نوع مقاله: مقاله پژوهشی

نویسندگان

1 دانشگاه آزاد اسلامی، نیشابور

2 دانشگاه آزاد اسلامی - واحد نیشابور- گروه زیست شناسی

چکیده

هندوانه وحشی (Citrullus colocynthis) یک گونه بسیار متحمل به خشکی از خانواده کدوئیان است که در مناطق خشک دنیا از جمله در بیابان‌های منطقه مدیترانه و خاورمیانه پراکندگی دارد. یکی از راهکار‌های احتمالی دخیل در پاسخ تحمل این گیاه، می‌تواند بیان بالای ژن Rboh باشد که محصول پروتئینی آن در تولید ملکول‌های سیگنال ROS نقش دارد. در این پژوهش بیان ژن Rboh تحت تاثیر خشکی در C. colocynthis و هندوانه زراعی مطالعه شد. بذرها پس از ضدعفونی و جوانهزنی در ژرمیناتور به گلدان‌های حاوی ماسه منتقل شدند. گیاهان در مرحله 5 برگی تحت تیمار PEG8000 15% قرار گرفتند و در زمانهای صفر، 3، 9 و 18 ساعت پس از اعمال تیمار میزان نسبی آب برگ‌ها و تغییرات بیان ژن Rboh به روش Real Time PCR مورد بررسی قرار گرفت. نتایج حاکی از کاهش معنی‌دار میزان نسبی آب در برگ‌های هر دو گیاه بود اما این کاهش در هنداونه وحشی به طور قابل توجهی کمتر بود. در پی اعمال تنش خشکی بیان نسبی ژن Rboh در هر دو گونه افزایش یافت اما هندوانه وحشی از سطح بیان بالاتری برخوردار بود. بیان نسبی Rboh که یک نقش مهم در پاسخ به محرک استرس ایفا می‌کند، در هندوانه وحشی با تیمار PEG با سرعت و شدت بیشتری نسبت به هندوانه زراعی القا شد. این نتایج می‌تواند مویدی بر ایفای نقش کلیدی Rboh در تحمل C. colocynthis در برابر تنش خشکی باشد.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Comparative expression of Rboh gene in Citrullus lanatus and Citrullus colocynthis under drought stress

چکیده [English]

Citrullus colocynthis is a very drought tolerant cucurbit species which widely distributed in the deserts of Mediterranean region and Middle East. One of the possible mechanisms involved in the tolerance response of this plant could be overexpression of Rboh gene which its protein product are involved in the production of ROS signal molecules. In this research, Rboh gene expression during drought stress, were studied in C. colocynthis and watermelon. Seeds after sterilization and germination in germinator transfer to pots containing sand and 5 leave plants treated by PEG 8000 15%. At times zero, 3, 9, 18 hours after treatment relative water content of leaves and Quantitative gene expression of Rboh by Real Time PCR method was studied. The results showed a significant decrease in relative water content in both species but in C. colocynthis this decrease was less remarkably. After PEG treatment the expression of Rboh increased in two species but expression level in C. colocynthis was more than watermelon. Expression of Rboh which play an important role in response to stress stimulus, was rapidly and strongly induced by PEG treatment in C. colocynthis rather than C. lanatus. The result can be a confirmation that Rboh Play a critical role in C. colocynthis tolerant against the drought stress.

کلیدواژه‌ها [English]

  • C. colocynthis
  • C. lanatus
  • Real Time PCR
  • RWC
  • Watermelon

مقایسه بیان ژن Rboh در هندوانه زراعی (Citrullus lanatus) و هندوانه وحشی (Citrullus colocynthis) تحت تأثیر تنش خشکی 

نسرین صلاحی، زهرا سلیمانی، اکبر صفی­پور افشار* و فاطمه سعید نعمت پور

نیشابور، دانشگاه آزاد اسلامی، واحد نیشابور، گروه زیست شناسی 

تاریخ دریافت: 23/6/94                تاریخ پذیرش: 4/11/94 

چکیده

هندوانه وحشی (Citrullus colocynthis) یک گونه بسیار متحمل به خشکی از خانواده کدوئیان است که در مناطق خشک دنیا از جمله در بیابانهای منطقه مدیترانه و خاورمیانه پراکندگی دارد. یکی از راهکار‌های احتمالی دخیل در پاسخ تحمل این گیاه، می‌تواند بیان بالای ژن Rboh باشد که محصول پروتئینی آن در تولید مولکولهای سیگنال ROS نقش دارد. در این پژوهش بیان ژن Rboh تحت تأثیر خشکی در C. colocynthis و هندوانه زراعی مطالعه شد. بذرها پس از ضدعفونی و جوانه زنی در ژرمیناتور به گلدانهای حاوی ماسه منتقل شدند. گیاهان در مرحله 5 برگی تحت تیمار PEG8000 15 درصد  قرار گرفتند و در زمانهای صفر، 3، 9 و 18 ساعت پس از اعمال تیمار میزان نسبی آب برگها و تغییرات بیان ژن Rboh به روش Real Time PCR مورد بررسی قرار گرفت. نتایج حاکی از کاهش معنی‌دار میزان نسبی آب در برگهای هر دو گیاه بود اما این کاهش در هنداونه وحشی به طور قابل توجهی کمتر بود. در پی اعمال تنش خشکی بیان نسبی ژن Rboh در هر دو گونه افزایش یافت اما هندوانه وحشی از سطح بیان بالاتری برخوردار بود. بیان نسبی Rboh که یک نقش مهم در پاسخ به محرک استرس ایفاء می­کند، در هندوانه وحشی با تیمار PEG با سرعت و شدت بیشتری نسبت به هندوانه زراعی القاء شد. این نتایج می‌تواند مؤیدی بر ایفای نقش کلیدی Rboh در تحمل C. colocynthis در برابر تنش خشکی باشد.

واژه های کلیدی: میزان نسبی آب، هندوانه زراعی، هندوانه وحشی،  .Real Time PCR

* نویسنده مسئول، تلفن: 09151186887 ، پست الکترونیکی: asafshar@iau-neyshabur.ac.ir 

مقدمه

 

کم آبی مهم ترین تنش محیطی و عامل اصلی کاهش رشد و بازدهی گیاهان است. تحمل به تنش خشکی یک پدیده پیچیده شامل تعدادی فرآیندهای فیزیکوـ بیوشیمیایی است که در طول مراحل مختلف رشد گیاه فعال می‌شوند (12). تولید اکسیژنهای واکنشگر (ROS) در سطح سلول، یکی از اولین وقایع شناخته شده از پاسخهای دفاعی گیاهان است. در طول یک دهه گذشته نقشهای متعددی برای اکسیژنهای واکنشگر شامل سوپراکسید (O2·-)، هیدروژن پراکسید(H2O2) و رادیکالهای هیدروکسیل (HO·) در طول چرخه حیات سلول شناخته شده است (30). مشخص شده که بخشی از این اکسیژنهای واکنشگر در آپوپلاست سلولهای گیاهی تولید می‌شوند تا بتوانند در پاسخ پاتوژن (34)، تغییرات بیوفیزیکی در دیواره سلولی (23) و به عنوان میانجیهای علامت­دهی سیستمی (24) مشارکت کنند.

سوپراکسید آپوپلاستی می­تواند توسط همولوگهای اکسیداز انفجار تنفسی (Rboh) تولید شود. پروتئینهای rboh به دلیل همسان بودن دمین کاتالیک آنها با زیرواحدgp91phox  از Rboh پستانداران نام­گذاری شده‌اند. انتقال الکترون و تولید سوپر­اکسید زمانی رخ می‌دهد که دمین کاتالیک الکترونهای بین سلولی را از NADH یا NADPH گرفته وآنها را به O2 خارج سلولی منتقل می‌کند (15). خانواده ژنی Rboh زیر واحد کلیدی آنزیم NADPH oxidase) Noxs) را کد می‍کند و به همین دلیل گاهی NADPH اکسیداز نامیده می­شود (32). پروتئینهای rboh عامل بخش عمده‌ای از ROS تولید شده در فرآیندهای دفاع در برابر پاتوژن می‍باشند. نقش این پروتئین در فرآیند­های مختلف دیگری، شامل رشد طولی گیاهچه (7) ، رشد راسی ریشه­های موئین (21)، رشد لوله­های گرده (31) ، جوانه زنی بذر (24) و در حسگر‌های مکانیکی (22) شناخته شده است.

بر اساس آخرین یافته ها تاکنون ده Rboh در آرابیدوپسیس شناسایی شده است (6) که عملکرد­هایی در پاسخهای دفاعی گیاهان به استرسهای زیستی دارند (32 و 33). همچنین پروتئین کد شده توسط RbohD، که به طور پیوسته در گیاه آرابیدوپسیس بیان می­شود در علامت‌دهی سیستمی توسط ROS آپوپلاستی، که در اثر زخمی شدن و یا استرسهای غیر­زیستی مثل گرما، سرما، نور شدید، شوری و خشکی راه­اندازی می‌شوند، دخیل هستند (20).

خانواده کدوئیان شامل چندین گونه زراعی مهم اقتصادی مثل هندوانه زراعی، خربزه، خیار، کدو حلوایی، کدو تنبل و کدو قلیایی است (9). برای مقاوم کردن هندوانه زراعی به پاتوژنها، دمای پایین خاک، شوری و استرس کم آبی، این گیاه به پایه گونه­های مقاومی همچون
Cucurbita moschata، C. maxima، پیوند زده می‌شود (36 و 37). یک گونه از این خانواده و از جنس Citrullus که به طور وسیعی در مناطق خشک و بیابانی ایران می‌روید و به خوبی با شرایط استرس کم آبی وفق یافته است، به لحاظ ژنتیکی منبعی غنی برای ارتقاء مقاومت به خشکی می‌باشد و قرابت زیادی با گونه هندوانه زراعی دارد (25). این گونه (C. colocynthis) که به زبان محلی سیب تلخ، کدوی تلخ و هندوانه ابوجهل نیز نامیده می­­شود، گیاهی علفی و چند­ ساله است، منبعی غنی از روغنهای ارزشمند

بوده و یک گیاه دارویی مهم محسوب می‌گردد (27).

با توجه به نقش ژن Rboh در تحمل تنشهای غیرزیستی در گیاهان مختلف و تحمل بالای هندوانه وحشی به تنش خشکی، هدف از این مطالعه بررسی مقایسه‌ای بیان این ژن در هندوانه زراعی و وحشی در شرایط تنش خشکی می‌باشد.

مواد و روشها

مواد گیاهی و تیمارها: بذر گیاه مقاوم به خشکی هندوانه وحشی (C. colocynthis) از منطقه گچساران واقع در استان کهگیلویه و بویراحمد و بذر هندوانه زراعی
(C. lanatus) توده محلی منطقه نیشابور واقع در استان خراسان رضوی تهیه شد. بذرها پس از ضدعفونی جهت جوانه‌زنی در ژرمیناتور با دمای 20 درجه سانتی‌گراد قرار گرفتند. پس از جوانه زنی به گلدانهای حاوی ماسه منتقل شده و در شرایط کنترل شده، فتوپریود 16 ساعت و دمای بین 30-25 درجه سانتی‌گراد نگهداری شدند. آبیاری به صورت روزانه با محلول هوگلند انجام شد. پس از رسیدن به مرحله 5 برگی، گیاهان به طور کامل از گلدانها خارج و به ظروف شیشه‌ای حاوی 200 میلی‌لیتر محلول هوگلند دارای PEG8000 15 درصد  منتقل شدند و در زمانهای صفر، 3، 9 و 18 ساعت پس از اعمال تیمار، ریشه و ساقه گیاهان جداگانه برداشت و جهت آنالیزهای بعدی در فریزر 80- درجه سانتی گراد نگهداری شدند. گیاهان شاهد نیز به محلول مشابه اما فاقد PEG8000 منتقل شدند.

اندازه گیری محتوی نسبی آب (RWC): برای اندازه­گیری محتوی نسبی آب در زمانهای مذکور از آخرین برگ نمو یافته گیاه نمونه برداری و وزن تر (FW) آنها اندازه گیری شد. سپس برای تعیین وزن تورگور (TW) نمونه­های مذکور به مدت 4 ساعت در آب مقطر غوطه­ور شده و سپس وزن آنها اندازه گیری شد. وزن خشک (DW) این نمونه ها پس از قرار گرفتن در آون به مدت 24 ساعت در دمای 70 درجه سانتی گراد، اندازه گیری شد.  RWC طبق فرمول [100× (TW - DW RWC=[(FW – DW)/ محاسبه شد (29).

استخراج RNA و سنتز cDNA:  استخراج RNA کل با استفاده از کیت جداسازی (Intron) eassy BlueTM انجام گرفت. برای حذف DNA ژنومی، RNA استخراج شده با DNase I (Fermentas) و بر اساس دستور العمل شرکت تیمار شد.  ساخت cDNA با کیت Power cDNA Synthesis (Intron)  طبق دستورالعمل شرکت سازنده و با استفاده از  Oligo dT و آنزیم AMV RT انجام شد.

 اندازه­گیری بیان کمی ژن: مقایسات کمی در بیان ژن Rboh به روش Real time SYBER Green PCR و با استفاده از دستگاه ABI Step-One (Applied Biosystems, USA) و نرم افزار اختصاصی دستگاه (Software v2.1) انجام شد. ژن β-actin اختصاصی هندوانه وحشی (GH626171) به عنوان ژن کنترل داخلی استفاده و به طور موازی با ژن هدف تکثیر شد و برای نرمال کردن و کمیت سنجی بیان ژن مورد استفاده قرار گرفت. پرایمرهای مورد استفاده بر اساس نواحی حفاظت شده توالی‌ Rboh هندوانه وحشی (EU580727.2) با استفاده از نرم افزار Becon designer  طراحی شدند. توالی پرایمرهای استفاده شده برای ژن Rboh و β-actin در جدول 1 مشخص شده است. برای هر واکنش 3 تکرار در نظر گرفته شد. حجم مخلوط واکنش برای هر نمونه، 20 میکرولیتر شامل 10 میکرولیتر مخلوط SYBER Green، 3 میکرولیتر از cDNA ساخته شده، 4/0 میکرولیتر از هریک از آغازگرهای اختصاصی پیشرو و پسرو با غلظت 10 میکرومول، 2/6 میکرولیتر آب مقطر استریل فاقد RNase، بود که پس از آماده و لود شدن در چاهکهای پلیت مخصوص به دستگاه ABI منتقل گردید. واکنش زنجیره‌ای پلی مراز با شرایط زیر انجام شد: 10 دقیقه در دمای 95 درجه سانتی گراد و 40 تکرار با چرخه‌های 15 ثانیه در دمای 95 درجه سانتی‌گراد، 15 ثانیه در دمای 60 درجه سانتی‌گراد جهت اتصال پرایمرها به الگو و 30 ثانیه در دمای 60 درجه سانتی‌گراد جهت سنتز cDNA. کمیت سنجی بیان نیز به روش (comparative CT method) ΔΔCT و با تعیین نسبت بیان ژن هدف (Rboh) به ژن کنترل داخلی (β-actin) صورت گرفت:

 

 

ΔΔCT = (CT; rboh -CT; actin) stressed- (CT; Target -CT; actin) control

جدول 1 -  توالی پرایمر‌های استفاده شده در آنالیز‌های Real time PCR

طول قطعه سنتز شده

طول الیگونوکلئوتید

توالی '3 – '5

نام آغازگر

90

18

GAGCGTGTACGAGGAAGG

RBOH (Forward(

19

CGAGTCCCTGATACCACAT

RBOH (Reverse(

90

20

CAACATACATAGCAGGCACA

ACT (Forward(

20

TGACTGAGGCTCCACTCAAC

ACT (Reverse(

 


آنالیز آماری: برای تجزیه واریانس داده‌های به دست آمده از نرم‌افزار SAS نسخه 9.2 استفاده شد. جهت مقایسه میانگینها از آزمون LSD استفاده شد و سطح معنی داری p≤0.05 لحاظ گردید. رسم نمودارها توسط نرم‌افزار (Microsoft office 2013)Excel  انجام شد. جهت آنالیز داده های حاصل از QRT-PCR از نرم افزار دستگاه Real Time PCR استفاده شد.

 

شکل 1 - الکتروفورز محصول واکنش QRT – PCR روی ژل آگارز 2 درصد، خط 1 : خط­کش مولکولی 50bp شرکت Fermentase ، خط2: کنترل منفی β-actin ، خط 3: قطعه تکثیر شده از ژن β-actin به طول 90 جفت باز ، خط 4: کنترل منفی Rboh ، خط 6: قطعه تکثیر شده از ژن Rboh به طول 90 جفت باز

نتایج

QRT-PCR : برای اطمینان از انجام موفق و هدفمند PCR محصول واکنش که به روش QRT-PCR انجام شده بود، روی ژل آگارز 2 درصد بارگیری شد (شکل1). وجود تک باندهای مربوط به قطعات 90 جفت بازی از ژن Rboh و ژن خانه دار β-actin نشان از تکثیر اختصاصی است. همچنین منحنیهای ذوب حاصل از دستگاهReal Time PCR حاکی از تکثیر تنها یک قطعه برای هر کدام از ژنهای فوق و نیز عدم تشکیل پرایمر دایمر در واکنش می‌باشد (شکل 2).

محتوای نسبی آب (RWC): مقدار RWC برگها به طور معنی‌داری در هر دو گونه پس از اعمال تنش، نسبت به گروه شاهد کاهش یافت. همچنین، گذشت زمان نیز بر کاهش مقدار RWC، دارای اثر معنی دار  بود و بیشترین کاهش در زمان‌ 18 ساعت پس از تنش مشاهده شد. محتوی نسبی آب در نمونه­های کنترل C. colocynthis و هندوانه زراعی در زمان صفر حدود 90 درصد بود. پس از تیمار با PEG، محتوی نسبی آب برگ در هر دو گونه کاهش یافت (شکل3). به طوری که پس از 9 ساعت در هندوانه زراعی و وحشی به ترتیب به 50 درصد و 68 درصد رسید. با این حال در C. colocynthis به تدریج RWC در سطح 60 درصد تثبیت شد، درحالی که محتوی نسبی آب برگ هندوانه زراعی با افزایش زمان تیمار به 18 ساعت تا 30 درصد کاهش یافت و در نهایت منجر به پژمردگی برگها شد.

 

 

جدول 2- تجزیه واریانس میزان نسبی آب و بیان نسبی ژن Rboh

 

میانگین مربعات

منابع تغییر

درجه آزادی

میزان نسبی آب

بیان نسبی ژن Rboh

نوع گیاه

1

**04/1457

**28/6

زمان

3

**49/2571

**00/15

نوع گیاه*زمان

3

**6/213

**53/2

خطا

16

96/75

032/0

ضریب تغییرات

 

75/12

50/8

         

* ،** و ns به ترتیب،  معنی‌دار در سطح احتمال 1 درصد، 5 درصد و غیر معنی‌دار

 

       
       

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 


 

 

شکل 2 - منحنی ذوب  محصولات تکثیر شده در واکنش QRT – PCR.  ژن اکتین (سمت راست) و  ژن Rboh (سمت چپ). وجود یک پیک بیانگر تکثیر فقط یک محصول در واکنش می‌باشد.

 

 

 

 

شکل 3- اثر متقابل زمان و نوع گیاه بر میزان RWC . (میانگینها حاصل 3 تکرار و حروف غیر مشترک نشانه اختلاف معنی دار در سطح 5 درصد بر اساس آزمون LSD است. بارها نشان‌دهنده خطای استاندارد می‌باشند.)


بیان نسبی ژن Rboh : پس از اعمال تنش، به طور کلی میزان بیان نسبی ژن Rboh در هر دو گونه افزایش یافت اما رقم وحشی از سطح بیان نسبی بالاتری برخوردار بود و این سطح بیان نسبی در رقم وحشی و به ویژه پس از 9 ساعت  اعمال تنش به طور قابل ملاحظه­ای القاء شد به طوری که در این زمان بیان نسبی ژن Rboh در هندوانه وحشی و زراعی به ترتیب 9/5 و 3 برابر نسبت به شاهد افزایش یافت اما با افزایش زمان تیمار به 18 ساعت کاهش قابل توجه و معنی‌داری در بیان ژن هر دو گونه مشاهده شد (شکل4).

 

 

شکل4-  مقایسه بیان نسبی ژن Rboh در دو گونه C. colocynthis و C. lanatus در زمانهای متفاوت پس از اعمال تنش خشکی (PEG). (حروف غیر مشترک نشانه اختلاف معنی دار در سطح 5 درصد بر اساس آزمون LSD است. بارها نشان‌دهنده خطای استاندارد می‌باشند.)

 

 

 

شکل 5- مقایسه بیان نسبی ژن Rboh در ریشه و ساقه گیاه C. colocynthis در زمانهای متفاوت پس از اعمال تنش خشکی (PEG). (حروف غیر مشترک نشانه اختلاف معنی دار در سطح 5 درصد بر اساس آزمون LSD است. بارها نشان‌دهنده خطای استاندارد می‌باشند.)

 


همچنین بررسی سطوح بیان نسبی ژن Rboh در پی اعمال تنش خشکی (PEG)، حاکی از افزایش بیان نسبی Rboh هم در ریشه ­و هم در ساقه هر دو رقم بود. با این تفاوت که القاء در ریشه زودتر از ساقه رخ داد. بیشترین سطح القاء در ریشه ها در بین زمانهای 3 و 9 ساعت مشاهده شد و پس از آن تا زمان 18 ساعت روند نزولی گردید. در ساقه­ها  نیز بیشترین القاء در زمان 9 ساعت رخ داد اما این میزان در مقایسه با ریشه کمتر بوده و همچنین بین زمان صفر و 3 ساعت میزان القاء کاهش نشان داد (شکل 5).

بحث

مطالعات بسیاری نشان داده‌اند که تولید ROS و فعالیت NADPH oxidase) Nox) در گیاهان تحت تأثیر استرسهای محیطی مختلف شامل خشکی (1، 3 و 4)، ABA، تیمار Ca 2+ (11) و تیمار نیکل (8) القاء می‌شود. همچنین تولید ROS به عنوان یک مکانیسم تنظیمی مهم در درک و پاسخ گیاهان به تنشها بوده (2) و  Nox‌ها به عنوان یک مرکز مولکولی مهم در هنگام علامت دهی وابسته به ROS در پاسخ گیاهان به تنش عمل می‌کنند (19).

پروتئینهای مختلف Nox در آرابیدوپسیس عملکردهای متفاوتی نشان داده‌اند (19). برای مثال، RbohC در رشد راسی ریشه های موئین ایفای نقش می‌کند (31)،  RbohB در بذر، پس از رسیدن آن عمل می­کند (23) و RbohD  و RhohF در پاسخ‌ به پاتوژن و بسته شدن روزنه ها عمل می‌کنند (38). اگرچه مکانیسم عملکرد RbohD و RbohF در پاسخ به تنشها مشابه است، اما مشخص شده RbohD فعالیت بیشتری در تولید ROS دارد (16) که نشان دهنده تنوع در فعالیت آنها است. در ذرت 4 ژن  کد کننده پروتئینهای Nox کلون شده و مشخص شده است که سطح بیان  آنها تحت تأثیر ABA متفاوت می­باشد (17).

در این پژوهش به منظور تأیید القای شرایط تنش خشکی پس از استفاده از PEG محتوای آب نسبی برگ اندازه گیری شد. کاهش RWC برگ گیاهان تیمار شده و تثبیت میزان آن در برگ هندوانه وحشی در سطح 60 درصد و کاهش میزان آن در هندوانه زراعی تا پژمردگی برگها بیانگر این است که C. colocynthis دارای برخی مکانیسمهای مقابله با تنش خشکی می‌باشد.

آنالیز بیان نسبی ژن با استفاده از Real-time PCR در این مطالعه نشان داد که تنش خشکی به طور معنی داری باعث افزایش بیان نسبی ژن‌ Rboh در بخشهای هوایی و ریشه گیاه C. colocynthis شد. به عبارت دیگر خشکی باعث تنظیم مثبت ژن Rboh در این گیاه شده است. هر چند که بیان نسبی این ژن در گیاه  C. lanatus نیز تحت تأثیر خشکی قرار گرفت اما این  افزایش فقط در زمان 9 ساعت بعد از تنش خشکی قابل ملاحظه بوده و در مقایسه با افزایش سطح بیان نسبی در C. colocynthis در همان زمان نیز کمتر بود. تنظیم الگوهای بروز مکانی و زمانی ژنهای ویژه تنش، بخشی مهم از واکنش به تنش در گیاهان است. این مطالعه نشان داد که میزان بیان نسبی ژن‌ Rboh در ریشه و ساقه گیاه C. colocynthis متفاوت است. به طوری که القاء در ریشه ها سه ساعت زودتر رخ داد و بین زمان 3 تا 9 ساعت به بیشترین مقدار خود رسید. در حالی که در ساقه ها بین زمان 9 تا 18 ساعت اوج مقدار بیان نسبی مشاهده شد. که این میزان در مقایسه با ساقه ها نیز رقم کمتری بود. این مشاهدات می‌تواند نشان دهنده وابسته به بافت بودن الگوی بیان ژن در این گیاه باشد. اختلاف وابسته به بافت در الگوی بیان نسخه‌های ژنی تحت تأثیر تنشهای مختلف بین ریشه و ساقه در بسیاری گونه‌های گیاهی گزارش شده است (3، 14 و 18).

در مطالعه‌ای Si و همکاران (2009)  گزارش کردند تغییرات بیان ژن تحت تنش خشکی در ریشه­های گیاه هندوانه وحشی 4 ساعت زودتر از ساقه­ها رخ داد که نشان دهنده واکنش زودتر ریشه­ها به خشکی نسبت به ساقه­ها می­باشد، و ممکن است برخی سیگنالها همچون ABA از ریشه به ساقه منتقل شوند تا بیان ژن را در ساقه­ها تنظیم کنند (28). شناسایی و سهم نسبی سیگنالها در ریشه تحت تأثیر تنش کم آبی هنوز هم بحثی چالش بر انگیز است (35) اما به نظر می‌رسد Rboh به عنوان یک میانجی حساس‌، چند منظوره و قویاً تنظیم شده از سیگنالهای محیطی و رشدی باشد (13).

 برای بالا بردن کیفیت و بازدهی هندوانه زراعی معمولاً آن را به یک گیاه پایه مقاوم پیوند می‌زنند. ویژگیهای ریشه از اولین اولویتها در تعیین تحمل به خشکی در گونه‌های مختلف گیاهان است (5، 10 و 26). با توجه به رویش هندوانه وحشی در مناطق خشک و بیابانی و از آنجایی که در این تحقیق بیان نسبی ژن Rboh در هندوانه وحشی تحت تأثیر تنش خشکی افزایش نشان داد، شاید بتوان از این گیاه به عنوان یک پایه بالقوه برای پیوند به هندوانه زراعی و یا برای بهبود تحمل به خشکی از طریق دستکاری ژنتیکی استفاده کرد.

نتایج این تحقیق می‌تواند گامی در راستای آنالیز عملکردی Rboh و کاربرد آن در ارتقا کیفیت ژنتیکی گیاه در شرایط تنش کم آبی باشد. البته مطالعات بیشتر از جمله تشخیص تنظیم سیستم علامت­دهی که تولید و فعالیت Rboh را کنترل می­­کند، همچنین بررسی میزان بیان این ژن در مراحل مختلف رشد و نمو، دانش نقش بیولوژیکی و عملکرد Rboh در رشد و نمو گیاه و همچنین پاسخ به استرسهای گوناگون زیستی و غیرزیستی را افزایش خواهد داد.

تشکر و قدردانی

این تحقیق با حمایت و پشتیبانی مالی دانشگاه آزاد اسلامی واحد نیشابور انجام شده است که بدین وسیله تشکر قدردانی می­شود.

  1. امینی، ز و حداد، ر (1392) نقش رنگیزه‌های فتوسنتزی و آنزیم‌های آنتی‌اکسیدان در مقابل تنش اکسیداتیو. مجله پژوهش‌های سلولی و ملکولی (زیست شناسی ایران). جلد 26، شماره 3، صفحه 251-265.
  2. فرزانه، م.، معتمد، ن.، رستگار جزی، ف. و ابراهیم زاده، ح. (1393) افزایش بیان ژن P5CS در گیاهچه زیتون تحت تنش شوری. مجله پژوهش‌های سلولی و ملکولی (زیست شناسی ایران). جلد 27، شماره 1، صفحه 119-124.
    1. Baisakh N, Subudhi PK, and Parami NP. (2006) cDNA-AFLP analysis reveals differential gene expression in response to salt stress in a halophyte Spartina alterniflora Loisel. Plant Science. 170(6): 1141-1149.
    2. Duan ZQ, Bai L, Zhao ZG, Zhang GP, Cheng FM, Jiang LX, and Chen KM. (2009) Drought‐Stimulated Activity of Plasma Membrane Nicotinamide Adenine Dinucleotide Phosphate Oxidase and Its Catalytic Properties in Rice. Journal of integrative plant biology. 51(12): 1104-1115.
    3. Fernández-García N, Martínez V, Cerdá A, and Carvajal M. (2002) Water and nutrient uptake of grafted tomato plants grown under saline conditions. Journal of Plant Physiology. 159(8): 899-905.
    4. Foreman J, Demidchik V, Bothwell JH, Mylona P, Miedema H, Torres MA, Linstead P, Costa S, Brownlee C, and Jones JD. (2003) Reactive oxygen species produced by NADPH oxidase regulate plant cell growth. Nature. 422(6930): 442-446.
    5. Frahry G and Schopfer P. (2001) NADH-stimulated, cyanide-resistant superoxide production in maize coleoptiles analyzed with a tetrazolium-based assay. Planta. 212(2): 175-183.
    6. Hao F, Wang X, and Chen J. (2006) Involvement of plasma-membrane NADPH oxidase in nickel-induced oxidative stress in roots of wheat seedlings. Plant Science. 170(1): 151-158.
    7. Hussain AI, Rathore HA, Sattar MZ, Chatha SA, Sarker SD, and Gilani AH. (2014) Citrullus colocynthis (L.) Schrad (bitter apple fruit): a review of its phytochemistry, pharmacology, traditional uses and nutritional potential. Journal of Ethnopharmacology. 155(1): 54-66.
    8. Jensen PJ, Rytter J, Detwiler EA, Travis JW, and McNellis TW. (2003) Rootstock effects on gene expression patterns in apple tree scions. Plant molecular biology. 53(4): 493-511.
    9. Jiang M and  Zhang J. (2003) Cross‐talk between calcium and reactive oxygen species originated from NADPH oxidase in abscisic acid‐induced antioxidant defence in leaves of maize seedlings. Plant, Cell & Environment. 26(6): 929-939.
    10. Kar RK. (2011) Plant responses to water stress: role of reactive oxygen species. Plant Signal Behaveior. 6(11): 1741-5.
    11. Kaur G, Sharma A, Guruprasad K, and Pati PK. (2014) Versatile roles of plant NADPH oxidases and emerging concepts. Biotechnology advances. 32(3): 551-563.
    12. Kawasaki S, Borchert C, Deyholos M, Wang H, Brazille S, Kawai K, Galbraith D, and Bohnert HJ. (2001) Gene expression profiles during the initial phase of salt stress in rice. The Plant Cell. 13(4): 889-905.
    13. Keller T, Damude HG, Werner D, Doerner P, Dixon RA, and Lamb C. (1998) A plant homolog of the neutrophil NADPH oxidase gp91phox subunit gene encodes a plasma membrane protein with Ca2+ binding motifs. The Plant Cell. 10(2): 255-266.
    14. Kimura S, Kaya H, Kawarazaki T, Hiraoka G, Senzaki E, Michikawa M, and Kuchitsu K. (2012) Protein phosphorylation is a prerequisite for the Ca 2+-dependent activation of Arabidopsis NADPH oxidases and may function as a trigger for the positive feedback regulation of Ca2+ and reactive oxygen species. Biochimica et Biophysica Acta (BBA)-Molecular Cell Research. 1823(2): 398-405.
    15. Lin F, Ding H, Wang J, Zhang H, Zhang A, Zhang Y, Tan M, Dong W, and Jiang M. (2009) Positive feedback regulation of maize NADPH oxidase by mitogen-activated protein kinase cascade in abscisic acid signalling. Journal of Experimental Botany. erp157.
    16. Liu X and Baird WV. (2003) The ribosomal small-subunit protein S28 gene from Helianthus annuus (Asteraceae) is down-regulated in response to drought, high salinity, and abscisic acid. American journal of botany. 90(4): 526-531.
    17. Marino D, Dunand C, Puppo A, and Pauly N. (2012) A burst of plant NADPH oxidases. Trends in plant science. 17(1): 9-15.
    18. Miller G, Schlauch K, Tam R, Cortes D, Torres MA, Shulaev V, Dangl JL, and Mittler R. (2009) The plant NADPH oxidase RBOHD mediates rapid systemic signaling in response to diverse stimuli. Science Signaling. 2(84): ra45-ra45.
    19. Monshausen G, Bibikova T, Messerli M, Shi C, and Gilroy S. (2007) Oscillations in extracellular pH and reactive oxygen species modulate tip growth of Arabidopsis root hairs. Proceedings of the National Academy of Sciences. 104(52): 20996-21001.
    20. Monshausen GB, Bibikova TN, Weisenseel MH, and Gilroy S. (2009) Ca2+ regulates reactive oxygen species production and pH during mechanosensing in Arabidopsis roots. The Plant Cell. 21(8): 2341-2356.
    21. Müller K, Carstens AC, Linkies A, Torres MA, and Leubner‐Metzger G. (2009) The NADPH‐oxidase AtrbohB plays a role in Arabidopsis seed after‐ripening. New Phytologist. 184(4): 885-897.
    22. Müller K, Linkies A, Vreeburg RA, Fry SC, Krieger-Liszkay A, and Leubner-Metzger G. (2009) In vivo cell wall loosening by hydroxyl radicals during cress seed germination and elongation growth. Plant Physiology. 150(4): 1855-1865.
    23. Rahimi R, Amin G, and Ardekani MR. (2012) A review on Citrullus colocynthis Schrad.: from traditional Iranian medicine to modern phytotherapy. Journal of  Alternative Complementary Medicine. 18(6): 551-4.
    24. Ruiz JM, Ríos JJ, Rosales MA, Rivero RM, and Romero L. (2006) Grafting between tobacco plants to enhance salinity tolerance. Journal of plant physiology. 163(12): 1229-1237.
    25. Shafaei H, Rad JS, Delazar A, and Behjati M. (2014) The effect of pulp and seed extract of Citrullus Colocynthis, as an antidaibetic medicinal herb, on hepatocytes glycogen stores in diabetic rabbits. Advanced Biomedical Research. 3: 258.
    26. Si Y, Zhang C, Meng S, and Dane F. (2009) Gene expression changes in response to drought stress in Citrullus colocynthis. Plant Cell Report. 28(6): 997-1009.
    27. Smart RE and Bingham GE. (1974) Rapid estimates of relative water content. Plant Physiology. 53(2): 258-260.
    28. Swanson S and Gilroy S. (2010) ROS in plant development. Physiologia Plantarum. 138(4): 384-392.
    29. Takeda S, Gapper C, Kaya H, Bell E, Kuchitsu K, and Dolan L. (2008) Local positive feedback regulation determines cell shape in root hair cells. Science. 319(5867): 1241-1244.
    30. Torres MA and Dangl JL. (2005) Functions of the respiratory burst oxidase in biotic interactions, abiotic stress and development. Current opinion in plant biology. 8(4): 397-403.
    31. Torres MA, Dangl JL, and Jones JD. (2002) Arabidopsis gp91phox homologues AtrbohD and AtrbohF are required for accumulation of reactive oxygen intermediates in the plant defense response. Proceedings of the National Academy of Sciences. 99(1): 517-522.
    32. Torres MA, Jones JD, and Dangl JL. (2006) Reactive oxygen species signaling in response to pathogens. Plant physiology. 141(2): 373-378.
    33. Wi SJ, Kim SJ, Kim WT, and Park KY. (2014) Constitutive S-adenosylmethionine decarboxylase gene expression increases drought tolerance through inhibition of reactive oxygen species accumulation in Arabidopsis. Planta. 239(5): 979-88.
    34. Yetisir H, Çaliskan ME, Soylu S, and Sakar M. (2006) Some physiological and growth responses of watermelon [Citrullus lanatus (Thunb.) Matsum. and Nakai] grafted onto Lagenaria siceraria to flooding. Environmental and experimental botany. 58(1): 1-8.
    35. Yetisir H and Sari N. (2003) Effect of different rootstock on plant growth, yield and quality of watermelon. Animal Production Science. 43(10): 1269-1274.
    36. Zhang Y, Zhu H, Zhang Q, Li M, Yan M, Wang R, Wang L, Welti R, Zhang W, and Wang X. (2009) Phospholipase Dα1 and phosphatidic acid regulate NADPH oxidase activity and production of reactive oxygen species in ABA-mediated stomatal closure in Arabidopsis. The Plant Cell. 21(8): 2357-2377.