نوع مقاله: مقاله پژوهشی

نویسندگان

1 عضو هیات علمی دانشگاه مازندران

2 دانشگاه مازندران

چکیده

امروزه با توجه به آلودگی گسترده محیط زیست به انواع آلاینده‌ها و فلزات سنگین، استفاده از روش‌های نوین، سریع و با کارایی بالا برای تشخیص آلاینده‌ها اهمیت زیادی پیدا کرده است. یکی از روش‌های سنجش سمیت نمونه‌های محیطی، استفاده از باکتری‌های نورافشان برای آزمون سنجش سمیت بر اساس مهار بیولومینسانس می‌باشد. هدف پژوهش حاضر، سنجش سمیت فلزات سنگین با استفاده از باکتری نورافشان جدا شده از دریای مازندران بود. نمونه آب از اعماق مختلف دریای مازندران جمع آوری شد. برای جداسازی باکتری نورافشان، نمونه‌ها در محیط کشت اختصاصی تلقیح و در دمای 28 درجه سانتی‌گراد گرماگذاری شد. رشد و نورافشانی جدایه به روش اسپکتروفتومتری و لومینومتری بررسی شد. سپس سنجش سمیت فلزات سنگین سرب، کادمیوم و مس توسط خاصیت لومینسانس جدایه نورافشان انجام شد. باکتری نورافشان به نام جدایه MM1 از آب دریا جداسازی شد. نتایج بررسی نورافشانی نشان داد که جدایه MM1 توانایی نورافشانی پایدار و با سطح بالا داشت. نور ساطع شده از جدایه‌ی MM1 کاهش قابل توجهی در حضور فلزات سنگین داشت. نتایج نشان داد که جدایه قادر به تشخیص غلظت بسیار پایین فلزات سنگین می‌باشد. مقادیر EC50 برای فلزات سنگین سرب، کادمیوم و مس به ترتیب mgL-1 55/8، mgL-1 46/18 و mgL-1 77/3 سنجیده شد. نتایج مطالعه حاضر نشان داد که فعالیت لومینسانس باکتری نورافشان جدا شده از دریای مازندران به حضور فلزات سنگین حساس بوده و به طور قابل توجهی کاهش یافت. این جدایه می‌تواند برای سنجش سمیت آلاینده‌های زیست محیطی بویژه فلزات سنگین مورد استفاده قرار گیرد.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Toxicity assay of heavy metals Pb, Cd and Cu by luminescent bacterium isolated from the Caspian Sea

نویسنده [English]

  • Mojtaba Mohseni 1

1 University of Mazandaran

چکیده [English]

Due to widespread environmental pollution contaminants and heavy metals, using of modern, fast and high performance methods for detection of contaminants has great significance. One of the methods to assay the toxicity of environmental samples is use of luminescent bacteria for toxicity assay based on bioluminescence inhibition. The purpose of current study was toxicity assay of heavy metals using luminescent bacterium isolated from the Caspian Sea. Water samples were collected from different depth of the Caspian Sea. For isolation of luminescent bacteria, samples were inoculated into specific medium and incubated at 28 °C. Growth and luminescence of isolate were studied using spectrophotometry and luminometry. Then assessment of toxicity of heavy metals including Pb, Cd and Cu was performed using luminescence property of the isolate. Of the sea water a luminescent bacterium was isolated named MM1. The result of bioluminescence investigation revealed that the isolate MM1 can be able to emit steady and high level of light. The light emission of isolate MM1 was significantly decreased in the presence of heavy metals. The results revealed that the isolate was able to detect low concentration of heavy metals. The EC50 values for Pb, Cd and Cu were assayed 8.55, 18.46 and 3.77 mgL-1, respectively. The results of this study demonstrated that luminescence activity of bacterium isolated from the Caspian Sea was sensitive to the presence of heavy metals and was significantly reduced. The isolate can be used for toxicity assay of environmental pollutants especially for heavy metals.

کلیدواژه‌ها [English]

  • Luminescent bacterium
  • Heavy metals
  • toxicity assay
  • Caspian Sea

سنجش سمیت فلزات سنگین سرب، کادمیوم و مس توسط باکتری نورافشان جدا شده از دریای مازندران

مجتبی محسنی1،2* و شیماسادات معقول1

1 بابلسر، دانشگاه مازندران، گروه زیست شناسی سلولی و مولکولی

2 بابلسر، دانشگاه مازندران، گروه پژوهشی نانو و بیوتکنولوژی

تاریخ دریافت: 23/4/94                تاریخ پذیرش: 4/7/94 

چکیده

امروزه با توجه به آلودگی گسترده محیط زیست به انواع آلاینده‌ها و فلزات سنگین، استفاده از روشهای نوین، سریع و با کارآیی بالا برای تشخیص آلاینده‌ها اهمیت زیادی پیدا کرده است. یکی از روشهای سنجش سمیت نمونه‌های محیطی، استفاده از باکتریهای نورافشان برای آزمون سنجش سمیت بر اساس مهار بیولومینسانس می‌باشد. هدف پژوهش حاضر، سنجش سمیت فلزات سنگین با استفاده از باکتری نورافشان جدا شده از دریای مازندران بود. نمونه آب از اعماق مختلف دریای مازندران جمع آوری شد. برای جداسازی باکتری نورافشان، نمونه‌ها در محیط کشت اختصاصی تلقیح و در دمای 28 درجه سانتی‌گراد گرماگذاری شد. رشد و نورافشانی جدایه به روش اسپکتروفتومتری و لومینومتری بررسی شد. سپس سنجش سمیت فلزات سنگین سرب، کادمیوم و مس توسط خاصیت لومینسانس جدایه نورافشان انجام شد. باکتری نورافشان به نام جدایه MM1 از آب دریا جداسازی شد. نتایج بررسی نورافشانی نشان داد که جدایه MM1 توانایی نورافشانی پایدار و با سطح بالا داشت. نور ساطع شده از جدایه‌ MM1 کاهش قابل توجهی در حضور فلزات سنگین داشت. نتایج نشان داد که جدایه قادر به تشخیص غلظت بسیار پایین فلزات سنگین می‌باشد. مقادیر EC50 برای فلزات سنگین سرب، کادمیوم و مس به ترتیب mgL-1 55/8، mgL-1 46/18 و mgL-1 77/3 سنجیده شد. همچنین بررسی توالی ژن 16S rDNA نشان داد که جدایه MM1 دارای 99 درصد هومولوژی با ویبریو هاروِ‌یی (Vibrio harveyi) بود. نتایج مطالعه حاضر نشان داد که فعالیت لومینسانس باکتری نورافشان جدا شده از دریای مازندران به حضور فلزات سنگین حساس بوده و به طور قابل توجهی کاهش یافت. این جدایه می‌تواند برای سنجش سمیت آلاینده‌های زیست محیطی به ویژه فلزات سنگین مورد استفاده قرار گیرد.

واژه‌های کلیدی: باکتری نورافشان، فلزات سنگین، سنجش سمیت، دریای مازندران

* نویسنده مسئول، تلفن: 01135302497، پست الکترونیکی: M.Mohseni@umz.ac.ir

مقدمه 

 

افزایش جمعیت و توسعه  صنایع مختلف و گسترش مناطق کشاورزی باعث ورود حجم بالای آلاینده‌های مختلف به محیطهای آبی می‌شود (4). از میان مواد آلاینده  وارد شده به محیط زیست، فلزات سنگین به علت اثرات سمی و پتانسیل بالای تجمع زیستی قابل توجه هستند (1). اغلب فلزات سنگین مانند سرب و کادمیوم برای متابولیسم بدن مورد نیاز نبوده و حتی مقادیر کم آنها نیز برای بدن مضر هستند (6). سرب در گروه B۲ ترکیبات سرطان‌زای مؤسسه بین المللی تحقیقات سرطان طبقه بندی شده است و هیچ کار ضروری شناخته شده‌ای در فیزیولوژی انسان انجام نمی‌دهد. همچنین سرب به واسطه  نیمه عمر زیستی زیاد می‌تواند در بافتهای بدن تجمع یابد (18 و 25). مهم‌ترین اثر سوء مصرف کادمیوم در انسان بیماری ایتای- ایتای (Itai-Itai) است که اولین بار به علت مصرف برنج آلوده به این فلز در ژاپن گزارش شد (6). از اثرات بالا بودن میزان مس در بافتهای بدن می‌توان به ناراحتیهای شدید مخاطی، صدمات وسیع مویرگی، صدمات کلیوی-کبدی، اختلال در سیستم اعصاب مرکزی و افزایش کلسترول نام برد (18). به طور سنتی، تأثیر آلاینده‌های تخلیه شده به محیط زیست توسط فعالیتهای انسانی، با استفاده از اندازه‌گیریهای شیمیایی یا سنجش‌ پارامتر‌های فیزیکی، ارزیابی می‌شود. در این میان تکنیکهای کروماتوگرافی مایع با کارآیی بالا (HPLC) و طیف سنجی جرمی با فاز حامل گاز gas-MS (Gas Chromatography–Mass Spectrometry) به طور گسترده استفاده می‌شود. محدودیتهایی در استفاده از این روشها وجود دارد که از جمله می‌توان به قیمت بالا، زمان بالای آنالیز و نیز نیاز به اپراتور با تجربه اشاره کرد. علاوه بر اینها اطلاعات به دست آمده از این تکنیکها محدود به غلظت آلاینده‌ها بوده بدون اینکه اطلاعات مربوط به سمیت آنها را نشان دهد. برای غلبه بر محدودیتهای ارزیابی فیزیکوشیمیایی تأثیر آلاینده‌ها، روش زیست سنجی معرفی شده است (7). زیست سنجی شامل آزمونهایی می‌باشد که از موجودات زنده به عنوان شاخص استفاده می‌گردد. این روش به طور گسترده‌ برای شناسایی سمیت مواد شیمیایی و آلودگی محیط زیست به کار گرفته می‌شود (17). زیست سنجی، ارزیابی تغییرات در فیزیولوژی یا رفتار موجودات زنده ناشی از تنشهای القاء شده توسط ترکیبات سمی شیمیایی یا زیستی را ممکن می‌سازد که می‌تواند باعث اختلال سوخت و ساز شود (26). سنجش زیستی بر پایه باکتریها می‌تواند به دلیل پاسخ سریع آن به سموم شیمیایی یا زیستی به عنوان روشهای غربالگری هشداردهنده  اولیه به کار برده شود (8). حساسیت بالا و پاسخ سریع لومینسانس باکتریایی به آلاینده‌های مختلف به عنوان مهارکننده فعالیت زیستی موجب شده است تا این روش را به یک ابزار کارآمد در مقایسه با سایر آزمونهای زیستی برای تعیین مقادیر کوچک آلاینده‌ها تبدیل کند (24). اساس زیست سنجی مهار بیولومینسانس بر پایه تغییرات شدت بیولومینسانس تحت تأثیر مواد سمی است. باکتریهای نورافشان در شرایط مناسب سطوح بالا و پایداری از نور لومینسانس را ساطع می‌کنند که به دلیل این ویژگی منحصر به فردشان در ارزیابی سمیت مورد استفاده قرار می‌گیرند. از این رو، بسیاری از مواد سمی از قبیل آفت‌کشها، علف‌کشها و فلزات سنگین می‌توانند یک تأثیر نمایان و قابل اندازه گیری روی سیستم لومینسانس باکتریایی بگذارند که به عنوان سنسورهای زیستی توسعه داده شده‌اند (9). پارامتر اصلی اندازه‌گیری در زیست سنجی مهار بیولومینسانس، سنجش کاهش نورافشانی می‌باشد (2). از آنجا که لومینسانس باکتریایی به طور مستقیم به تنفس سلولی گره خورده است هر مهار متابولیسم سلولی به علت سمیت، به کاهش در انتشار نور سلولهای تحت تأثیر منتج می‌شود و در نتیجه تغییر در شدت لومینسانس باکتری مورد آزمایش، گواه بر وجود شرایط غیر معمول برای اکوسیستم است (17). مهم‌ترین پارامتر سمیت شناسی در زیست سنجی مهار بیولومینسانس EC50 (Effective concentration) می‌باشد یعنی غلظتی از آلاینده که لومینسانس باکتریایی را حدود ۵۰ درصد کاهش می‌دهد (5). حساسیت بالای سیستم لومینسانس، نتایج سریع، تغییرات کمی دقیق در سطح لومینسانس و راحتی در کار آنالیز موجب شد تا روش زیست سنجی مهار بیولومینسانس برای نظارت زیستی سریع محیط زیست مناسب باشد (2). در این تحقیق باکتری نورافشان از دریای مازندران جداسازی شد و برای اولین بار آزمون سنجش سمیت فلزات سنگین سرب، کادمیوم و مس با استفاده از خاصیت لومینسانس باکتری نورافشان جداشده از دریای مازندران بررسی گردید.

مواد و روشها

نمونه‌برداری، غنی‌سازی و جداسازی باکتریها: نمونه‌های آب دریا از سواحل جنوبی دریای مازندران و از اعماق ۵، ۱۰ و ۱۵ متری در ظروف استریل درب‌دار جمع‌آوری شد و بلافاصله در دمای ۴ درجه سانتی‌گراد، به آزمایشگاه منتقل شد. برای غنی‌سازی باکتریهای نورافشان، از محیط‌ کشت‌ اختصاصی (Sea Water Broth) SWB استفاده شد. این محیط کشت از مخلوط کردن پپتون 5/0 گرم، عصاره مخمر 5/0 گرم، عصاره گوشت 3/0 گرم، سدیم کلراید 4/2 گرم، پتاسیم کلراید 07/0 گرم، منیزیم کلراید 53/0 گرم، منیزیم سولفات 7/0 گرم و کلسیم کلراید 01/0 گرم در 100 میلی‌لیتر آب دیونیزه تهیه شد (2/7-8/6=pH). مقدار یک میلی لیتر نمونه‌ آب دریا به محیط کشت مایع SWB تلقیح و در دمای ۲۸ درجه‌ سانتی‌گراد، گرماگذاری شد. پس از ۲۴ ساعت گرماگذاری، نمونه‌های غنی شده به محیط کشت سفت SWA (محیط کشت مایع SWB حاوی 5/1 درصد آگار) منتقل و در دمای ۲۸ درجه سانتی‌گراد به مدت 24 ساعت گرماگذاری شد. برای بررسی کلنیهای نورافشان، از اتاق تاریک استفاده شد. پس از گذشت چند ثانیه که چشمها به تاریکی عادت کرد، کلنیهای نورافشان مشاهده و جداسازی شد (21). برای تهیه کشت خالص باکتری‌، کلنیهای مجزا نورافشان به محیط کشت تازه  SWA منتقل شد و در دمای ۲۸ درجه سانتی‌گراد، گرماگذاری شد. همچنین مرفولوژی کلنی جدایه روی محیط کشت آگاردار و نیز مرفولوژی و واکنش گرم باکتری به کمک روش استاندارد رنگ آمیزی گرم بررسی شد. جدایه‌ باکتریایی تا انجام مراحل بعدی آزمایش، در گلیسرول 15 درصد و دمای 85- درجه سانتی‌گراد نگهداری شد.

بررسی رشد و نورافشانی جدایه به روش اسپکتروفتومتری و لومینومتری: برای بررسی رشد و نورافشانی جدایه، باکتری در محیط کشت مایع SWB رشد داده شد و در دمای ۲۸ درجه سانتی‌گراد گرمخانه‌گذاری شد. پس از ۱۲ ساعت گرما‌گذاری، مقدار جذب نوری در طول موج 600 نانومتر توسط دستگاه اسپکتروفتومتر (CT-2200 Chrom Tech) با فاصله‌ زمانی دو ساعت اندازه‌گیری شد.

همزمان با بررسی رشد جدایه، نورافشانی باکتری نیز با فاصله‌ زمانی دو ساعت توسط دستگاه لومینومتر (Berthold) اندازه‌گیری شد. برای اندازه‌گیری شدت لومینسانس، حجم یک میلی‌لیتر نمونه در سل مخصوص لومینومتر ریخته شد و شدت لومینسانس جدایه در مدت 60 ثانیه اندازه‌گیری شد. شدت لومینسانس با واحد نسبی لومینسانس RLU (Relative luminescence Unit) اندازه‌گیری می‌شود و متناسب با شدت نور، بر حسب فوتون بر ثانیه محاسبه می‌شود (12).

سنجش سمیت فلزات سنگین با استفاده از بیولومینسانس جدایه نورافشان: برای سنجش سمیت فلزات سنگین، از جدایه نورافشان رشد کرده در محیط کشت مایع SWB استفاده شد. پس از شستشوی سلولهای نورافشان در سرم فیزیولوژی استریل، سوسپانسیون رسوب سلولی در محلول سدیم کلراید دو درصد تهیه شد (10). محلول ذخیره کاتیونهای فلزی شامل کادمیوم نیترات، سرب نیترات و مس سولفات (مرک، آلمان) در آب مقطر تهیه و در تاریکی نگهداری شد. برای انجام سنجش سمیت، حجم ۱/۰ میلی ‌لیتر از سوسپانسیون باکتریایی با ۹/۰ میلی‌لیتر از رقت‌ مختلف فلزات سنگین (تهیه شده در سدیم کلراید دو درصد) مخلوط شد. غلظت نهایی فلزات سنگین در روش سنجش سمیت شامل کادمیوم 00/36، سرب 43/12 و مس 62/7 میلی‌گرم بر لیتر بود. مخلوط باکتری و فلز سنگین به مدت ۱۵ دقیقه در دمای ۱۵ درجه سانتی‌گراد نگهداری شد و کاهش نورافشانی جدایه به کمک دستگاه لومینومتر سنجیده شد (9). سمیت هر فلز سنگین توسط شاخص EC50 (غلظتی از ماده که باعث مهار ۵۰ درصدی بیولومینسانس می‌شود) مورد ارزیابی قرار گرفت. شاخص EC50 به کمک منحنی دُز‌-پاسخ برای کاهش بیولومینسانس باکتریایی نسبت به غلظت فلز سنگین، محاسبه می‌شود (3).

استخراج نوکلئیک اسید و واکنش زنجیره‌ای پلیمراز ژن 16S rDNA: برای شناسایی مولکولی جدایه نورافشان، واکنش زنجیره‌ای پلیمراز (PCR) ژن 16S rDNA انجام شد. ابتدا نوکلئیک اسید جدایه با استفاده از روش استاندارد استخراج شد (20). در این روش از هگزا دسیل ‌تری‌ متیل ‌آمونیوم‌ بروماید (CTAB) برای متلاشی کردن دیواره  سلولی و از محلول فنل: کلروفرم: ایزوآمیل الکل به نسبت 1:24:25 جهت حذف پروتئینها و قند‌ها استفاده شد. همچنین به منظور رسوب نوکلئیک اسید، محلول 30 درصد پلی اتیلن گلیکول و نیز برای شستشو و حذف ناخالصیها، اتانول به کار گرفته شد. سپس تکثیر ژن 16S rDNA با استفاده از واکنش زنجیره‌ای پلیمراز (PCR)، انجام شد (19). برای انجام این واکنش از پرایمر‌های عمومی PA و PH استفاده شد. مشخصات الیگونوکلئوتید‌ پرایمر‌های مورد استفاده در جدول 1 نشان داده شده است. برنامه واکنش زنجیره‌ای پلیمراز ژن 16S rDNA با واسرشت اولیه در دمای ۹۴ درجه سانتی‌گراد به مدت ۵ دقیقه آغاز شد. چرخه  تکثیر شامل ۳۵ چرخه  تکرار شونده با دمای واسرشت ۹۵ درجه به مدت ۱ دقیقه، دمای اتصال50 درجه به مدت ۵/۰ دقیقه و دمای گسترش ۷۲ درجه به مدت ۵/۱ دقیقه بود. پس از اتمام چرخه‌ها و به منظور تکمیل نهایی ساختار DNA تکثیر شده، واکنش به مدت ۵ دقیقه در دمای 72 درجه سانتی‌گراد نگهداری شد. درستی انجام واکنش زنجیره‌ای پلیمراز ژن‌ 16S rDNA، با الکتروفورز ژل آگارز 8/0 درصد رنگ آمیزی شده با اتیدیوم برماید تأیید شد. سپس محصول واکنش زنجیره‌ای پلیمراز با استفاده از کیت تخلیص GeneJET (Thermo Scientific, Lithuania) خالص سازی شد. توالی ژن 16S rDNA توسط شرکتGATC Biotech  آلمان تعیین شد. نتایج توالی نوکلئوتید‌ها مجدداً با استفاده از نرم افزار Chromas Lite (2.01) بررسی شد. شباهت توالی‌ نوکلئوتید‌های ژن 16S rDNA جدایه نورافشان با دیگر توالیهای ثبت شده در پایگاههای اطلاعاتی NCBI و EZtaxonTaxon تعیین شد (13).

 

جدول1- مشخصات و توالی پرایمر‌های عمومی واکنش زنجیره‌ای پلیمراز ژن 16S rDNA (F: پرایمر رفت، R: پرایمر برگشت) (19).

پرایمر

توالی ( 5′→3′)

درصد GC

دمای اتصال پرایمر

(درجه سانتی‌گراد)

محصول PCR (جفت نوکلئوتید)

PA-F

AGAGTTTGATCCTGGCTCAG

50 درصد

50

1500

PH-R

AAGGAGGTGATCCAGCCGCA 

60 درصد

50

1500


شماره دستیابی ژنی توالی 16S rDNA جدایه MM1 در بانک اطلاعاتی: توالی ژن 16S rDNA جدایه MM1 به دست آمده در این پژوهش برای ثبت شماره دستیابی ژنی به بانک ژنی NCBI ارسال شد.

نتایج

جداسازی و بررسی مرفولوژی باکتری‌ نورافشان: پس از غنی‌سازی نمونه‌های آب دریا در محیط کشت مایع SWB و انتقال آن به محیط کشت آگاردار SWA، کلنیهای مجزای نورافشان جداسازی شد. کلنیهای نورافشان در اتاق تاریک نشانه‌گذاری و با انتقال به محیط کشت تازه آگاردار SWA، خالص سازی شد. از میان کلنیها، جدایه با نور‌افشانی بهتر برای مراحل بعدی آزمایش انتخاب شد. این جدایه MM1 نامگذاری گردید. مشخصات کلنی جدایه نور‌افشان MM1 در محیط کشت SWA به صورت کروی با حاشیه  صاف و به رنگ کرم مایل به سفید در شکل 1 نشان داده شد. همچنین نتایج بررسی مرفولوژی به روش رنگ‌آمیزی گرم نشان داد سلولهای جدایه MM1 به صورت میله‌ای کوتاه، منفرد و گرم منفی بود (شکل 1).

 

 

 

الف

ب

 

شکل 1- مرفولوژی کلنی در محیط کشت آگاردار SWA (الف) و سلولهای رنگ‌آمیزی شده به روش گرم (ب) جدایه نورافشان‌ MM1 جداشده از آب دریای مازندران.


بررسی رشد و نورافشانی جدایه MM1: به منظور بررسی رشد جدایه MM1 و توانایی نورافشانی آن، جدایه در محیط کشت مایع SWB رشد داده شد. منحنی رشد باکتری با سنجش جذب نوری آن در طول موج 600 نانومتر در فواصل زمانی مشخص رسم شد. همزمان لومینسانس جدایه نیز مورد بررسی قرار گرفت و منحنی شدت بیولومینسانس جدایه با گذشت زمان رسم گردید. همان طور که در منحنی رشد و شدت بیولومینسانس (شکل 2) نشان داده شده است در 18 ساعت اول رشد باکتری، شدت بیولومینسانس افزایش زیادی نداشته است اما در فاصله زمانی 20-18 ساعت از رشد جدایه، شدت بیولومینسانس به طور چشمگیری افزایش یافت. به‌طوری‌که شدت نسبی لومینسانس در مدت دو ساعت، 49/185 درصد افزایش یافت. سپس در فاصله زمانی 24-20 ساعت رشد، شدت نسبی بیولومینسانس در حدود RLU 103×6/784 ثابت ماند.

سنجش سمیت کاتیونهای فلزی توسط جدایه MM1: برای سنجش سمیت فلزات سنگین سرب، کادمیوم و مس غلظتهای مختلف از فلزات مورد نظر در سدیم کلراید دو درصد تهیه شد و پس از افزودن سوسپانسیون باکتریایی، کاهش بیولومینسانس ثبت شد. نتایج تأثیر غلظتهای مختلف فلز سرب در کاهش بیولومینسانس جدایه MM1 در شکل 3- الف مشاهده می‌شود. این نتایج نشان داد که با افزودن سرب به سوسپانسیون باکتریایی، اثرات سمی آن با کاهش نورتابی جدایه نمایان شد. نتایج شکل 3- الف نشان می‌دهد افزایش غلظت سرب رابطه مستقیم با کاهش نورتابی جدایه دارد. مقدار EC50 یا غلظت مؤثر سرب که باعث کاهش 50 درصد شدت نور بیولومینسانس می‌شود به کمک معادله خط و بر اساس دو پارامتر غلظت فلز و شدت نسبی نورتابی باکتری، mgL-1 55/8  سرب به دست آمد.

منحنی کاهش بیولومینسانس جدایه در حضور فلز کادمیوم (شکل 3- ب) نشان می‌دهد با افزایش غلظت فلز، نورتابی جدایه نیز کاهش یافته و در غلظت mgL-1 46/18 کادمیوم، شدت نورتابی جدایه به نصف کاهش یافت ( mgL-1 46/18=EC50). نتایج نشان می‌دهد با افزایش غلظت کادمیوم، شدت نورتابی جدایه کاهش شدیدی داشت به‌طوری‌که در غلظت mgL-1 00/36 کادمیوم، شدت نورتابی جدایه 44/87 درصد کاهش یافت.

نتایج سنجش سمیت فلز مس در شکل 3- ج نشان می‌دهد کاهش شدت بیولومینسانس جدایه MM1 با افزایش غلظت مس ارتباط مستقیم دارد. نتایج نشان می‌دهد شدت نورتابی جدایه در غلظت mgL-1 62/7 مس، 27/99 درصد کاهش یافت. با توجه به معادله خط در شکل 3- ج، مقدار EC50 فلز مس mgL-1 77/3 مس سنجش شد.

 

 

 

شکل 2- رشد (●) و شدت بیولومینسانس (¢) جدایه MM1 در محیط کشت مایع SWB. داده‌ها نمایانگر میانگین نتایج سه بار تکرار ± انحراف معیار اند (3=n).

 

 

 

 

شکل 3- سنجش سمیت فلز سرب (الف)، کادمیوم (ب) و مس (ج)  به روش زیست سنجی مهار بیولومینسانس جدایه MM1. داده‌ها نمایانگر میانگین نتایج سه بار تکرار ± انحراف معیار اند (3=n).


شناسایی مولکولی جدایه نورافشان MM1: برای شناسایی مولکولی جدایه نورافشان MM1، واکنش زنجیره‌ای پلیمراز ژن 16S rDNA انجام شد. پس از تعیین توالی، با انجام BLAST و مقایسه اطلاعات موجود در بانک ژنی EzTaxon وNCBI ، درصد همولوژی جدایه‌ با سایر باکتریهای بانک اطلاعاتی به دست آمد. نتایج آنالیز تطبیقی توالی با اطلاعاتی که قبلاً وجود داشت، نشان داد که جدایه MM1، دارای بیش از 99 درصد هومولوژی با ویبریو هاروِیی (Vibrio harveyi) بود. همچنین توالی ژن 16S rDNA جدایه نورافشان MM1 به شماره دستیابی ژنی KP732105 در بانک اطلاعاتی NCBI ثبت شد.

بحث

فعالیتهای انسان نظیر ذوب فلزات، استخراج معادن، نیروگاههای صنعتی و نیز استفاده از آفت‌کشها، کود‌های شیمیایی و فاضلابها حاوی فلزات در کشاورزی منجر به آلودگی شدید محیط زیست به انواع آلاینده‌های فلزی شده است (16). در بین آلاینده‌های مختلف زیست محیطی، حضور فلزات سنگین در اکوسیستم مختلف به واسطه سمیت، ماندگاری بالا، تجزیه ناپذیری و همچنین توانایی تجمع در موجودات زنده، مورد توجه قرار می‌گیرد (15). روشهای مختلفی برای سنجش آلاینده‌ها در محیط زیست معرفی شده است اما روش استفاده شده در پژوهش حاضر تحت عنوان استفاده از بیولومینسانس برای مطالعه آلودگی خاک و آب مورد توجه قرار گرفته است. استفاده از باکتریهای لومینسانس برای تشخیص آلودگیهای محیطی نسبت به روشهای دیگر دارای مزایایی است. از جمله مزایای این روش جدید می‌توان به حساسیت بالا، سهولت فرآیند اندازه‌گیری و سرعت عمل و نیز کم هزینه بودن آزمایشات اشاره کرد (14). برای انجام سنجش سمیت توسط ویژگی بیولومینسانس باکتریها، به باکتریهایی با توانایی نورافشانی مطلوب و پایدار نیاز است. از آنجا که بخش اعظم باکتریهای نورافشان دریایی بوده و دریای مازندران دارای تنوع زیستی گسترده از میکروارگانیسم‌ها می‌باشد، در این پژوهش جدایه باکتریایی MM1 با نورافشانی مطلوب و پایدار از دریای مازندران جداسازی شد. نتایج بررسی رشد باکتری و نورافشانی آن نشان داد که رشد جدایه از 12 ساعت افزایش داشت اما لومینسانس MM1 پس از 18 ساعت، شدت یافت. این نتایج نشان می‌دهد که نورافشانی با افزایش رشد باکتری و رسیدن تراکم سلولی به حد آستانه افزایش می‌باید. افزایش بیولومینسانس جدایه بر اساس پدیده حد نصاب احساس (Quorum sensing) در باکتریها قابل توجیه می‌باشد (23).

از آنجا که فلزات سنگین سرب، کادمیوم و مس با فعالیتهای صنعتی به محیط زیست وارد می‌شوند در پژوهش حاضر سنجش سمیت فلزات سنگین به کمک جدایه MM1 انجام گرفت. در پژوهشی مشابه، هونگ و همکاران گونه‌‌ای از فتوباکتریوم را از چین جداسازی و کاربرد آن را در سنجش زیستی سریع مواد شیمیایی سمی موجود در آب بررسی، کردند (9). مقایسه نتایج حاصل از سنجش سمیت فلز مس توسط جدایه  LuB-1 (19) با نتایج حاصل از جدایه MM1 (پژوهش حاضر) نشان داد که مقدار EC50 هر دو جدایه به ترتیب mgL-1 29/2 و mgL-1 77/3 مس بود. این نتایج نشان می‌دهد جدایه MM1 برای سنجش فلز مس دارای حساسیت مطلوبی است.

مقایسه جدایه  MM1 با ویبریو فیشری که به طور متداول برای سنجش سمیت نمونه های محیطی نظیر آب و پساب استفاده می‌شود حساسیت بیشتر جدایه تحقیق حاضر را به بعضی از فلزات سنگین نشان می‌دهد (جدول 2). مقادیر EC50 برگرفته از پژوهشهای مختلف توسط ویبریو فیشری و نتایج جدایه MM1 در جدول 2 مقایسه شده است (2، 11 و 22).

نتایج جدول 2 نشان می‌دهد مقادیر EC50 حاصل از سنجش سمیت تمام فلزات سنگین توسط جدایه MM1 کمتر از نتایج سایر پژوهشها بود به استثنای مقدار EC50 فلز سرب که توسط کاهرو گزارش شد (11). همچنین این نتایج نشان از حساسیت بیش از دو برابری جدایه MM1 به فلز مس نسبت به ویبریو فیشری دارد (2). سنجش سمیت کادمیوم توسط جدایه MM1 نیز حساسیت بیش از دو و پنج برابر در مقایسه با نتایج گزارشات بالیچ و مونکیتریک نشان داد (2 و 22). نتایج سنجش سمیت نشان داد که جدایه MM1، حساسیت بالایی در زیست سنجی فلزات سنگین دارد و قادر به تشخیص مقادیر بسیار پایین از فلزات سنگین می‌باشد.

 

جدول2- مقایسه مقادیر EC50 (mgL-1) فلزات سنگین بر اساس سنجش سمیت توسط جدایه MM1 (مطالعه حاضر) و ویبریو فیشری.

فلز سنگین

جدایه MM1 

ویبریو فیشری 

منبع

سرب

55/8

0/11

6/0

(12)

(25)

کادمیوم

46/18

4/41

0/106

(12)

(26)

مس

77/3

0/8

(12)

پژوهش حاضر، اولین گزارش از سنجش سمیت آلاینده‌های زیست محیطی توسط باکتری نورافشان جدا شده از دریای مازندران به شمار می‌آید. نتایج این تحقیق نشان داد که جدایه‌  MM1 توانایی سنجش سمیت فلزات سنگین به عنوان آلاینده زیست محیطی را دارد و می‌تواند به عنوان گزینه مناسب برای تشخیص سریع فلزات سنگین در نمونه‌های آب، پساب و خاک به کار گرفته شود.

1. Altındağ, A. and Yiğit, S., 2005. Assessment of heavy metal concentrations in the food web of lake Beyşehir, Turkey. Chemosphere. 60(4): 552-556.

2. Bulich, A., Greene, M. and Isenberg, D., 1981. Reliability of the bacterial luminescence assay for determination of the toxicity of pure compounds and complex effluents. Aquatic Toxicology and Hazard Assessment. 4: 338-347.

3. Bundy, J., Wardell, J., Campbell, C., Killham, K. and Paton, G., 1997. Application of bioluminescence‐based microbial biosensors to the ecotoxicity assessment of organotins. Letters in Applied Microbiology. 25(5): 353-358.

4. Cheung, R. Y. and Chan, K., 1999. Metal Concentrations in Tissues of Rabbitfish (Siganus oramin) Collected from Tolo Harbour and Victoria Harbour in Hong Kong. Marine Pollution Bulletin. 39(1): 234-238.

5. Drzyzga, O., Gorontzy, T., Schmidt, A. and Blotevogel, K., 1995. Toxicity of explosives and related compounds to the luminescent bacterium Vibrio fischeri NRRL-B-11177. Archives of Environmental Contamination and Toxicology. 28(2): 229-235.

6. Ebrahimi Sirizi, Z., Sakizadeh, M., Esmaili Sari, A., Bahramifar, N., Ghasempouri, S. M. and Abbasi, K., 2012. Survey of Heavy Metals (Cd, Pb, Cu and Zn) Contamination in Muscle tissue of Esox luciusn from Anzali International Wetland: Accumulation and Risk Assessment. Journal of Mazandaran University of Medical Sciences. 22(87): 57-63 [Persian].

7. Girotti, S., Ferri, E. N., Fumo, M. G. and  Maiolini, E., 2008. Monitoring of environmental pollutants by bioluminescent bacteria. Analytica Chimica Acta. 608(1): 2-29.

8. Gupta, G. and Lin, Y., 1995. Toxicity of methyl tertiary butyl ether to Daphnia magna and Photobacterium phosphoreum. Bulletin of Environmental Contamination and Toxicology. 55(4): 618-620.

9. Hong, Y., Chen, Z., Zhang, B. and  Zhai, Q., 2010. Isolation of Photobacterium sp. LuB‐1 and its application in rapid assays for chemical toxicants in water. Letters in Applied Microbiology. 51(3): 308-312.

10. Kahru, A., Kurvet, M. and Külm, I., 1996. Toxicity of phenolic wastewater to luminescent bacteria photobacterium phosphoreum and activated sludges. Water Science and Technology. 33(6): 139-146.

11. Kahru, A., 1993. In vitro toxicity testing using marine luminescent bacteria (Photobacterium phosphoreum): the Biotox test. Alternatives to Laboratory Animals: ATLA 1993.

12. kelly, C.J., tumsaroj, n. and lajoie, c.a., 2004. Assessing wastewater metal toxicity with bacterial bioluminescence in a bench-scale wastewater treatment system. Water Research. 38: 423-431.

13. Kim, O.S., Cho, Y.J., Lee, K., Yoon, S.H., Kim, M., Na, H., et al., 2012. Introducing EzTaxon: a prokaryotic 16S rRNA gene sequence database with phylotypes that represent uncultured species. International Journal of Systematic and Evolutionary Microbiology. 62: 716-721.

14. Lakzian, A., 2009. Determination of toxicity threshold of zinc and copper for E. coli (as biosensor). Journal of Water and Soil. 23(1): 1-7 [Persian].

15. MacFarlane, G. and Burchett, M., 2000. Cellular distribution of copper, lead and zinc in the grey mangrove, Avicennia marina (Forsk.) Vierh. Aquatic Botany. 68(1): 45-59.

16. McGrath, S. and Lane, P., 1989. An explanation for the apparent losses of metals in a long-term field experiment with sewage sludge. Environmental Pollution. 60(3): 235-256.

17. Medvedeva, S., Tyulkova, N., Kuznetsov, A. and Rodicheva, E., 2009. Bioluminescent Bioassays Based on Luminous Bacteria. Journal of Siberian Federal University. 4: 418-452.

18. Muhammad, S., Shah, M. T.and Khan, S., 2011. Health risk assessment of heavy metals and their source apportionment in drinking water of Kohistan region, northern Pakistan. Microchemical Journal. 98(2): 334-343.

19. Mohseni, M., Abbaszadeh, J. and Nasrollahi-Omran, A., 2014. Radiation resistant of native Deinococcus spp. isolated from the Lout desert of Iran "the hottest place on Earth". International Journal of Environmental Science and Technology. 11(7): 1939-1946.

20. Mohseni, M., Khosravi, F., Mohadjerani, M. and Chaichi, M.J., 2014. Biosorption of lead and copper by heavy metal resistance bacterium using Fourier Transform Infrared Spectrophotometer (FT IR). Medical Laboratory Journal. 8(3): 30-39 [Persian].

21. Mohseni, M. and Salehghamari, M., 2014.  Molecular investigation of luxA gene to identify luminescent bacteria in Caspian Sea. Taxonomy and Biosystematics. 5: 95-104 [Persian].

22. Munkittrick, K., Power, E. and Sergy, G., 1991. The relative sensitivity of Microtox®, daphnid, rainbow trout, and fathead minnow acute lethality tests. Environmental Toxicology and Water Quality. 6(1): 35-62.

23. Platt, T.G. and Fuqua, C., 2010. What's in a name? The semantics of quorum sensing. Trends in Microbiology. 18(9): 383-387.

24. Roda, A., Guardigli, M., Pasini, P. and Mirasoli, M., 2003. Bioluminescence and chemiluminescence in drug screening. Analytical and bioanalytical chemistry. 377(5): 826-833.

25. Shokrzadeh, M. and Shaki, F., 2014. Study of the Amount of Pb, Cd and Cr in Imported Indian Rice to Iran and Tarom rice Produced in the Province of Golestan. Journal of Mazandaran University of Medical Sciences. 23(109): 115-123 [Persian].

26. Urbanczyk, H., Ast, J.C., Kaeding, A.J., Oliver, J.D. and Dunlap, P. V., 2008. Phylogenetic analysis of the incidence of lux gene horizontal transfer in Vibrionaceae. Journal of Bacteriology. 190(10): 3494-3504.