نوع مقاله: مقاله پژوهشی

نویسندگان

1 دانش آموخته کارشناسی ارشد بیوتکنولوژی دانشگاه رازی

2 استادیار گروه زراعت و اصلاح نباتات دانشگاه رازی

چکیده

در این مطالعه با استفاده از روش آنالیز نسبی بیان ژن‎ها به‎کمک تکنیک (qRT-PCR) Quantitative Real Time PCR تاثیر دو سطح تنش خشکی 12 و 16 روزه بر بیان خانواده ژنی‎ رمزکننده آنزیم اس-آدنوزیل-ال‎متیونین: فسفواتانول‎آمین‎ان-متیل‎ترانسفراز (PEAMT) در سه اندام آرابیدوپسیس؛ شامل برگ‌های درحال توسعه، برگ‌های توسعه یافته و ریشه؛ ارزیابی شد. این آنزیم نقش کلیدی در بیوسنتز فسفوکولین دارد. تاکنون یک ژن به ‎طور قطع (AtNMT1) و دو ژن به‎ صورت احتمالی (AtNMT2 و AtNMT3) به عنوان رمزکننده آنزیم‎های خانواده PEAMT در آرابیدوپسیس معرفی شده‎اند. رفتار این سه ژن در مواجهه با تنش خشکی متفاوت بود. درحالیکه بیان ژن AtNMT2 چندان متاثر از تنش و نوع اندام نبود، بیان دو ژن AtNMT1 و AtNMT3 بسیار به این عوامل وابسته بودند. بیان AtNMT1 در پاسخ به 12 روز قطع آبیاری در برگ‎های درحال توسعه و توسعه یافته کاهشی تقریبا 8/0 برابری داشت، اما بیان آن در ریشه تا حدود 5/4 برابر شاهد افزایش یافت. پس از 16 روز قطع آبیاری بیان این ژن در برگ‎های در حال توسعه تقریبا 5/2 برابر افزایش یافت و در ریشه با کاهش روبرو و به سطح شاهد بازگشت. بیان ژن AtNMT3 در 12 و 16 روز قطع آبیاری، به رغم عدم تغییر و کاهش در اندام‎های هوایی، به ترتیب در حدود 5/3 و 9 برابر در ریشه افزایش یافت. به نظر می‎رسد AtNMT3 احتمالا ژن حساس ‎به خشکی در ریشه است. به‎طور کلی، شاید بتوان گفت که دو ژن AtNMT1 و AtNMT3 ایزوفرم‎های موثر رمزکننده آنزیم‎های PEAMTدر شرایط مواجهه با تنش خشکی در آرابیدوپسیس هستند.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Monitoring the Expression Pattern of Genes encoding S-adenosyl-L-methionine:phosphoethanolamine N-methyltransferase (PEAMT) enzyme in Arabidopsis under Drought Stress

نویسندگان [English]

  • Zahra Zangishei 1
  • Hooman Salari 2

2 assistant profesor of Razi University

چکیده [English]

In this study we use relative expression analysis via quantitative Real-Time PCR to evaluate the effects of drought on the expression pattern of genes coding for the enzyme S-adenosyl-L-methionine: phosphoethanolamine N-methyltransferase (PEAMT) in Arabidopsis thaliana. Tissues including fast-expanding leaves, fully expanded leaves, and roots have been considered. PEAMT plays a key role in the biosynthesis of phosphocholine. According to the Arabidopsis thaliana genome database (TAIR) there is one known gene At3g18000 (AtNMT1) and two putative genes At1g48600 (AtNMT2) and At1g73600 (AtNMT3) coding for the PEAMT enzyme. The tissue mRNA induction level of AtNMT1and AtNMT3 genes varied in response to drought levels, while AtNMT2 gene expression was affected negligibly by these factors. While withholding water for 12 days reduced the expression level of AtNMT1 in fast expanding and fully expanded leaves by about 0.8 folds, the expression level of the gene increased in roots by about 4.5 folds. In contrast, after 16 days without watering, the expression level of AtNMT1 rose about 2.5 folds and reduced to the level of control in fast expanding leaves and roots, respectively. The expression pattern of AtNMT3 suggests that AtNMT3 may be a drought responsive gene in roots. AtNMT3 expression in roots increased about 3.5 and 9 folds in response to 12 and 16 days of water deficit, respectively, despite the lack of changes and/or reduction in leaves. We conclude that the genes AtNMT1 and AtNMT3 may influence the response to drought stress in Arabidopsis.

کلیدواژه‌ها [English]

  • Arabidopsis thaliana
  • drought stress
  • S-adenosyl-L-methionine: phosphoethanolamine N-methyltransferase
  • phosphatidylcholine
  • qRT-PCR

اثر تنش خشکی بر بیان ژنهای کدکننده آنزیم اس-آدنوزیل-المتیونین: فسفواتانولآمینان-متیلترانسفراز (PEAMT) در آرابیدوپسیس

زهرا زنگیشه‎ای و هومن سالاری*

کرمانشاه، دانشگاه رازی، پردیس کشاورزی و منابع طبیعی

تاریخ دریافت: 11/6/94                تاریخ پذیرش: 16/9/94

چکیده

در این مطالعه با استفاده از روش آنالیز نسبی بیان ژنها به‎کمک تکنیک (qRT-PCR) Quantitative Real Time PCR تأثیر دو سطح تنش خشکی 12 و 16 روزه بر بیان خانواده ژنی‎ رمزکننده آنزیم اس-آدنوزیل-ال‎متیونین: فسفواتانول‎آمین‎ان-متیل‎ترانسفراز (PEAMT) در سه اندام آرابیدوپسیس؛ شامل برگهای درحال توسعه، برگهای توسعه یافته و ریشه؛ ارزیابی شد. این آنزیم نقش کلیدی در بیوسنتز فسفوکولین دارد. تاکنون یک ژن به ‎طور قطع (AtNMT1) و دو ژن به‎ صورت احتمالی (AtNMT2 و AtNMT3) به عنوان رمزکننده آنزیمهای خانواده PEAMT در آرابیدوپسیس معرفی شده‎اند. رفتار این سه ژن در مواجهه با تنش خشکی متفاوت بود. درحالی که بیان ژن AtNMT2 چندان متأثر از تنش و نوع اندام نبود، بیان دو ژن AtNMT1 و AtNMT3 بسیار به این عوامل وابسته بودند. بیان AtNMT1 در پاسخ به 12 روز قطع آبیاری در برگهای درحال توسعه و توسعه یافته کاهشی تقریباً 8/0 برابری داشت، اما بیان آن در ریشه تا حدود 5/4 برابر شاهد افزایش یافت. پس از 16 روز قطع آبیاری بیان این ژن در برگهای در حال توسعه تقریباً 5/2 برابر افزایش یافت و در ریشه با کاهش روبرو و به سطح شاهد بازگشت. بیان ژن AtNMT3 در 12 و 16 روز قطع آبیاری، به رغم عدم تغییر و کاهش در اندامهای هوایی، به ترتیب در حدود 5/3 و 9 برابر در ریشه افزایش یافت. به نظر می‎رسد AtNMT3 احتمالاً ژن حساس ‎به خشکی در ریشه است. به‎طور کلی،  شاید بتوان گفت که دو ژن AtNMT1 و AtNMT3 ایزوفرمهای مؤثر رمزکننده آنزیمهای PEAMT در شرایط مواجهه با تنش خشکی در آرابیدوپسیس هستند.

واژه های کلیدی: آرابیدوپسیس تالیانا، تنش خشکی، اس-آدنوزیل-ال‎متیونین: فسفواتانول‎آمین‎ان-متیل‎ترانسفراز، فسفاتیدیل‎کولین،qRT-PCR

* نویسنده مسئول، تلفن: 38324929-083، پست الکترونیکی: hsalari@yahoo.com

مقدمه

 

ترکیب شیمیایی فسفوکولین به خاطر پیش‎سازی فسفاتیدیل‎کولین و کولین در گیاهان و جانوران اهمیت بسیار دارد. فسفاتیدیل‎کولین فسفولیپید عمده در غشای سلولهای یوکاریوتی است (7 و 17). علاوه بر نقش مهم به‎ عنوان جزئی از غشای سلولی، فسفاتیدیل‎کولین دارای عملکرد حیاتی در سیگنالینگ سلولی نیز می‎باشد. پژوهشها نشان داده‎اند که فسفاتیدیکاسید که یکی از مشتقات فسفاتیدیل‎کولین می‎باشد، یک مولکول سیگنالینگ است که به عنوان پیغامبر ثانویه در انواع فرآیندهای سلولی و پاسخ به تنشها عمل می‎کند (35). کولین، ترکیب دیگری است که از فسفوکولین حاصل می‎شود. این ترکیب به جهت پیش‎سازی گلایسین‎بتائین که از متابولیتهای حیاتی در گیاهان به شمار می‎رود، اهمیت زیادی دارد. به طوری که در کنار اهمیت کولین در واکنش گیاه به تنشها، این ماده در راستای بهبود ارزش غذایی گیاهان نیز مورد توجه است. در گیاهان و برخی از یوکاریوتها کولین همچنین می‎تواند به عنوان پیش‎ساز فسفاتیدیل‎کولین مورد استفاده قرار گیرد (16).

بیوسنتز فسفاتیدیل‎کولین در گیاهان با سایر یوکاریوتها متفاوت به نظر می‎رسد. گزارشهایی مبنی بر وجود مسیرهای مختلف بیوسنتز فسفوکولین وجود دارد، اما شواهد مختلف نشان داده‎اند که آنزیم اس-آدنوزیل-ال‎متیونین: فسفواتانول‎آمین‎ان-متیل ‎ترانسفراز (PEAMT) مهم‌ترین آنزیم کنترل ‎کننده در تمامی این مسیرهاست. مک نیل و همکاران در سال 2001 نشان داده اند که ان-متیلاسیون فسفو‎اتانول‎آمین، رخداد اصلی کنترل در مسیر بیوسنتز فسفاتیدیل‎کولین می‎باشد که توسط آنزیم PEAMT تسهیل می‎گردد (16). سپس دو ان-متیلاسیون متوالی رخ می‎دهد که نتیجه آن به ترتیب فسفو-دی‎متیل‎اتانول‎آمین و فسفوکولین است (شکل 1)(25). تسهیل دو متیلاسیون اخیر نیز همچون متیلاسیون نخست توسط آنزیم PEAMT انجام می‎شود (2 و20 و 28). همان طور که پیشتر اشاره شد،  به طور کلی می‎توان گفت که آنزیم PEAMT و فعالیت آن مهم‌ترین عامل کنترل بیوسنتز فسفاتیدیل‎کولین و سایر مشتقات این ماده آلی است (7، 8، 16، 19، 20و 32). بررسی فعالیتهای آنزیمی در گیاهان مختلف مسیرهای جایگزین دیگری را هم برای بیوسنتز فسفاتیدیل‎کولین پیشنهاد داده ‎است (15 و 29) اما تاکنون درباره شواهد ژنتیکی که مستقیماً این مسیرها را به اثبات برساند گزارشی ارائه نشده است. پس از تولید فسفو‎کولین، سنتز فسفاتیدیل‎کولین از طریق CDP-کولین (مسیر کندی) و توسط دو آنزیم CCT-فسفوکولین ‎سیتیدیل ‎ترانسفراز (CCT) و آمینوالکل‎فسفوترانسفراز (AAPT) کاتالیز می‌شود (11). علاوه ‎بر تولید فسفاتیدیل‎کولین، کولین هم می‎تواند در ادامه این مسیر تولید شود (15 و 25).

در شرایط تنش، کولین توسط آنزیمهای کولین‎مونواکسیژناز (CMO) و بتائین‎آلدهیددهیدروژناز (BADH) در کلروپلاست‎ها اکسید شده و به گلایسین‎بتائین تبدیل می‎شود. گلایسین‎بتائین از محلولهای سازگاری است که به عنوان تنظیم کننده‎های اسمزی غیرسمی در سیتوپلاسم شناخته می‎شوند. این ترکیبات در بسیاری از گیاهان در پاسخ به اثرات سوء تنشهای غیرزیستی سنتز و انباشت می‎یابند (5، 24 و 33).

 

 

شکل 1- مسیر متابولیکی بیوسنتز فسفوکولین، کولین، فسفاتیدیل‎کولین و گلایسین‎بتائین در گیاهان عالی (براساس سالاری، 2008)

 

مطالعات مختلف نشان داده‎اند ‎که فسفاتیدیل‎کولین ممکن است در پاسخ گیاه به تنشهای غیرزیستی، به ویژه در گونه‎هایی که قادر به انباشت گلایسین‎بتائین نیستند، ایفای نقش کند. برای نمونه نشان داده شده که در طی سازگاری به سرما، کمیت و سهم نسبی فسفاتیدیل‎کولین نسبت به دیگر لیپیدها افزایش می‎یابد (4، 9، 10، 12 و 14). طبق بررسی صورت گرفته، غلظت فسفاتیدیل‎کولین با درجه تحمل یخ زدگی در 13 رقم سرما دیده گندم همبستگی نشان ‎داده است (9). همچنین محتوای فسفاتیدیل‎کولین روزت آرابیدوپسیس در روز اول و چهارم بعد از قرار‌گرفتن گیاه در سرمای 2 درجه سانتی گراد به ترتیب به میزان 15 و 26 درصد افزایش یافته است (10). گزارشهایی وجود دارند که نشان می‌دهند تحمل یخ‎زدگی با تغییر در مقدار و درجه غیراشباعیت چندگانه فسفاتیدیل‎کولین همبستگی دارد (12 و 27). مطالعات دیگری درباره نقش فسفاتیدیل‎کولین در تنشهای شوری و اسموتیک انجام شده است. پیکال و همکارانش (1999) نشان دادند که، در سلولهای کشت سوسپانسیونی آرابیدوپسیس مقدار فسفاتیدیل‎کولین پس از تیمار با 400 میلی مولارNaCl  در حدود 35 برابر افزایش یافته است. این درحالی بود که، تیمار با سوربیتول (800 میلی مولار) محتوای فسفاتیدیل‎کولین را متأثر نساخت (22).

گزارشهایی درباره رفتار ژنهای کدکننده آنزیمهای خانواده PEAMT که عامل مهم و اصلی در کنترل مسیر بیوسنتز فسفوکولین و سایر مشتقات این ماده آلی است، در پاسخ به تنشهای غیرزیستی ارائه شده است. خاموش‌کردن ژنهای خانواده AtNMT - کدکننده آنزیمهای خانواده PEAMT - در آرابیدوپسیس به نرعقیمی حساس به دما و همچنین حساسیت شدید به نمک منتج شده است (18). آنالیز بیان ژنهای خانواده فوق الذکر به روش نورترن بلاتینگ، نشان داد که شش ساعت پس‎از تیمار سرمایی بیان کاهش می‏یابد، ولی 48 ساعت بعد به سطح نرمال باز می‎گردد (30). براساس گزارش‎ صورت گرفته توسط چرن و همکاران (2002)، تجمع رونوشتهای ژن PEAMT گندم پس از تیمار با آبسیزیک اسید و قرار گرفتن در معرض شوری، تنش رطوبتی و دمای پایین در سطوح بالایی صورت می‎گیرد. فعالیت ویژه آنزیم نیز 5 برابر پس از شش روز تنش سرمایی، 4 برابر بعد از افزودن نمک، 3 برابر پس از تیمار با آبسیزیک اسید و حدود 1 برابر پس از اعمال تنش آبی افزایش یافت. علاوه بر این، رابطه مثبت و معنی‌داری بین ظرفیت انطباق با سرما و تجمع رونوشتهای PEAMT در طیف وسیعی از ارقام مختلف گندم مشاهده شد (4). آنالیز RT-PCR صورت گرفته توسط وو و همکاران (2007) هم حاکی‎از القای بیان ژن PEAMT ذرت در شرایط تنش شوری و عدم بیان در دمای بالا بود. بیش بیانی این ژن در آرابیدوپسیس افزایش تحمل شوری، طول ریشه و تعداد سیلیک‎ را به‎دنبال داشت (34).

براساس اطلاعات موجود در پایگاه داده ژنوم آرابیدوپسیس تالیانا (تارنمای TAIR) تاکنون یک ژن به ‎طور قطع ((AtNMT1)  (At3g18000و دو ژن به صورت احتمالی At1g48600 (AtNMT2)) و At1g73600 (AtNMT3)) آنزیمهای خانواده PEAMT را در گیاه آرابیدوپسیس کد می‏کنند. مطالعه الگوی بیان کمی این ژنها در شرایط بدون تنش نشان داد ‎که همه اعضای این خانواده در هر دو بخش ریشه و اندام هوایی بیان می‌شوند، اما میزان بیان آنها متفاوت است (26). براساس این مطالعه، AtNMT3 ایزوفرم غالب در برگ آرابیدوپسیس گزارش شد، به طوری ‌که بیان آن به ترتیب 17 و 2 برابر بیشتر از میزان بیان AtNMT1 و AtNMT2 در این اندام بود. درمقابل، AtNMT2 ایزوفرمی بود که بیشترین بیان را در ریشه نشان داد؛ این درحالی بود که میزان بیان دو ایزوفورم AtNMT1 و AtNMT3 در مقادیر قابل مقایسه‎ای از برگ پایین‎تر بود.

با وجود آنکه اثرات تنشهای‏ غیرزیستی بر عملکرد، ویژگیهای رشدی و فیزیولوژیک گیاهان به ‎فراوانی مورد بررسی قرار‎ گرفته است‎، اما تأثیر اولیه این تنشها بر رفتارهای بیوشیمیایی و مولکولی به خوبی مطالعه نشده ‎است. لذا به نظر می‎رسد آگاهی از پاسخهای مولکولی گیاهان به تغییر محیط پیرامون و تنشهای غیرزیستی یکی از حوزه‎های مهم در پژوهشها به ‎شمار می‎رود. این آگاهی می‎تواند منجر به به کارگیری فناورهای زیستی به منظور ایجاد ارقام متحمل به تنشها گردد. بر‎اساس اطلاعات در‎ دسترس تاکنون ‌از چگونگی تغییر در بروز سه ژن‎ AtNMT1،  AtNMT2و AtNMT3 بر ‎اثر قطع آبیاری درگیاه آرابیدوپسیس، به عنوان مهم‎ترین گیاه مدل در بررسیهای زیست شناسی و زیست فناوری، گزارشی منتشر نشده است. از سوی دیگر، هرگونه دست‎کاری ژنتیکی در ژنهای کدکننده این آنزیم در مسیر متابولیکی مربوطه پیش‎تر نیازمند پاسخ به این پرسش است ‎که آیا بروز این ژنها متأثر از وقوع تنشها می‎باشد یا خیر؟ در مطالعه حاضر برای نخستین بار تلاش شده است تا با بهره‎گیری از روش آنالیز نسبی بیان ژنها به‎کمک تکنیک qRT-PCR، چگونگی تأثیر دو دوره قطع آبیاری بر بروز این ژنها در سه اندام گیاه آرابیدوپسیس تالیانا شامل برگهای درحال توسعه، برگهای توسعه یافته و ریشه مورد ارزیابی قرار گیرد.

مواد و روشها 

آزمایشهای این پژوهش در آزمایشگاههای تحقیقاتی پردیس کشاورزی و منابع طبیعی دانشگاه رازی کرمانشاه انجام شد. اکوتیپ Col-0 گیاه آرابیدوپسیس تالیانا، مورد استفاده قرار گرفت. بذور مربوطه از پژوهشگاه ملی مهندسی ژنتیک و بیوتکنولوژی ایران تهیه شد. بذور مطابق روش پیشنهادی ویگل و همکاران (2002) ضد عفونی شدند (31). بذور ضدعفونی شده به مدت 48 ساعت در تاریکی کامل و دمای 4 درجه سانتی گراد سرمادهی و در یک نوبت کشت شدند. گلدانهایی به قطر و ارتفاع نه سانتیمتر از جنس پلی اتیلن شفاف و با گنجایش تقریبی 170 گرم خاک مورد استفاده قرار گرفت. خاک مورد استفاده نسبت مساوی حجمی از ورمیکولایت سایز 3-0 (کاندیس- ایران) و پیت ماس (ای دی فری پیت- هلند) و 2 گرم به‎ازای هر لیترخاک، کود آماده اگرویت (آگلوکن- آلمان) بود. در هر گلدان پنج بذر کشت و در دو نوبت (درمرحله 4-3 برگی) از‎ طریق تنک‎کردن به یک گیاه در هر گلدان کاهش یافت. گلدانها در سینیهایی به ابعاد 50×25×9 سانتیمتر و در اتاقک رشدی با دمای 25 درجه سانتی گراد، رطوبت نسبی 30 درصد، شدت نور 120 میکروانشتین (لامپ فلوئورسنت سفید) و طول روز 10 ساعت که در اواخر مرحله رشد به تدریج به 12 ساعت رسانیده شد، نگهداری شدند. آبیاری از کف و با آب شرب شهری انجام شد. بدین منظور هشت سوراخ با فاصله مساوی در لبه مماس بر ته هر گلدان تعبیه شد. آبیاری تا رسیدن به ظرفیت زراعی، هر چهار روز یکبار انجام گرفت. تنش خشکی از هفته هفتم و در دو سطح  قطع کامل آبیاری به مدت 12 روز (خشکی سطح 1) و قطع کامل آبیاری به مدت 16 روز (خشکی سطح 2) اعمال شد. پس از اعمال تنش نمونه‏گیری انجام شد (شکل 2). از تیمار شاهد متناظر با هر سطح تنش همزمان با تیمار تنش مربوطه نمونه‎گیری به عمل آمد. نمونه‎ها بلافاصله در ازت مایع منجمد و تا زمان استفاده در فریزر 80- درجه سانتی گراد نگهداری شدند. سه اندام‎ مورد مطالعه شامل برگهای درحال توسعه، برگهای توسعه یافته و ریشه، بود. هر نمونه آزمایشی متشکل ‎از بالک (مخلوط) اندام مدنظر از دو گیاه مجزا در نظر گرفته شد.

از روش پیشنهادی بوتلا و همکاران (1992) برای استخراج RNA استفاده شد (3). کیفیت RNA‎های حاصل با بارگذاری در ژل آگارز 8/0 درصد بررسی شد. مقدار کمی RNA با استفاده ‎از دستگاه نانودراپ (NanoDrop 2000c, Thermo Scientific, USA) و بررسی جذب در طول موجهای 260 و 280 نانومتر تعیین شد. آغازگرهای مورد استفاده از طریق نمایه pick primers در سایت NCBI طراحی شد (جدول 1). محل آغازگرها تا حد امکان نزدیک به انتهای '3 انتخاب شدند. طراحی آغازگرها به نحوی انجام شد که حداقل یکی‌از دو آغازگر رفتی یا برگشتی در نواحی اگزون پیشین- اگزون پسین قرار گیرد تا از تکثیر غیراختصاصی ناشی‎از آلودگیهای ژنومی جلوگیری شود. بازده تکثیر آغازگرها با استفاده از منحنیهای استاندارد و نیز رگرسیون خطی منحنی تکثیر نرم‎فزار LinRegPCR (23) بررسی شدند.

 

 

 

شکل 2- وضعیت نمونه‌های آرابیدوپسیس در روز نمونه‌گیری. خشکی سطح 1(D1) و کنترل خشکی سطح 1 (CD1). خشکی سطح 2 (D2) و کنترل خشکی سطح 2 (CD2). مقیاس (اندازه خط افقی) = cm5/4

 

برای این هدف یک سری رقت 10 واحدی (25 نانوگرم تا 25 پیکوگرم) از یکی از نمونه‎های ‎ RNA آماده شد. راندمان پرایمرها براساس رابطه E = 10(-1/slope)-1 محاسبه شد (21). این روش همچنین جهت تعیین غلظت مطلوب RNA در آنالیزهای qRT-PCR به کار رفت و غلظت 25 نانوگرم به‌ عنوان مقدار مطلوب RNA در واکنشهای بعدی تعیین شد. بیان کمی ژنها به روش qRT-PCR با استفاد‎ه ‌از کیت تک مرحله‎ایSG OneStep qRT-PCR (EURx, Poland)  و در دستگاه ترموسایکلر Rotor-GeneQ, Corbett Research, Australia) ) اندازه گیری شد. براساس پروتکل پیشنهادی شرکت سازنده در برنامه واکنش ابتدا یک مرحله 30 دقیقه‎ای در دمای 50 درجه سانتی گراد جهت رونویسی معکوس درنظر گرفته ‎‌شد. سپس qRT-PCR با یک مرحله واسرشت ‎سازی اولیه در دمای 95 درجه سانتی گراد به مدت 3 دقیقه شروع و پس ‎از آن 40 سیکل شامل سه مرحله متوالی 94 درجه سانتی گراد به مدت 15 ثانیه، 55 درجه سانتی گراد به مدت 30 ثانیه و 72 درجه سانتی گراد به مدت 20 ثانیه انجام شد. در پایان و به منظور دستیابی به منحنی‏ ذوب، آغازگرها در محدوده دمایی 95-60 درجه سانتی گراد طی یک مرحله ذوب شدند. بررسی کیفیت آغازگرها و اختصاصی بودن تکثیر محصول هدف، بعد از هر دور qRT-PCR و به کمک تجزیه منحنیهای ذوب انجام شد. مقادیر چرخه آستانه (CT) به روش Fit Point توسط نرم‎افزار دستگاه rotor-gene_1_7_87)) و براساس منحنیهای استاندارد تولید شده، تعیین شد. در وارد کردن داده‎ها و انجام تجزیه‎های آماری، میانگین مقادیر CT حاصل ‌از 3 تکرار فنی برای هر نمونه‎ به کار گرفته شد. از میانگین ژئومتریک مقادیر CT سه ژن‎ مرجع AtPDF2، AtUBC9 و AtYLS8 برای نرمال کردن داده‎‎ها، استفاده شد (6). دو روش غیرمبتنی ‎بر تصحیح راندمان 2^-ΔΔCT (13) با کمک نرم‎ افزار آفیس 2010 در محیط اکسل و روش مبتنی ‎بر تصحیح راندمان پافل در نرم‎ افزار REST 2009 (21) جهت آنالیز داده ها مورد استفاده قرار گرفتند.

نتایج  

نتایج بررسی به روش غیرمبتنی ‎بر تصحیح راندمان 2^-ΔΔCT در شکل 3 نشان داده شده است. بررسی بیان ژن ‎AtNMT1 در اندامهای مورد مطالعه نشان‎ داد‎ که 12 روز قطع آبیاری بیان این ژن را در برگهای درحال توسعه و توسعه یافته به صورت معنی‎دار و به ترتیب به میزان 80 و 90 درصد ( 2/0 و 1/0 برابر) نسبت به شرایط بدون تنش- شاهد- کاهش داده است.

 

 

جدول 1. اسامی آغازگرها و اندازه مورد انتظار قطعات ژنهای هدف و مرجع

نام آغازگر 

ژن هدف 

(5’ à) توالی آغازگر 

دمای اتصال (0C)  

اندازه قطعه مورد انتظار (bp) 

AtNMT1-qPCR-F01

AtNMT1

GCCCCAAAACTCCATCTGCT

59.4

100

AtNMT1-qPCR-R01

CCAGCGTCTTTTAGCATCTGTC

60.3

AtNMT2-qPCR-F01

AtNMT2

ATCCAGACTCGCCGTTGAAG

59.4

114

AtNMT2-qPCR-R02

TCTTCCTTGTATGGTGTCGCC

59.8

AtNMT3-qPCR-F01

AtNMT3

ACAGTCATCTCCGTCTCGAA

57.3

127

AtNMT3-qPCR-R01

TTTCACGCTCCTCGCCATA

56.7

AtPDF2_ Ref -F01

AtPDF2

AATCGGTAGGGAGTGATTTGAGT

53.5

231

AtPDF2_ Ref -R01

AGCCAAAAGCACCTCATCGT

51.8

AtUBC9_ Ref -F01

AtUBC9  

GGATTGGTTTTCGATTGCAGAG

53

134

AtUBC9_ Ref -R01

ACGGGTCCTGCGCTACA

51.9

AtYLS8_ Ref -F01

AtYLS8

GCAGATGGATGAGGTGCTTG

53.8

212

AtYLS8_ Ref -R01

GCTTGTCCTTGAGAGCCCAG

55.9

 

برخلاف اندامهای هوایی، 12 روز قطع آبیاری موجب افزایش تقریباً 5 برابری بیان ژن ‎ AtNMT1در ریشه در مقایسه با شرایط بدون تنش شده است. رفتار این ژن در اندامهای مورد مطالعه پس از افزایش زمان تنش قطع آبیاری از 12 روز به 16 روز  تغییر کرد. دوره 16 روزه قطع آبیاری در برگهای درحال توسعه به افزایش حدوداً 3 برابری بروز ژن AtNMT1 نسبت به شاهد منجر شد که افزایش بسیار چشمگیری را در مقایسه با 12 روز تنش نشان می‎دهد. اما مقایسه بروز این ژن در دوره‎های تنش 12 روزه و 16 روزه در برگهای توسعه یافته تفاوتی را نشان نمی‎دهد، اگر چه بروز این ژن کاهش بسیار چشمگیری را نسبت به شاهد نشان داده است. نکته قابل توجه کاهش معنی‎دار بیان این ژن در 16 روز قطع آبیاری درمقایسه ‎با 12 روز قطع آبیاری و برگشت بیان به سطح شاهد در ریشه است. به ‎نظر می‎رسد‎ که افزایش مدت قطع آبیاری رابطه نسبی بیان این ژن‎ بین برگهای درحال توسعه و ریشه را معکوس می‎کند (شکل 3-الف).

الگوی تغییر بیان ژن AtNMT2 ‎نشان داد‏ که، 12 روز قطع آبیاری و افزایش این زمان به 16 روز نتوانسته در مقایسه با شرایط بدون تنش تغییر محسوسی را در بیان این ژن در دو اندام‎ هوایی ایجاد کند. 12 روز قطع آبیاری در ریشه همچون اندامهای هوایی موجب تغییر در بیان ژن AtNMT2 نشد. اما افزایش مدت تنش به 16 روز بیان این ژن را در ریشه در مقایسه با شرایط بدون تنش شدیداً کاهش داده و تقریباً به صفر رسانیده است. بنابراین، علی رغم اینکه بیان این ژن در اندامهای هوایی از تنش و تغییرات شدت/مدت آن متأثر نیست، در ریشه افت بیان در پاسخ ‎به افزایش شدت/مدت خشکی چشم‎گیر است (شکل 3-ب).

درخصوص ژن AtNMT3 مشاهده شد  که‌ 12 روز قطع آبیاری در مقایسه با شرایط بدون تنش تغییری را در بیان این ژن در برگهای توسعه یافته ایجاد نکرد. در برگهای درحال توسعه بیان ژن AtNMT3 تا حدود 50 درصد (5/0 برابر) در مقایسه با شاهد کاهش یافت. نکته قابل توجه آن است که رفتار این ژن در پاسخ به قطع آبیاری در ریشه کاملاً متفاوت بود. اعمال تنش 12 روزه موجب افزایش نزدیک به 9 برابری بیان ژن AtNMT3 در ریشه در مقایسه ‎با شرایط بدون تنش شد. افزایش مدت تنش به 16 روز همچنان تغییر معنی‎داری را در بیان ژن AtNMT3‎ در برگهای درحال توسعه نسبت به شاهد ایجاد نکرد، اما بیان آن را در برگهای توسعه یافته کاهش داد و تقریباً میزان بیان به صفر رسید. 16 روز قطع آبیاری موجب کاهش نسبتاً چشمگیر بیان این ژن نسبت به مدت 12 روز قطع آبیاری در ریشه شد، اما همچنان میزان بیان آن 5/3 برابر شاهد بود (شکل 3-ج). به طور کلی، می‎توان گفت که رفتار سه ژن خانواده AtNMT در مواجهه با قطع آبیاری متفاوت است (شکل 3).

 

 

 

شکل 3- الگوی تغییر بیان کمی ژنهای خانواده AtNMT در پاسخ ‌به خشکی در دو بازه زمانی 12 و 16روزه. الف: AtNMT1. ب: AtNMT2. ج: AtNMT3. **= تفاوت بسیار معنی‎دار نسبت به شاهد، *= تفاوت معنی‎دار نسبت به شاهد.

 

آنالیز داده‏ها به روش مبتنی ‎بر تصحیح راندمان پافل نتایج حاصل از روش غیرمبتنی ‎بر تصحیح راندمان 2^-ΔΔCT را کاملاً تأیید نمود (شکل 4).

 

 

شکل 4- بیان کمی سه ژن‎ AtNMT1، AtNMT2 و AtNMT3 در برگهای درحال توسعه(Fast Expanding Leaves) ، برگهای توسعه یافته (Fast Expanded Leaves) و ریشه(Root) ، در دو بازه زمانی 12(D1) و 16(D2) روزه پس‎از قطع آبیاری، به روش مبتنی ‎بر تصحیح راندمان پافل. باکسها نشان‌دهنده 50 درصد مشاهدات، خطوط نقطه‎چین نشان‎دهنده میانه بیان ژن، و خطوط دنباله نشان‎دهنده 25 درصد بیشینه و 25 درصد کمینه مشاهدات هستند. بیان ژنها در کالیبراتور (شاهد) معادل 1 درنظر‎گرفته می‎شود، که به‎وسیله خط مبنا مشخص شده‎است.


بحث 

در این مطالعه بررسی سطوح تجمع رونوشتها، که به‎ وسیله تعداد سیکلهای مورد ‎نیاز جهت رسیدن به نقطه CT (ΔCT) تعیین ‌شد، نشان داد که میزان بیان ژن AtNMT2 در همه اندامهای مورد بررسی و در شرایط بدون تنش- شاهد- علی رغم وجود تنوع بروز در اندامهای مختلف زیاد است (شکل 5). همان طور که پیش تر گفته شد، رخ دادن تنش و افزایش شدت/مدت آن تغییر محسوس و معنی‎داری را در بیان ژن AtNMT2 در اندامهای هوایی ایجاد نکرد. همچنین تنش اثری در رفتار این ژن پس از 12 روز قطع آبیاری در ریشه نداشت اما افزایش شدت/مدت تنش بیان این ژن را نسبت به حالت بدون تنش در این اندام شدیداً کاهش داد (شکل 3-ب). این مشاهده با نتیجه آزمایش تاسوا و همکاران (2004) که اثر تنشهای غیرزنده را بر گیاهچه آرابیدوپسیس مطالعه کرده‎اند و نشان داده‎اند که ژن AtNMT2 در پاسخ ‎به سطوح گوناگون تنش‎ سرما و سطوح اولیه تنشهای شوری و اسمتیک عکس‎العملی را نشان نمی‎دهد، ولی با افزایش شدت/مدت دو تنش اخیر بیانش کاهش می‎یابد، تا حدودی تطابق نشان می‎دهد (30). همچنین سالاری در سال 2008 نشان داده است که در میان ژنهای خانواده AtNMT ژن AtNMT2 ایزوفرم غالب ریشه است، بنابراین تفاوت رفتار این ژن در اندامهای هوایی و ریشه شاید مرتبط با اختصاصی بودن این ایزو فرم برای ریشه باشد (26). به طور کلی ممکن است بتوان گفت بروز زیاد این ژن در شرایط غیر تنش به علت نقش مهم‎تر و احتمالی این ژن در سایر مسیرهای متابولیکی است که نیازمند مطالعه دیگری است. همچنین ممکن است عدم تغییر معنی‏‎دار بیان این ژن به اعمال تنش بدان دلیل باشد که با توجه به بروز نسبتاً چشمگیر این ژن در شرایط بدون تنش، پس از نسبی سازی بروز آن در شرایط تنش نسبت به شرایط بدون تنش، علی رغم تغییر قابل ملاحظه مطلق بروز، در مقام قیاس با شرایط بدون تنش ناچیز می‎نماید.

بیان ژن ‎AtNMT3 در نمونه‎های مربوط به شرایط بدون تنش-شاهد- بسیار کم و نزدیک ‎به صفر بود؛ به‎ نحوی ‎که مقادیر CT متناظر‎ با این ژن معمولاً در محدوده سیکلهای 28 تا 32 قرار داشت (شکل 3-ج). لذا امکان دخالت این ژن در سایر مسیرهای متابولیکی در شرایط بدون تنش کم به نظر می‎رسد. تغییر چشمگیر بروز نسبی این ژن در ریشه به هنگام مواجه شدن گیاه با تنش این فرضیه را که احتمالاً ژن AtNMT3 ژن حساس ‎به خشکی برای این مسیر متابولیکی در ریشه است را بسیار تقویت می‎کند. گفتنی است براساس مطالعه سالاری (2008)، AtNMT3 ایزوفرم غالب در برگ و AtNMT2 ایزوفرم غالب ریشه بوده است که نتایج این پژوهشگر در توافق ‎با الگوی ارائه شده ‌در سایتhttp://www.bar.utoronto.ca/efp/cgibin/efpWeb.cg می‎باشد (26). به نظر می‎رسد نتایج پژوهش حاضر با گزارش پیشتر گفته تفاوت دارد، اما بسیار محتمل است که الگوی بیان این ژن‎ در شرایط تنش با شرایط بدون تنش متفاوت باشد. از سوی دیگر چون بررسی حاضر در مرحله رشدی دیگری صورت پذیرفته است، مرحله رشدی نیز می‎تواند علت تفاوت مشاهدات در نظر گرفته شود (10). با این‎ حال هرگونه اظهار‎نظر درباره این تفاوت به مطالعه و آزمایشهای بیشتر نیازمند است.

توجه به مقدار بیان ژن  AtNMT1در شرایط بدون تنش و مقایسه آن با تغییرات بروز آن در شرایط تنش خشکی این فرضیه که ژن AtNMT1 به هنگام مواجه گیاه با تنش خشکی نقش دارد را تقویت می‎نماید (اشکال 3-الف و 5). با این حال تشخیص یک الگوی منسجم متأثر از شدت/مدت تنش و اندامهای مورد بررسی برای رفتار این ژن در مواجه با تنش خشکی امکان‎پذیر نیست. به طور کلی شاید بتوان گفت که ژن AtNMT1 در سطوح اولیه تنش خشکی در ریشه تحریک شده و نقش ایفاء می‎نماید، ولی با شدت گرفتن تنش این وظیفه‎ را در برگهای درحال توسعه دنبال می‎کند. همچنین با توجه به نتایج مطالعات پیشین محتمل است ژن AtNMT1 با افزایش سطح تنش خشکی نقش بیشتری نسبت به سایر ژنهای این خانواده در گیاه ایفاء نماید. راستی آزمایی چنین فرضیه‎ای به بررسی موتانتها و لاینهای ترانسژنیک ژنهای خانواده‎AtNMT  نیاز دارد.

 

 

شکل 5- بیان کمی سه ژن‎ AtNMT1، AtNMT2 و AtNMT3 در برگهای درحال توسعه، برگهای توسعه یافته و ریشه در شرایط بدون تنش (شاهد) برحسب مقادیر 2^-Δ.

 

به طور کلی و براساس نتایج بدست آمده می‎توان گفت که ژن AtNMT2 از تنش خشکی و تغییرات شدت/مدت آن متأثر نیست. براساس این نتایج و شواهدی همچون عدم تولید موتان بدون عملکرد برای ژن AtNMT2 (26)، به نظر می‎رسد که این ژن در مسیرهای متابولیکی احتمالاً حیاتی و متفاوت از پاسخ به تنشها دخالت داشته باشد. با پذیرش این فرضیه و کنار گذاشتن ژن AtNMT2 به عنوان عضوی از خانواده ژنی دخیل در مسیر بیوسنتز فسفوکولین و مشاهده الگوی مشابه کاهش در بیان دو ژن AtNMT1 و AtNMT3 در پاسخ به سطوح مختلف تنش خشکی در برگهای توسعه یافته، به نظر می‎رسد که مسیر بیوسنتز فسفوکولین در این اندام از مکانیسمهای اصلی مواجه با تنش خشکی نباشد. با این حال شواهد ژنتیکی که بتواند مستقیماً این فرضیه را تأیید کند، در دست نیست. در عین حال دیده می‌شود که بیان دو ژن AtNMT1 و AtNMT3 در پاسخ به اولین سطح تنش خشکی در ریشه به شدت افزایش می‎یابد. همچنین می‎توان گفت دلیل رفتار متفاوت ریشه با اندامهای هوایی می‎تواند بدان جهت باشد که ریشه نخستین اندامی است که با تنش مواجه می‌شود. نتایج حاضر همچنین نشان می‎دهد که اگرچه ژن AtNMT1 درسطوح اولیه تنش خشکی در ریشه –اولین اندام متأثر از تنش- تحریک می‎شود، اما با تشدید تنش و احتمالاً رسیدن سیگنالهای القایی ناشی از آن به بخشهای هوایی، به عنوان ایزوفرم غالب در برگهای درحال توسعه عمل می‎کند. AtNMT3 احتمالاً ژن حساس ‎به خشکی در ریشه است. به عبارت دیگر، به نظر می‎رسد که بیان دو ژن‎ AtNMT1 و AtNMT3 در میان اندامها تاحدودی از الگوی القای مختص به بافت پیروی می‎کند. همچنین دیده شد که افزایش شدت/مدت خشکی بیان این دو ژن در ریشه را در مقایسه با 12 روز خشکی کاهش داده است (اشکال 3-الف و ج). این مشاهده براساس گزارشات پیشین درخصوص حساسیت آنزیم PEAMT به بازخورد منفی فسفوکولین توجیه پذیر است (16). این مسئله همچنین می‎تواند ناشی از این باشد که با افزایش تنش گیاه از مکانیسمهای جایگزین استفاده کرده و نقش این مسیر بیوسنتزی در پاسخ به شرایط موجود در حال کم اثر شدن است. به عبارت دیگر، ممکن است که مسیر متابولیکی تولید فسفوکولین که محصول این ژنها در آن دخالت دارد، در شرایط تشدید عدم دسترسی به آب چندان فعال نبوده یا کم فعالیت گردد. همین روند در مطالعه پیش تر صورت گرفته توسط این تیم تحقیقاتی بر روی ژنهای خانواده BADH که در بیوسنتز گلایسین بتائین –به عنوان یکی از فرآورده‏های پایین دستی مسیر بیوسنتزی فسفوکولین- نقش دارند مشاهده شد؛ یافته‎ای که می‎تواند به فرضیه فوق قوت بیشتری ببخشد (1). با توجه به نتایج این آزمایش و مطالعات قبلی به ‏نظر می‎رسد که دو ژن‎ AtNMT1 و AtNMT3 ایزوفرم NMT مفروض مؤثر در مواجهه با تنش‎ خشکی در آرابیدوپسیس هستند. بر این اساس اندازه‎گیری فعالیت آنزیمهای کدشده توسط این ژنها و محتوای درونی فرآورده‎های آنها در شرایط مشابه با شرایط این آزمایش، و همچنین ارزیابی بیان این ژنها در شرایط رفع تنش (آبیاری مجدد) ضروری به‎ نظر می‎رسد.

1. زنگیشه‎ای ز. و سالاری ه. 1394. اثر تنش خشکی بر بیان ژن‏های رمزگذارآنزیم‎های خانواده بتائین‎آلدهیددهیدروژناز (BADH) در آرابیدوپسیس. ژنتیک نوین. در دست چاپ.

 

  1. Bolognese C. P. and McGraw P. 2000. The isolation and characterization in yeast of a gene for Arabidopsis S-adenosylmethionine: phospho-ethanolamin N-methyltransferase. Plant Physiology. 124: 1800-1813.
  2. Botella J., Schlagnhaufer A. and Phillips A. 1992. Identification and characterization of a full-length cDNA encoding for an auxin-induced 1-aminocyclopropane-1-carboxylated synthase from etiolated bean hypocotyl segments and expression of its mRNA in response to indole-3-acetic acid. Plant Molecular Biology. 20: 425–436.
  3. Charron J-B. F., Breton G., Danyluk J., Muzac I., Ibrahim R. K. and Sarhan F. 2002. Molecular and biochemical characterization of a cold-regulated phosphoethanolamine N-methyltransferase from wheat. Plant Physiology. 129: 363-373.
  4. Chen THH. and Murata N. 2002. Enhancement of tolerance of abiotic stress by metabolic engineering of betaines and other compatible solutes. Current Opinion in Plant Biology 5: 250–257.
  5. Czechowski T. Stitt M. Altmann T. Udvardi MK. Scheible WF. 2005. Genome-wide identification and testing of superior reference genes for transcript normalization in Arabidopsis. Plant Physiology. 139:5–17.
  6. Datko A. H. and Mudd S. H. 1988a. Enzymes of phosphatidylcholine synthesis in lemna, soybean, and carrot. Plant Physiology. 88: 1338-1348.
  7. Datko A. H. and Mudd S. H. 1988b. Phosphatidylcholine synthesis - Differing patterns in soybean and carrot. Plant Physiology. 88: 854-861.
  8. Horvath I. Vigh L. Belea A. and Farkas T. 1980. Hardiness dependent accumulation of phospholipids in leaves of wheat cultivars. Physiologia Plantarum. 49: 117-120.
  9. Inatsugi R. Nakamura M. and Nishida I. 2002. Phosphatidylcholine biosynthesis at low temperature: Differential expression of CTP: Phosphorylcholine cytidylyltransferase isogenes in Arabidopsis thaliana. Plant and Cell Physiology. 43: 1342-1350.
  10. Kent C. 1995. Eukaryotic phospholipid biosynthesis. Annual Review of Biochemistry. 64: 315-343.
  11. Kinney A. J. Clarkson D. T. and Loughman B. C. 1987. Phospholipid-metabolism and plasmamembrane morphology of warm and cool rye roots. Plant Physiology and Biochemistry. 25: 774-769.
  12. Livak K.J. Schmittgen T.D. 2001. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2^−ΔΔCT Method. Methods. 25: 402–408.
  13. Lynch D. V. and Steponkus P. L. 1987. Plasma-membrane lipid alterations associated with [1] coldacclimation of winter rye seedlings (secale-cereale L-Cv puma). Plant Physiology. 83: 761-767.
  14. McNeil S. D. Nuccio M. L. Rhodes D. Shachar-Hill Y. and Hanson A. D. 2000. Radiotracer and computer modeling evidence that phospho-base methylation is the main route of choline synthesis in tobacco. Plant Physiology. 123: 371-80.
  15. McNeil S. D. Nuccio M. L. Ziemak M. J. and Hanson A. D. 2001. Enhanced synthesis of choline and glycine betaine in transgenic tobacco plants that overexpress phosphoethanolamine Nmethyltransferase. Proceedings of the National Academy of Sciences of the United States of America. 98: 10001-10005.
  16. Moreau P. Bessoule J. J. Mongrand S. Testet E. Vincent P. and Cassagne C. 1998. Lipid trafficking in plant cells. Progress in Lipid Research. 37: 371-391.
  17. Mou Z. L. Wang X. Q. Fu Z. M. Dai Y. Han C. Ouyang J. Bao F. Hu Y. X. and Li J. Y. 2002. Silencing of phosphoethanolamine N-methyltransferase results in temperature-sensitive male sterility and salt hypersensitivity in Arabidopsis. Plant Cell. 14: 2031-2043.
  18. Nuccio M. L. Russell B. L. Nolte K. D. Rathinasabapathi B. Gage D. A. and Hanson A. D. 1998. The endogenous choline supply limits glycine betaine synthesis in transgenic tobacco expressing choline monooxygenase. The Plant Journal. 16: 487-496.
  19. Nuccio M. L. Ziemak M. J. Henry S. A. Weretilnyk E. A. and Hanson A. D. 2000. cDNA Cloning of phosphoethanolamine N-methyltransferase from spinach by complementation in pombe and characterization of the recombinant enzyme. Journal of Biological Chemistry. 275: 14095-14101.
  20. Pfaffl M.W. Horgan G.W. Dempfle L. 2002. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Research. 30: 36.
  21. Pical C. Westergren T. Dove S. K. Larsson C. and Sommarin M. 1999. Salinity and hyperosmotic stress induce rapid increases in phosphatidylinositol 4,5-bisphosphate, diacylglycerol pyrophosphate, and phosphatidylcholine in Arabidopsis thaliana cells. Journal of Biological Chemistry. 274: 38232-38240.
  22. Ramakers C. Ruijter J.M. Deprez R.H. Moorman A.F. 2003. Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data. Neuroscience Letters. 339: 62–66.
  23. Rhodes D. and Hanson A. D. 1993. Quarternary ammonium and tertiary sulfonium compounds in higher plants. Annual Review of Plant Physiology and Plant Molecular Biology. 44: 357-84.
  24. Rontein D. Nishida I. Tashiro G. Yoshioka K. Wu W. I. Voelker D. R. Basset G. and Hanson A. D. 2001. Plants synthesize ethanolamine by direct decarboxylation of serine using a pyridoxal phosphate enzyme. Journal of Biological Chemistry. 276: 35523-35529.
  25. Salari, H. 2008. Characterization of NMT gene family in Arabidopsis. The Australian National University. PhD Thesis.
  26. Sikorska E. and Kacperskapalacz A. 1980. Frost-induced phospholipid changes in cold-acclimated and non-acclimated rape leaves. Physiologia Plantarum. 48: 201-206.
  27. Smith D. D. Summers P. S. and Weretilnyk E. A. 2000. Phosphocholine synthesis in spinach: Characterization of phosphoethanolamine N-methyltransferase. Physiologia Plantarum. 108: 286-294.
  28. Summers P. S. and Weretilnyk E. A. 1993. Choline synthesis in spinach in relation to salt stress. Plant Physiology. 103: 1269-1276.
  29. Tasseva G. Richard L. Zachowski A. 2004. Regulation of phosphatidylcholine biosynthesis under salt stress involves choline kinases in Arabidopsis thaliana. FEBS Letters. 566: 115–120.
  30. Weigel D. and Glazebrook J. 2002. Arabidopsis, a laboratory manual. Cold Spring Harbor Laboratory Press. New York.
  31. Weretilnyk E. A. Smith D. D. Wilch G. A. and Summers P. S. 1995. Enzymes of choline synthesis in spinach - response of phospho-base N-methyltransferase activities to light and salinity. Plant Physiology. 109: 1085-1091.
  32. Weretilnyk E.A. Bednarek S. McCue K.F. Rhodes D. Hanson AD. 1989. Comparative biochemical and immunological studies of the glycine betaine synthesis pathway in diverse families of dicotyledons. Planta. 178: 342–352.
  33. Wu S. Yu Z. Wang F. Li W. Ye C. Li J. Tang J. Ding J. Zhao J. Wang B. 2007. Cloning, characterization, and transformation of the phosphoethanolamine Nmethyltransferase gene (ZmPEAMT1) in maize (Zea mays L). Molecular Biotechnology. 36: 102–112.
  34. Xue H. Chen X. and Li G. 2007. Involvement of phospholipid signaling in plant growth and hormone effects. Current Opinion in Plant Biology. 10: 483-489.