roche، آلمان) لکه‌گذاری شدند. کاوشگر اختصاصی نشاندار با استفاده از سیستم DIG از ناحیه رمز کننده تراژنها بر اساس دستورالعمل کیتPCR DIG probe synthesis kit (Roche) تهیه شد. دورگه‌سازی غشای لکه‌گذاری شده با کاوشگر، مراحل شستشو و تشخیص سیگنالها طبق دستورالعمل کیت DIG DNA Labaling and Detection kit (Roche، آلمان) صورت گرفت. 

آنالیز RT-PCR نیمه‌کمّی (Semi-quantitative reverse transcription- PCR): به منظور تأیید بیان تراژنها در گیاهان اینفیلتر شده از آنالیز RT-PCR نیمه‌‌ کمّی استفاده شد. برای استخراج RNA کل از نمونه‌های برگی اینفیلتر شده حاوی تراژنها و گیاه مادری غیرتراریخته توتون (شاهد منفی) بر اساس دستورالعمل کیت RNeasy Plant Mini Kit (QIAGEN) عمل شد. آنالیز RT-PCR بر اساس دستورالعمل کیت Titan One Tube RT-PCR (Roche) توسط آغازگرهای اختصاصی تراژنها (LC-Fwd2, -Rev و HC-Fwd2, -Rev، جدول 1) به صورت Multiplex در قالب طرح کاملاً تصادفی (CRD) با سه تکرار انجام شد. در این آنالیز از رونوشت ژن 18S rRNA به عنوان کنترل داخلی برای کمّی نمودن نسبی بیان تراژنها و از تکنولوژی Competimer™ 18S rRNA (Ambion، آمریکا) برای کنترل تکثیر رونوشت آن در رقابت با رونوشت تراژنها استفاده شد. بدین منظور پس از بهینه‌سازی، از نسبت 3:8 primers:competimers در واکنش RT-PCR استفاده شد. محصولات RT-PCR در ژل آگارز 1 درصد مورد بررسی قرار گرفتند. برای سنجش نیمه کمّی بیان تراژنها، شدت نوارهای تکثیر شده پس از نرمال‌سازی نسبت به کنترل داخلی در نرم ‌افزار 1.47 ImageJ به داده‌های کمّی چگالی تصحیح شده (Adjusted density) تبدیل شدند و مقایسه میانگین داده‌ها توسط آزمون حداقل تفاوت معنی‌دار (LSD) در سطح احتمال (01/0 ˂ P) انجام شد. 

آنالیز لکه‌گذاری وسترن (Western blotting): آنالیز لکه‌گذاری وسترن به منظور ردیابی بیان پروتئینهای LC و HC آنتی‌بادی trastuzumab در پروتئین کل برگ گیاهان توتون آگرواینفیلتر شده صورت گرفت. 7 روز پس از اینفیلتراسیون، استخراج، پروتئین‌ کل از برگهای اینفیلتر شده و برگ گیاهان غیرتراریخته به عنوان شاهد منفی به روش Jafari و همکاران (2009) انجام شد (26) و غلظت پروتئین کل استخراج شده به روش برادفورد (10) تعیین شد. در حدود 50 میکروگرم از نمونه پروتئین گیاهان تراریخته و شاهد، پس از واسرشت‌سازی در ژل SDS-PAGE (Sodium dodecyl sulfate-Polyacrylamide gel) 10 درصد بارگذاری شد و الکتروفورز در شرایط احیاء شده (reducing conditions) و شرایط احیاء نشده (non-reducing conditions) با دستگاه Protein II (Bio-Rad) انجام شد. انتقال پروتئینها از ژل بر روی غشاء نیتروسلولزی (Bio-Rad، آمریکا) به وسیله دستگاه Semi-dry transblot (Bio-Rad) با ولتاژ 20 انجام شد و تشخیص ایمونولوژیکی پروتئینهای هدف بر اساس روش Jafari و همکاران (2009) (26) و با استفاده از آنتی‌بادیهای goat Anti-human IgG-Gamma (γ)-specific AP-conjugated antibody وgoat Anti-human IgG-Kappa (κ)-chain specific AP-conjugated antibody (Sigma، آمریکا) صورت گرفت. برای اندازه‌گیری میزان نسبی تجمع پروتئین نوترکیب، آنالیز غشای وسترن به وسیله نرم‌ افزار 1.47 ImageJ انجام شد و شدت نوارها پس از نرمال ‌سازی نسبت به نمونه استاندارد به داده‌های کمّی چگالی نسبی (Relative density) تبدیل شدند و تجمع پروتئین نوترکیب به صورت درصدی از پروتئین محلول کل (Total soluble protein, TSP) بیان شد.

نتایج

آنالیز بیوانفورماتیکی توالی 5′ UTR NtHSF1: نتایج همردیفی توالی 5′ UTR NtHSF1 با استفاده از الگوریتم BLASTn نشان داد که توالی جداسازی شده از توتون رقم Gewone groene با توالی HSF1 ثبت شده برای توتون زراعی در NCBI دارای انطباق 100 درصد است (شکل 1، A). همچنین این توالی با فاکتورهای HSF24 شناسایی شده در توتونهای N. sylvestris و N. tomentosiformis و همچنین توالی شبه HSF24 در سیب‌زمینی شباهت بسیار بالایی نشان داد. آنالیز همردیفی چندگانه این توالیها نیز مؤید این مطلب بود (شکل 1، B) و آنالیز فیلوژنتیکی نشان داد که نتایج حاصل از BLAST و نتایج همردیفی چندگانه بر هم منطق هستند و نزدیک‌ترین توالی به توالی جداسازی شده در این مطالعه HSF1 توتون معمولی است (شکل 1، C) ، لذا درستی توالی 5′ UTR NtHSF1-IRES تأیید شد.

تأیید دستواره‌ نوترکیب توسط آنالیز PCR و برش آنزیمی: حضور تراژنها توسط آزمون PCR با استفاده از آغازگرهای اختصاصی تأیید شد (شکل 2، A). آنالیز Duplex PCR با استفاده از آغازگرهای اختصاصی برای تراژنها تکثیر همزمان قطعه bp 718 برای ژن HC و bp 615 برای ژن LC را نشان داد که برابر با اندازه مورد انتظار قطعات تکثیر شده در شاهد مثبت (مخلوط پلاسمیدهای pBIN19-NTopTras-HC و pBIN19-NTopTras-LC مورد استفاده در ساخت دستواره‌ نوترکیب، چاهک C+) بود. در پلاسمید غیر نوترکیب pBIN19 هیچ‌گونه تکثیری مشاهده نشد که نشان دهنده عدم وجود قطعات متناظر در آن می‌باشد (چاهک C1¯). عدم تکثیر در واکنش بدون DNA الگو نیز نشان دهنده صحت واکنش PCR و عدم وجود هرگونه آلودگی بود (چاهک C2¯). برای اطمینان بیشتر از صحت دستواره ساخته شده، ساختار مولکولی دستواره‌ ساخته شده توسط آنالیز برش با آنزیمهای محدود کننده تأیید شد (شکل 2، B). در اثر برش دوگانه با آنزیمهای BamHI و HindIII در پلاسمید نوترکیب اولیه نواری با اندازه بزرگتر نسبت به نوار ایجاد شده در پلاسمید pBIN19-TrasHC مشاهده شد که نشانگر درج توالی 5′ UTR NtHSF1-IRES در آن بود (چاهکهای 1 و 2). دستواره ساخته شده در این مرحله به صورت pBIN19-TrasHC-IRESHSF نام‌گذاری شد. پلاسمیدهای نوترکیب نهایی و pBIN19-TrasHC-IRESHSF در برش توسط آنزیم HindIII به صورت خطی در آمدند، ولی اندازه بزرگتر پلاسمید نوترکیب خطی شده نشان دهنده وارد شدن قطعه الحاقی (ژن LC) در آن بود (چاهکهای 3 و 4). برش با آنزیم BamHI باعث خطی شدن پلاسمید pBIN19-TrasHC-HSFIRES شد (چاهک 5)، در صورتی که در پلاسمید نوترکیب نهایی به دلیل وجود جایگاه دیگر برای این آنزیم بر روی قطعه الحاقی، یک قطعه دیگر با طول حدود bp 850 حاصل شد (چاهک 6). برای تأیید جهت صحیح درج قطعه الحاقی، پلاسمید نوترکیب با استفاده از آنزیم XhoI برش یافت، که ایجاد قطعه‌ای با اندازه مورد انتظار نشان دهنده درج قطعه الحاقی با جهت صحیح بود (چاهک 7). بدین ترتیب ساختار دستواره نوترکیب pBIN19-TrasHLC-IRESHSF حاوی ژنهای رمزکننده زنجیره­های L و H آنتی‌بادی trastuzumab جدا شده با توالی IRES فاکتور شوک ‌حرارتی 1 توتون تأیید شد (شکل 3).


 

شکل 1- آنالیز بیوانفورماتیک توالی 5′ UTR NtHSF1 جداسازی شده از توتون (Nicotiana tabacum) رقم Gewone groene. A: همردیفی توالی به دست آمده با استفاده از الگوریتم BLASTn در NCBI، C و B: به ترتیب همردیفی چندگانه توالیها با استفاده از نرم افزارCLC Sequence Viewer و درخت فیلوژنی بر اساس الگوریتم UPGMA حاصل از داده‌های همردیفی چندگانه.


آنالیز لکه‌گذاری نقطه‌ای: بر اساس نتایج حاصل از این آنالیز (شکل 4)، در نمونه DNA برگ اینفیلتر شده با بافر اینفیلتراسیون، به عنوان شاهد منفی اول، سیگنالی مشاهده نشد که نشان دهنده عدم وجود توالی هومولوگ با کاوشگر اختصاصی تراژنها (HC و LC) در ژنوم این گیاهان است. در نمونه‌های بدون DNA (آب) نیز به عنوان شاهد منفی دوم هیچ‌گونه سیگنالی مشاهده نشد، که بیانگر عدم آلودگی سیستم ‌هیبریداسیون بود. در نمونه‌های DNA مربوط به برگهای اینفیلتر شده با آگروباکتری حاوی پلاسمید نوترکیب pBIN19-TrasHLC-IRESHSF، مشابه با نمونه DNA این پلاسمید (به عنوان شاهد مثبت) سیگنال‌ مشاهد شد. نتایج این آنالیز نشان دهنده درج حداقل یک نسخه از تراژنها در ژنوم سلولهای برگی اینفیلتر شده بود.


 

شکل 2- تأیید ساختار مولکولی دستواره‌ نوترکیب pBIN19-TrasHLC-IRESHSF  حاوی ژنهای رمزکننده زنجیره­های L و H آنتی‌بادی trastuzumab و 5′ UTR NtHSF1-IRES. A) آنالیز Duplex PCR برای دستواره نوترکیب pBIN19-TrasHLC-IRESHSF، M: نشانگر وزن مولکولی 1 kb DNA Ladder (Fermentas). (B آنالیز برش آنزیمی برای دستواره نوترکیبpBIN19-TrasHLC-IRESHSF  با استفاده از آنزیمهای BamHI، HindIII ، XhoI. یا BamHI+HindIII..

 

شکل 3- نقشه فیزیکی بخش T-DNA پلاسمید نوترکیب pBIN19-TrasHLC-IRESHSF، RB: توالی مرزی راست، :LB توالی مرزی چپ، Nos-P: راه‌انداز ژن nos، :nptII ژن neomycin phosphotransferase،:Nos-T، توالی پایانی ژنnos ، 35S2xe: راه‌انداز ویروس موزائیک کلم تقویت شده، CHS: ناحیه غیرترجمه شونده 5ʹ (5ʹ-UTR) ژن چالکون سینتاز، SP: توالی نشانه شبکه آندوپلاسمی ژن کینیتاز بازی آرابیدوپیس، HC: ژن رمز کننده زنجیره H، IRES، 5′ UTR NtHSF1-IRES ، LC: ژن رمز کننده زنجیره L، 35S: توالی پایانی.

 

شکل 4- آنالیز لکه‌گذاری نقطه‌ای با کاوشگر نشاندار شده با DIG.اختصاصی ژنهای HC و LC رمز کننده آنتی‌بادی trastuzumab. A1 تا A4: به ترتیب غلظتهای 1000، 500، 100، 10 پیکوگرم از پلاسمید نوترکیب pBIN19-TrasHLC-IRESHSF به عنوان شاهد مثبت، A5: ddH2O، B1 و B2: نمونه‌های برگی اینفیلتر شده با آگروباکتری حاوی پلاسمید نوترکیب pBIN19-TrasHLC-IRESHSF، B3: نمونه‌ برگی اینفیلتر شده با دو تیپ سلول آگروباکتری حاوی پلاسمید نوترکیب pBIN19-TrasHLC-IRESHSF و pCAMBIA1302، B4: نمونه‌ برگی اینفیلتر شده با بافر اینفیلتراسیون، B5: ddH2O.


بیان تراژنها در بافت برگ: بیان موقت ژن gfp در برگهای توتون اینفیلتره شده با ترکیبی از پلاسمیدهای pCAMBIA1302 + pBIN19-TrasHLC-IRESHSF (شکل 5) تأییدی بر کارآمدی روش اگرواینفیلتراسیون به کار رفته در این تحقیق بود. بیان ژنهای HC و LC توسط آنالیز RT-PCR نیمه کمّی تأیید شد (شکل 6). در این آنالیز از تکنولوژی Competimer™ 18S rRNA برای تکثیر رونوشت آن به عنوان کنترل داخلی و مقایسه میزان بیان تراژنها استفاده شد. بر اساس نتایج حاصل از آنالیز (شکل 6، A)، برای نمونه‌های بافت برگی حاصل از اینفیلتراسیون نوارهایی با اندازه‌های مورد انتظار (bp 718 و bp 615، به ترتیب برای ژنهای HC و LC) و هم اندازه با نوارهای تکثیر شده در واکنش حاوی پلاسمید نوترکیب pBIN19-TrasHLC-IRESHSF به عنوان شاهد مثبت تکثیر شد که حاکی از حضور رونوشت ژنهای هدف در RNA تام بود. برای نمونه بافت برگ گیاه مادری بدون اینفیلتراسیون (شاهد منفی اول) فقط نوار مربوط به رونوشت ژن 18S rRNA مشاهده شد که نشان دهنده عدم وجود رونوشت ژنهای هدف در گیاه غیر تراریخته، و به عبارت دیگر عدم وجود ژنهای HC و LC در ژنوم گیاه مادری غیر تراریخته است.


 

شکل 5- بیان پروتئین GFP در برگهای توتون اگرواینفیلتره شده با ترکیبی از پلاسمیدهای pCAMBIA1302 (حاوی ژن mgfp)+ pBIN19-TrasHLC-IRESNHSF. A: تشعشع نور سبز در اثر تابش نور UV در برگ آگرو اینفیلتر شده با ترکیبی از پلاسمیدها، C و B: تصویر میکروسکوپی از سلولهای برگی تراریخته با ژن mgfp دارای تشعشع نور سبز، D: عدم انعکاس نور سبز در برگ تلقیح شده با بافر اینفیلتراسیون بدون پلاسمید.

 

شکل 6- A) آنالیز Semi-quantitative RT-PCR برای ژنهای رمز کننده آنتی‌بادی trastuzumab در گیاهان توتون پس از آگرواینفیلتراسیون، A) الکترفورگرام بیان ژنهای LC و HC.. P+: پلاسمید نوترکیب pBIN19-TrasHLC-IRESHSF (شاهد مثبت)، HC-NtHS-LC-1, -2, -3: برگهای اینفیلتر شده با آگروباکتری حاوی پلاسمید pBIN19-TrasHLC-IRESHSF،In. B.-PL : برگ اینفیلتر شده با بافر اینفیلتراسیون (شاهد منفی اول)، C1 ̄ : واکنش RT-PCR دارای RNA الگو به صورت بالک از برگهای اینفیلتر شده و تیمار شده باRNase  (شاهد منفی دوم)، C2 ̄ : واکنش RT-PCR بدون RNA الگو (شاهد منفی سوم). B) نمودار بیان کمّی شده (نسبی) تراژنها بر اساس نرم ‌افزار ImageJ 1.47. مقادیر دارای حروف غیر مشترک بر اساس آزمون LSD از نظر آماری معنی‌دار (01/0 ˂ P) هستند.


عدم مشاهده هیچ‌گونه نواری در واکنشRT-PCR  دارای RNA الگو به صورت بالک از نمونه‌های برگی اینفیلتر شده و تیمار شده باRNase  (شاهد منفی دوم) بیانگر عدم آلودگی نمونه‌های مورد استفاده در آنالیز با DNA بود. همچنین در واکنش بدون RNA (شاهد منفی سوم) نواری مشاهده نشد که نشان دهنده عدم هر گونه آلودگی مخلوط مادر و آنالیز RT-PCR به RNA یا DNA غیر هدف بود. با توجه به استفاده از مقدار تقریباً یکسان RNA تام از گیاهان مورد بررسی و میزان بیان تقریباً ثابت از ژن 18S rRNA در آنالیز RT-PCR، به ‌طور نسبی میزان بیان ژن هدف در این گیاهان کمّی شد. بر این اساس، نمونه‌ HC-NtHS-LC-1 بیشترین میزان بیان ژنهای HC و LC را نشان ‌داد (شکل 6، B).

تجمع آنتی‌بادی trastuzumab به فرم تترامر: تجمع آنتی‌بادی trastuzumab در بافت برگی توتون 7 روز پس از اینفیلتراسیون توسط آنالیز لکه‌گذاری تحت شرایط SDS-PAGE احیاء شده و غیر احیاء تشخیص داده شد. در شرایط غیر احیاء، حضور نوار پررنگ با اندازه بزرگ نشان دهندۀ الگوی تترامر (H2L2) آنتی‌بادی trastuzumab مطابق با نوار مشاهده شده در IgG1 انسانی (شاهد مثبت) می‌باشد که این فرم غالب‌ترین فرم آنتی‌بادی تجمع یافته بود (شکل 7، A). باندهای دیگر مشاهده شده در آنالیز ایمونوبلات مربوط به فرمهای دیگر آن (هتروتریمر، دیمر و مونومر) است که در کمترین میزان تشکیل شده‌اند. با مقایسه شدت نوارها و آنالیز غشاء به وسیله نرم ‌افزار ImageJ مشخص شد که میزان تجمع فرم تترامر آنتی‌بادی در نمونه‌های برگی مختلف متفاوت و بیش از 44/0 درصد پروتئین محلول کل است (شکل 7، B).


 

 

 

شکل 7- A) آنالیز لکه‌گذاری وسترن برای نمونه‌های برگی توتون 7 روز پس از اینفیلتراسیون با آگروباکتری حاوی پلاسمید pBIN19-TrasHLC-IRESHSF تحت شرایط غیر احیاء. M: نشانگر پروتئینی Kaleidoscope prestained standard (BioRad)، In. B.-PL: برگ اینفیلتره شده با بافر اینفیلتراسیون (شاهد منفی)، S: IgG1 انسانی. HC-NtHS-LC-1, -2, -3: برگهای اینفیلتره شده با آگروباکتری حاوی دستواره پلاسمید نوترکیب، علامت پیکان فرم تترامر (H2L2) trastuzumab به عنوان فرم غالب تولید شده را نشان می‌دهد. B) پلات پروفیل نوارهای حاصل از الگوی تترامر trastuzumab. پیک حاصل از هر نوار توسط نرم‌ افزار ImageJ کمّی شد و به صورت چگالی نسبی (Relative density) بر اساس نمونه

استاندارد بیان شد.


در آنالیز وسترن‌ بلات تحت شرایط احیاء شده نوارهای مورد انتظار kDa 50 و kDa 25 به ترتیب مربوط به زنجیره H و زنجیره L مطابق با نوارهای حاصل از Herceptin (شاهد مثبت) مشاهده شد، در حالی‌که در بافت برگ گیاه مادری بدون اینفیلتراسیون (شاهد منفی) چنین نوارهایی تشخیص داده نشد (شکل 8، A). همچنین مقایسه شدت نوارها در شرایط احیاء شده نشان داد که میزان بیان زنجیره­های‌ H و L در نمونه‌های مختلف تقریباً 1 درصد پروتئین محلول کل است (شکل 8، B). آنالیز لکه‌گذاری وسترن نشان داد که آنتی‌بادی trastuzumab به طور موفقیت‌آمیزی در بافت برگی گیاه توتون پس از آگرواینفیلتراسیون با یک وکتور دو سیسترونی مبنتی بر یک IRES گیاهی بیان می‌شود.


 

 

شکل 8- A) آنالیز لکه‌گذاری وسترن برای نمونه‌های برگی توتون 7 روز پس از اینفیلتراسیون با آگروباکتری حاوی ژنهای رمزکننده زنجیره‌های L و H آنتی­بادی trastuzumab تحت شرایط احیاء شده. M: نشانگر پروتئینی Kaleidoscope prestained standard (BioRad)، S: نمونه استاندارد (Herceptin)، HC-NtHS-LC-1, -2, -3: برگهای اینفیلتر شده با آگروباکتری حاوی دستواره پلاسمید نوترکیب، In. B.-PL: برگ اینفیلتر شده با بافر اینفیلتراسیون (شاهد منفی اول)، Native plant: نمونه برگ گیاه غیرتراریخته (شاهد منفی دوم). نوارهای kDa 50 و kDa 25، به ترتیب زنجیره‌های L و H را نشان می‌دهند.B ) پلات پروفیل نوارهای حاصل از الگوی تترامر trastuzumab. پیک حاصل از هر نوار توسط نرم ‌افزار ImageJ کمّی شد و به صورت چگالی نسبی (Relative density) بر اساس نمونه استاندارد بیان شد.


بحث

استراتژیهای مختلفی برای انتقال همزمان چندین ژن به گونه‌های گیاهی توسعه یافته است. با این حال، استفاده از روشهای سنتی برای انتقال چندین ژن به طور همزمان دارای معایب متعددی می‌باشد از جمله می‌توان به الگوی نامطلوب درج T-DNA، صرف زمان بیشتر مورد نیاز برای ترانسفورماسیون مجدد و یا تلاقی بین گیاهان تراریخته (13 و 14) اشاره نمود و مهم‌تر اینکه تراژنهایی از منابع مختلف به طور معمول در مکانهای متفاوتی از ژنوم گیاه درج می‌شوند که ممکن است منجر به الگوهای بیان متفاوت و تفکیک تراژنها در نسل بعدی شود (30). با استفاده از توالیهای لینکر می­توان برای بیان همزمان ژنها استفاده کرد (7)، با این حال پلی­پپتیدهای حاصل به صورت پیوسته باقی خواهند ماند و برای گردایش آنها به صورت پروتئینهای مرکب مانند آنتی­بادیها مناسب نخواهد بود. یکی از روشهای مهم بیان همزمان بیش از یک ژن، استفاده از توالیهای IRES است. از مزایای اصلی استفاده از توالیهای IRES برای بیان همزمان چندین ژن، تولید پروتئینهای متعدد با نسبت مولی کنترل شده و انتقال تنها یک کاست بیانی به سلولهای گیاهی می‌باشد (12). از آنجایی که با استفاده از ناقلهای دو سیسترونی در نهایت یک مولکول DNA در ژنوم گیاه درج خواهد شد، تمام ژنهای همسانه شده در آن با هم قابل توارث به نتاج خواهند بود. با توجه به اهمیتی که بیان همزمان دو زنجیره پلی­پپتیدی L و H برای تاخوردگی صحیح و تجمع مولکول آنتی‌بادی‌ دارد، در این مطالعه امکان بیان همزمان ژنهای HC و LC به صورت یک کاست بیان کننده دو سیسترونی با استفاده از توالی IRES فاکتور شوک حرارتی 1 توتون (NtHSF1-IRES) بررسی شد. آنالیز ایمونوبلات عصاره خام بیان همزمان زنجیره­های‌ L و H و تجمع آنتی‌بادی به شکل تترامر (H2L2) در بافتهای برگی اینفیلتر شده را نشان داد. در این تحقیق عملکرد بیان trastuzumab با استفاده از دستواره بیانی دو سیسترونی حاوی توالی NtHS-IRES در سیستم بیان موقت معادل با 44/0 درصد پروتئین محلول کل به دست آمد که در مقایسه با سطح بیان trastuzumab (1/0 درصد پروتئین محلول کل) در تحقیق دیگر ما (20) با استفاده از دستواره‌های بیانی مبتنی بر ناقل دوتایی بدون توالی IRES قابل توجه است. Dorokhov و همکاران (2002) گزارش کردند که mRNA 453 نوکلئوتیدی 5′ UTR فاکتور 1 پروتئین شوک حرارتی N. tabacum (NtHSF-1) در دستواره دو سیسترونی آزمایش شده برای بیان همزمان پروتئینهای GFP و GUS در پروتوپلاست توتون به عنوان IRES عمل می‌کند (16). نتایج مطالعه Dinkova و همکاران (2005) نیز نشان دهنده کارآیی توالی 5′ UTR پروتئین شوک حرارتی HSP101 ذرت، یک mRNA سلول گیاهی، با توجه به ترجمه مستقل از کلاهک در طی تنش حرارتی به عنوان یک عنصر IRES بود (15). در مطالعه‌ای دیگر، Vanderhaeghen و همکاران (2006) با استفاده از بیان دو سیسترونی ژنهای گزارشگر لوسیفراز (lus) و کلرامفنیکل استیل ترانسفراز (cat) در یک سیستم in vitro عصاره جوانه گندم نشان دادند که 5′ UTR پروتئین ریبوزومی S18 (RPS18) واسطه ترجمه مستقل از کلاهک بوده و به صورت یک توالی IRES عمل می‌کند (52). Mardanova و همکاران (2008) نیز با استفاده از دستواره دو سیسترونی حاوی ژنهای گزارشگر در سلولهای N. benthamiana در شرایط in vivo و در سیستم ترجمه RRL (Rabbit Reticulocyte Lysate) در شرایط in vitro نشان دادند که توالی پیشرو mRNA ژن adh1 حاوی توالی IRES است (39).

ناقلهای پلی‌سیسترونی مبتنی بر IRES به طور گسترده‌ای برای بیان چندین ژن به طور همزمان در سلولهای پستانداری مورد مطالعه قرار گرفته‌اند (22، 27، 32 و 33). حجازی و همکاران (1382) از وکتور آدنوویروس نوترکیب IL-2/IRES/B7.1 برای بیان همزمان IL-2 و B7.1 در سلولهای لوکمیک C1498 موش استفاده کردند (3). نتایج این مطالعه نشان داد که وکتور آدنوویروس نوترکیب توانایی القاءی بیان همزمان IL-2 و B7.1 در سلولهای آلوده شده را دارد. Li و همکاران (b2007) در مطالعه خود کاستهای بیانی مختلفی را برای بیان مونو و دو سیسترونی آنتی‌بادی نوترکیب در سیستم پستانداری طراحی کردند (34). نتایج مطالعه آنها نشان داد که سطح بیان آنتی‌بادی با استفاده از دستواره بیانی دو سیسترونی به واسطه EMCV-IRES در مقایسه با بیان مونوسیسترونی مشابه است و این آنتی‌بادی پایداری طولانی مدت در لاینهای سلولی CHO نشان می‌دهد. Ho و همکاران (2012) از ناقلهای تری‌سیسترونی حاوی ژنهای رمز کننده زنجیره‌های سبک و سنگین آنتی‌بادی و ژن نشانگر انتخابی نئومایسین فسفوترانسفراز II (nptII) جدا شده با توالی EMCV-IRES در یک رونوشت و همچنین ناقلهای مونوسیسترونی حاوی یک راه‌انداز برای هر یک از این‌ ژنها برای بیان آنتی‌بادی مونوکلونال در لاینهای سلولی CHO استفاده کردند (24). نتایج مطالعه آنها نشان داد که استفاده از ناقلهای تری‌سیسترونی منجر به کاهش تعداد کلونهای غیر بیان کننده، افزایش بازده و کنترل نسبت بیان ژنهای HC و LC می‌شود. Ho و همکاران (2013) ناقلهای تری‌سیسترونک حاوی ژنهای رمز کننده زنجیره‌های سبک و سنگین آنتی‌بادی مونوکلونال و ژن دی‌هیدروفولات ردوکتاز (DHFR) را برای مقایسه اثر توالیهای IRES و furin-2A (F2A) بر سطح بیان و کیفیت آنتی‌بادی مونوکلونال در سلولهای CHO DG44 طراحی کردند (25). نتایج مطالعه آنها نشان داد که ناقلهای تری‌سیسترونی حاوی توالی IRES منجر به تجمع آنتی‌بادی با اندازه صحیح می‌شوند. شجاعی و همکاران (2013) بیان همزمان زنجیره‌های L و  Hآنتی­بادی trastuzumab را با استفاده از ناقل لنتی‌ویروسی با توالی IRES از ژنوم ویروس پولیو (Polio-IRES) در سیستم بیان پستانداری گزارش نمودند (4). با این حال، گزارشی در مورد بیان دو سیسترونی پروتئینهای نوترکیب چند زنجیره‌ای با استفاده از توالیهای IRES در سیستمهای گیاهی وجود ندارد. بیان کارآمد آنتی‌بادی trastuzumab در این تحقیق نشان دهندۀ توانایی بالای توالی 5′ UTR NtHSF1-IRES برای بیان همزمان ژنهای هترولوگ در سیستمهای گیاهی است. از حامل دو سیسترونی تهیه شده در این تحقیق می‌توان در تولید پایدار این آنتی‌بادی با ارزش در یک میزبان گیاهی مناسب مانند توتون استفاده نمود. نتایج تحقیق حاضر نشان داد که بیان پلی‌سیسترونی به واسطه توالیهای IRES می‌تواند به عنوان یک راهکار نوین در کشاورزی مولکولی برای تولید پروتئینهای چند زنجیره‌ای مانند آنتی‌بادیها مورد استفاده قرار گیرد.

تشکر و قدردانی

از حمایتهای مادی و معنوی دانشگاه ارومیه صمیمانه سپاسگزای می‌شود. از پژوهشکده زیست‌فناوری دانشگاه ارومیه به خاطر در اختیار گذاشتن امکانات آزمایشگاهی لازم جهت انجام تحقیق تشکر و قدردانی می‌شود. همچنین از جناب آقای مهندس محمدرضا صلواتی (مرکز تحقیقات توتون تیرتاش، مازندران) به خاطر فراهم آوردن بذر مورد نیاز تحقیق سپاسگزاری می شود.

 

  1. جعفری، م.، نوروزی، پ.، 1391، گیاهان به عنوان بیوراکتورهای سبز برای تولید آنتی‌ژن‌های واکسن. مجله ایمنی زیستی، دوره چهارم، شماره سوم، 90-67.
  2. جلالی جواران، م.، محب‌الدینی، م.، معصومی اصل، ا.، و همکاران، 1388، موفقیت‌های کشاورزی مولکولی (Molecular farming) در ایران. مجله بیوتکنولوژی کشاورزی، دوره 1، شماره 1، 48-19.
  3. حجازی، م. س.، فرزانه، ف.، 1382، بیان همزمان اینترلوکین -2 و B7.1 توسط وکتور آدنوویروس نوترکیب با استفاده از یک کاست بیان کننده محتوی جایگاه میانی ورود ریبوزوم (IRES). فصلنامه علوم دارویی، سال نهم، شماره اول، 89-97.
  4. شجاعی، س.، گردانه، م.، 1391، بیان آنتی‌بادی مونوکلونال هرسپتین در سلولهای یوکاریوتی و آنالیز کاهش بیان HER2 در رده‌های سلولی سرطان پستان. فصلنامه بیماری‌های پستان ایران، سال پنجم، شماره اول، 29-44.
  5. محمدزاده، ر.، مطلبی،  م.، زمانی، م.، 1394،  طراحی و ساخت سازه بیانی گیاهی جهت تولید پروتئین کایمری حاوی PGIP1 و PGIP2. مجله پژوهشهای سلولی و مولکولی، جلد 6 شماره 4، 561-550.
  6. معصومی اصل، ا.، جلالی جواران، م.، مهبود، ف.، علیزاده، ه.، 1388، همسانه سازی و انتقال ژن فعال کننده پلاسمینوژن بافتی (tPA) با منشاءء انسانی به گیاه توتون. مجله زیست شناسی ایران، جلد 22، شماره 3، 525-516.
    1. Allera-Moreau C, Chomarat P, Audinot V, Cogé F, Gillard M, Martineau Y, Boutin JA, Prats AC (2006) The use of IRES-based bicistronic vectors allows the stable expression of recombinant G-protein coupled receptors such as NPY5 and histamine 4. Biochimie 88:737-746.
    2. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K (1995) Short Protocols in Molecular Biology, John Wiley & Sons, New York, Ch. 2.4.
    3. Bouabe H, Fassler R, Heesemann J (2008) Improvement of reporter activity by IRES-mediated polycistronic reporter system. Nucleic Acids Res 36:28.
    4. Bradford MM (1976) "Rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding". Analytical Biochemistry 72:248-254.
    5. Carrington JC, Freed DD (1990) Cap-independent enhancement of translation by a plant potyvirus 5′ nontranslated region. Journal of Virology 64:1590-1597.
    6. Dafny-Yelin M, Tzfira T (2007) Delivery of Multiple Transgenes to Plant Cells. Plant Physiology, 145: 1118–1128.
    7. De Buck S, Jacobs A, Van Montagu M, Depicker A (1999) The DNA sequences of T-DNA junctions suggest that complex T-DNA loci are formed by a recombination process resembling T-DNA integration. Plant J 20: 295–304.
    8. De Neve M, De Buck S, Jacobs A, Van Montagu M, Depicker A (1997) T-DNA integration patterns in co-transformed plant cells suggest that T-DNA repeats originate from co-integration of separate T-DNAs. Plant J 11: 15–29.
    9. Dinkova TD, Zepeda H, Martinez-Salas E, Martinez LM, Nieto-Sotelo J, de Jimenez ES (2005) Cap-independent translation of maize Hsp101. Plant J 41: 722-731.
    10. Dorokhov YL, Skulachev MV, Ivanov PA, Zvereva SD, Tjulkina LG, Merits A, Gleba YY, Hohn T, Atabekov JG (2002) Polypurine (A)-rich sequences promote cross-kingdom conservation of internal ribosome entry. PNAS, 99(8): 5301-5306.
    11. Ecker DM, Jones SD, Levine HL (2015) The therapeutic monoclonal antibody market.  mAbs 7(1): 9-14.
    12. Ehsasatvatan (2014) Agrobacterium-mediated transformation of tobacco (Nicotiana tabacum L.) with the light and heavy-chain genes encoding Trastuzumab antibody. Dissertation, University of Urmia, Iran.
    13. Fallot S, Ben Naya R, Hieblot C, Mondon P, Lacazette E, Bouayadi K, Kharrat A, Touriol C, Prats H (2009) Alternative-splicing-based bicistronic vectors for ratio-controlled protein expression and application to recombinant antibody production. Nucleic Acids Research 37(20): 1-10.
    14. Goderis IJWM, De Bolle MFC, Francois IEJA, Wouters PFJ, Broekaert WF, Cammue BPA (2002) A set of modular plant transformation vectors allowing flexible insertion of up to six expression units. Plant Molecular Biology 50: 17-27.
    15. Goel S, Chirgwin J, Francis P, Stuart-Harris R, Dewar J, Mileshkin L, Snyder R, Michael M, Koczwara B (2011) Rational use of Trastuzumab in metastatic and locally advanced breast cancer: Implications of recent research. The Breast 20: 101-110.
    16. Greber, D., Fussenegger, M., 2007. Multi-gene engineering: simultaneous expression and knockdown of six genes off a single platform. Biotechnology and Bioengineering 96: 821–834.
    17. Hellen CUT, Sarnow P (2001) Internal ribosome entry sites in eukaryotic mRNA molecules. Genes and Develop­ment 15: 1593-1612.
    18. Ho SCL, Bardor M, Feng H, Mariati, Tong YW, Song Z (2012) IRES-mediated Tricistronic vectors for enhancing generation of high monoclonal antibody expressing CHO cell lines. Journal of Biotechnology 157: 130-139.
    19. Ho SCL, Bardor M, Li B, Lee JJ, Song Z, Tong YW, Goh LT, Yang Y (2013) Comparison of Internal Ribosome Entry Site (IRES) and Furin-2A (F2A) for Monoclonal Antibody Expression Level and Quality in CHO Cells. Plos One 8(5):1-12.
    20. Jafari M, Norouzi p, Malboobi MA, Ghareyazie B, Valizadeh M, Mohammadi SA, Mousavi M (2009) Enhanced resistance to a lepidopteran pest in transgenic suger beetplants expressing synthetic cry1Ab gene. Euphytica 165: 333-344.
    21. Jostock T, Vanhove M, Brepoels E, van Gool R, Daukandt M, Wehnert A, van Hegelsom R, Dransfield D, Sexton D, Devlin M, Ley A, Mullberg J (2004) Rapid generation of functional human IgG antibodies derived from Fab-onphage display libraries. Journal of Immunological Methods 289: 65–80.
    22. Jung H, Kim JK, Ha SH (2011) Use of Animal Viral Internal Ribosome Entry Site Sequence Makes Multiple Truncated Transcripts without Mediating Polycistronic Expression in Rice. Journal of the Korean Society for Applied Biological Chemistry 54(5): 678-684.
    23. Koh DC, Wong SM, Liu DX 2003. Synergism of the 3'-untranslated region and an internal ribosome entry site differentially enhances the translation of a plant virus coat protein. Journal of Biological Chemistry 278: 20565-20573.
    24. Komar AA, Hatzoglou M (2011) Cellular IRES-mediated translation: the war of ITAFs in pathophysiological states. Cell Cycle 10(2): 229-240.
    25. Komori T, Imayama T,KatoN, Ishida Y,Ueki J,Komari T (2007) Current status of binary vectors and superbinary vectors. Plant Physiol 145: 1155-1160
    26. Leuzinger K, Dent M, Hurtado J, Stahnke J, Lai H, Zhou X, Chen Q (2013) Efficient Agroinfiltration of Plants for High-level Transient Expression of Recombinant Proteins. Journal of Visualized Experiments 77: 1-9.
    27. Li J, Menzel C, Meier D, Zhang C, Dubel S, Jostock T (2007a) A comparative study of different vector designs for the mammalian expression of recombinant IgG antibodies. Journal of Immunological Methods 318: 113-124.
    28. Li J, Zhang C, Jostock T, Dubel S (2007b) Analysis of IgG heavy chain to light chain ratio with mutant Encephalomyocarditis virus internal ribosome entry site. Protein Engineering, Design & Selection 20(10): 491-496.
    29. Li L, Zhou Y, Cheng X, Sun J, Marita JM, Ralph J, Chiang VL (2003) Combinatorial modification of multiple lignin traits in trees through multigene cotransformation. Proceedings of the National Academy of Sciences USA 100: 4939-4944.
    30. Lin YJ, Huang LH, Huang CT (2013) Enhancement of Heterologous Gene Expression in Flammulina velutipes Using Polycistronic Vectors Containing a Viral 2A Cleavage Sequence. Plos One 8(3):1-7.
    31. Lucker J, Schwab W, van Hautum B, Blaas J, van der Plas LH, Bouwmeester HJ, Verhoeven HA (2004) Increased and altered fragrance of tobacco plants after metabolic engineering using three monoterpene synthases from lemon. Plant Physiology 134: 510-519.
    32. Ma JK, Hiatt A, Hein M, Vine ND, Wang F, Stabila P, van Dolleweerd C, Mostov K, Lehner T (1995) Generation and assembly of secretory antibodies in plants. Science 268: 716-719.
    33. Mardanova ES, Zamchuk LA, Skulachev MV, Ravin NV (2008) The 5′ untranslated region of the maize alcohol dehydrogenase gene contains an internal ribosome entry site. Gene 420: 11-16.
    34. Mayani M, McLean MD, Hall JC, Filipe CDM, Ghosh R (2011) Recovery and isolation of recombinant human monoclonal antibody from transgenic tobacco plants. Biochemical Engineering Journal 54: 103-108.
    35. Mountford PS, Smith AG (1995) Internal Ribosome Entry Sites And Dicistronic Rnas In Mammalian Transgenesis. Trends In Genetics 11: 179-184.
    36. Pelletier J, Sonenberg N (1988) Internal initiation of translation of eukaryotic mRNA directed by a sequence derived from poliovirus RNA. Nature 334: 320-325.
    37. Sambrook J, Russell, DW (2001) Molecular cloning: a laboratory manual. Cold Spring Harbor laboratory Press, Cold Spring Harbor, NY, USA.
    38. Sasaki Y, Sone T, Yahata K, Kishine H, Hotta J, Chesnut J.D, Honda T, Imamoto F (2008) Multi-gene gateway clone design for expression of multiple heterologous genes in living cells: Eukaryotic clones containing two and three ORF multi-gene cassettes expressed from a single promoter. Journal of Biotechnology 136: 103-112.
    39. Seitz C, Vitten M, Steinbach P, Hartl S, Hirsche J, Rathje W, Treutter D, Forkmann G (2007) Redirection of anthocyanin synthesis in Osteospermum hybrida by a two-enzyme manipulation strategy. Phytochemistry 68: 824-833.
    40. Shusta EV, Raines RT, Plunkthun A, Wittrup KD (1998) Increasing the secretory capacity of Saccharomyces cerevisiae for production of single-chain antibody fragments. Nature Biotechnology 16: 773-777.
    41. Singla-Pareek SL, Reddy MK, Sopory SK (2003) Genetic engineering of the glyoxalase pathway in tobacco leads to enhanced salinity tolerance. Proceedings of the National Academy of Sciences USA 100: 14672-14677.
    42. Skulachev, MV, Ivanov PA, Parpova OV, Korpela T, Rodionova N P, Dorokhov YL, Atabekov JG (1999) Internal initiation of translation directed by the 5′-untranslated region of the tobamovirus subgenomic RNA I(2). Virology 263: 139-154.
    43. Slater S, Mitsky TA, Houmiel KL, Hao M, Reiser SE, Taylor NB, Tran M, Valentin HE, Rodriguez DJ, Stone DA (1999) Metabolic engineering of Arabidopsis and Brassica for poly (3-hydroxybutyrate-co-3-hydroxyvalerate) copolymer production. Nature Biotechnology 17: 1011-1016.
    44. Sonenberg N, Hinnebusch AG (2009) Regulation of translation initiation in eukaryotes: mechanisms and biological targets. Cell 136: 731-745.
    45. Toth RL., Chapman S, Carr F, Cruz SS, A novel strategy for the expression of foreign genes from plant virus vectors. FEBS Letters 489: 215-219.
    46. Vanderhaeghen R, De Clercq R, Karimi M, Van Montagu M, Hilson P, Van Lijsebettens M (2006) Leader sequence of a plant ribosomal protein gene with complementarity to the 18S rRNA triggers in vitro cap-independent translation. FEBS Lett, 580 (11): 2630-2636.
    47. Zhao JZ, Cao J, Li Y, Collins HL, Roush RT, Earle ED, Shelton AM (2003) Transgenic plants expressing two Bacillus thuringiensis toxins delay insect resistance evolution. Nature Biotechnology 21: 1493-1497.