نوع مقاله: مقاله پژوهشی

نویسندگان

1 فارغ التحصیل

2 عضو هیأت علمی دانشگاه شهید چمران اهواز

چکیده

فیکوسیانین رنگدانه آبی رنگی است که در دو گروه از جلبک ها و سیانوباکترها ازجمله Spirulina وجود دارد. این رنگدانه دارای فعالیت های متنوع زیستی است و کاربردهای گوناگونی در صنعت غذایی، آرایشی و دارویی دارد. پیشرفت های زیادی جهت تولید فیکوسیانین در مقیاس بالا انجام شده است، اما اغلب روش ها مشکل و با هزینه های بالایی قابل انجام هستند؛ درصورتی که همسانه سازی و بیان فیکوسیانین به صورت نوترکیب روشی ارزان است و خالص سازی آن آسان تر انجام می پذیرد. از این رو هدف از این تحقیق، جداسازی و همسانه سازی ژن زیرواحد آلفا فیکوسیانین در ناقل بیانی و تولید این پروتئین نوترکیب در باکتری اشرشیاکلی بود تا زمینه تولید فیکوسیانین به صورت صنعتی فراهم گردد. در این پژوهش ژنوم سیانوباکتر Spirulina platensisاستخراج شد و به عنوان الگو در PCR مورد استفاده قرارگرفت. ژن زیرواحدآلفا فیکوسیانین تکثیریافته با آغازگرهای طراحی شده، در ناقل بیانی +pET-43.1a با استفاده از آنزیم های برشی NdeIوNotI کلون گردید. همسانه سازی ژن زیرواحد آلفا در ناقل بیانی با استفاده از Colony PCR، هضم آنزیمی و تعیین توالی تایید شد. بیان ژن با استفاده از آنالیز SDS-PAGE 12/5٪ تا 8ساعت پس از القا با IPTG مورد بررسی قرارگرفت. در بررسی SDS-PAGE، بیان قوی ژن زیرواحدآلفا فیکوسیانین در سیستم بیانی اشرشیاکلی تائید شد. بیان بالای ژن زیرواحدآلفا فیکوسیانین نشان داد که باکتری اشرشیاکلی می تواند به عنوان میزبان مناسب، جهت تولید فیکوسیانین نوترکیب مورد استفاده قرارگیرد. همچنین این تحقیق زمینه تولید فیکوسیانین نوترکیب در آینده را با صرف هزینه های پایین تر فراهم آورد.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Isolation and Cloning of Phycocyanin Alpha Subunit Gene and its Production in E.coli Expression System

چکیده [English]

Phycocyanin is a blue pigment in two eukaryote algal genera and in cyanobacteria as Spirulina. This pigment has various biology activities and are utilised in a number of applications in foods, cosmetics and pharmaceuticals. A lot advantage of phycocyanin studied by many researchers but the scale-up of these methods is difficult and expensive while production of recombinant phycocyanin is more convenience and inexpensive to scale up protein desire. The purpose of this study was to isolation and cloning of phycocyanin alpha subunit gene in expression vector and production of recombinant protein in E.coli to provide industrial production of phycocyanin. The genomic DNA of Spirulina platensis was prepared and used for PCR as template. phycocyanin alpha subunit gene amplified by designed specialize primers was cloned in a pET43.1a+ expression vector, under the control of T7 promoter using NdeI and NotI restriction enzymes. The cloning of phycocyanin alpha subunit gene is confirmed by colony PCR, digestion and DNA sequencing. The constructs were transformed into E.coli strain BL21 (DE3). Expression of phycocyanin alpha subunit gene was examined by 12.5 % SDS-PAGE analysis at 8 hrs after induction by IPTG. The SDS-PAGE analysis showed that alpha subunit phycocyanin was produced in E.coli expression system. Our study provided the production of recombinant phycocyanin. Also overexpression of the synthetic alpha subunit phycocyanin in a bacterial system (E.coli BL-21) showed that E.coli can be used to produce this desire protein in large quantity.

کلیدواژه‌ها [English]

  • cloning
  • expression
  • phycocyanin alpha subunit gene
  • Spirulina platensis
  • pET-43.1a+

جداسازی، همسانه­سازی و بیان ژن زیرواحد آلفا فیکوسیانین در سیستم بیانی اشرشیاکلی

زهرا شجاع1، حمید رجبی معماری2* و محمد رعایایی اردکانی3

1 جهرم، دانشگاه آزاد اسلامی، دانشکده علوم، گروه زیست شناسی

2 اهواز، دانشگاه شهید چمران، دانشکده کشاورزی، گروه زراعت و اصلاح نباتات

3 اهواز، دانشگاه شهید چمران، دانشکده علوم، گروه زیست شناسی

تاریخ دریافت: 12/12/92              تاریخ پذیرش: 14/8/93 

چکیده

فیکوسیانین رنگدانه آبی رنگی است که در دو گروه از جلبکها و سیانوباکترها ازجمله Spirulina وجود دارد. این رنگدانه دارای فعالیتهای متنوع زیستی است و کاربردهای گوناگونی در صنعت غذایی، آرایشی و دارویی دارد. پیشرفتهای زیادی جهت تولید فیکوسیانین در مقیاس بالا انجام شده است، اما اغلب روشها مشکل و با هزینه های بالایی قابل انجام هستند؛ درصورتی که همسانه سازی و بیان فیکوسیانین به صورت نوترکیب روشی ارزان است و خالص سازی آن آسان­تر انجام می­پذیرد. از این رو هدف از این تحقیق، جداسازی و همسانه­سازی ژن زیرواحد آلفا فیکوسیانین در ناقل بیانی و تولید این پروتئین نوترکیب در باکتری اشرشیاکلی بود تا زمینه تولید فیکوسیانین به صورت صنعتی فراهم گردد. در این پژوهش ژنوم سیانوباکتر  Spirulina platensisاستخراج شد و بعنوان الگو در PCR مورد استفاده قرار­گرفت. ژن زیرواحد آلفا فیکوسیانین تکثیریافته با آغازگرهای طراحی شده، در ناقل بیانی pET-43.1a+ با استفاده از آنزیمهای برشی  NdeIوNotI کلون گردید. همسانه­سازی ژن زیرواحد آلفا در ناقل بیانی با استفاده از Colony PCR، هضم آنزیمی و تعیین توالی تأیید شد. بیان ژن با استفاده از آنالیز SDS-PAGE 5/12 درصد تا 8 ساعت پس از القاء با IPTG مورد بررسی قرارگرفت. در بررسی SDS-PAGE، بیان قوی ژن زیرواحدآلفا فیکوسیانین در سیستم بیانی اشرشیاکلی تأیید شد. بیان بالای ژن زیرواحد آلفا فیکوسیانین نشان داد که باکتری اشرشیاکلی می­تواند بعنوان میزبان مناسب، جهت تولید فیکوسیانین نوترکیب مورد استفاده قرارگیرد. همچنین این تحقیق زمینه تولید فیکوسیانین نوترکیب در آینده را با صرف هزینه­های پایین­تر فراهم آورد.

واژه های کلیدی: همسانه­سازی، بیان، ژن زیرواحد آلفا فیکوسیانین، اسپیرولینا پلتنسیس، pET-43.1a+

* نویسنده مسئول، تلفن: 09163719193، پست الکترونیکی: hamidmemary@gmail.com

مقدمه


اسپیرولینا، سیانوباکتر رشته­ای است که علاوه بر درصد بالای پروتئین (70-50 درصد)، غنی از ویتامینها (مخصوصاً B12)، لیپیدها (گاما لینولنیک اسید) و رنگدانه­ها (فیکوبیلی پروتئین و کاروتنوئید) است. از این­رو امروزه در بسیاری از کشور­ها به صورت تجاری بعنوان مکمل غذای انسان و حیوانات مورد مصرف قرار می­گیرد (12).

صرف نظر از ارزش  غذایی  اسپیرولینا،  مطالعات  متنوعی

جهت اثبات خواص دارویی و فواید مواد مغذی موجود در اسپیرولینا انجام شده است که تعدادی از آنها مربوط به فیکوسیانین موجود در این سیانوباکتر است (4).

فیکوسیانین رنگدانه آبی رنگی است که می­تواند بعنوان رنگ طبیعی، جایگزین رنگهای سنتزی سرطان­زا در مواد غذایی، دارویی و آرایشی مورد استفاده قرارگیرد. امروزه علاوه بر استفاده از آن بعنوان رنگ غذا، بمیزان کمی در ایمونواسی وسیتومتری مورد استفاده قرار می­گیرد (5). فیکوسیانین موجود در اسپیرولینا همچنین با داشتن بعضی از عملکردها مانند آنتی اکسیدانی، ضد­التهابی (17) و ضد­سرطانی (13) برای سلامتی انسانها مفید است، به همین دلیل در سالهای اخیر مورد توجه بیشتری قرارگرفته است.

با توجه به اینکه فیکوسیانین 20 درصد از کل پروتئین سلولی اسپیرولینا پلتنسیس را بخود اختصاص داده است (11)، امروزه بعنوان مدل مناسبی جهت تولید فیکوسیانین به صورت تجاری در کشتهای فتوتروفی انتخاب شده است. تولید فیکوسیانین به صورت فتوتروفی همراه با مشکلاتی است. یک راهکار جهت کاهش مشکلات، تولید هتروتروفی آن است که تولید پروتئین نوترکیب، یکی از راههای تولید هتروتروفی است (6).

فیکوسیانین دارای دو زیرواحد پروتئینی آلفا و بتا ( β، α) است که زیرواحد آلفا یک محل و زیرواحد بتا دو محل، جهت اتصال فیکوسیانوبیلین به آپوپروتئین مذکور دارد. سنتز کامل فیکو­بیلی پروتئین وابسته به سنتز همزمان زنجیره آلفا و بتا و قرارگیری صحیح فیکوبیلین­ها در این دو زنجیره است. از این­رو تولید نوترکیب این فیکو­بیلی پروتئین نسبت به پروتئینهای دیگر مشکل است (6). تاکنون (2001) Tooley et al, هالوپروتئین زیرواحد آلفا فیکوسیانین مربوط به سیانوباکتر  Synechocystis sp. PCC6803را در اشرشیاکلی بیان کردند. در این تحقیق ژنهای cpcA همراه با ژنهای فیکوسیانوبیلین لیاز (cpc-E/c-pcF) در یک ناقل و ژنهای هم اکسیژناز و 3 Z-phycocyanobilin:ferredoxin reductase در ناقل دیگر کلون شدند و همزمان دو ناقل به باکتری معرفی شد (21). در گزارشی (2007) Guan et al, با انتقال این ژنها به یک ناقل، هالوپروتئین زیرواحد آلفا فیکوسیانین را تولید کردند (8). همچنین Guan et al, در سال 2009، با استفاده از ژن  cpcAاسپیرولینا، هالوپروتئین زیرواحد آلفا فیکوسیانین نوترکیب را تولید کردند. علاوه بر این بررسی فعالیت آنتی اکسیدانی نشان داد که این پروتئین نوترکیب، پتانسیلی جهت استفاده درfluorescent tagging  و عوامل دارویی دارد (9).

در سالهای اخیر نیز، پژوهشهای گسترده­ای برای تولید پروتئینهای نوترکیب از طریق میکروارگانیسم­ها، حیوانات ترانسژنیک و گیاهان مورد توجه قرارگرفته است که در این میان، باکتری گرم منفی اشرشیاکلی بعنوان کارخانه تولید پروتئینهای نوترکیب از جاذبه­های خاصی برخوردار است (1). مزیتهای بسیاری برای استفاده از سیستم بیان ژن اشرشیاکلی به اثبات رسیده که آن را یک میکروارگانیسم ارزشمند برای تولید پروتئینهای نوترکیب در سطوح بالا باقی گذارده است. ویژگیهای ژنتیکی و فیزیولوژیکی کاملاً شناخته شده آن، تکثیر درزمان کوتاه، آسان بودن دستورزی آن، دانش اثبات شده فرمانتاسیون و نهایتاً ظرفیت بالا برای تجمع پروتئینهای نوترکیب (بیش از 20 درصد از محتوای پروتئین کل سلولی)، اشرشیاکلی را یکی از پرکاربردترین میزبانها در تولید پروتئین ساخته است (7و10).

بر این اساس در این تحقیق ژن زیرواحد آلفا فیکوسیانین در ناقل بیانی مناسب کلون گردید و بیان آن در سیستم بیانی اشرشیاکلی بررسی شد تا در طرحهای بعدی، دیگر ژنهای مربوط به سنتز فیکوسیانین همسانه­سازی شوند و در آینده بتوان به فیکوسیانین نوترکیب کامل دست یافت.

مواد و روشها

کشت اسپیرولینا و استخراج ژنوم: اسپیرولینا پلتنسیس از مرکز پرورش میگو استان بوشهر تهیه شد. کشت در محیط اختصاصیZarrouk  انجام شد (نمکهای مورد نیاز جهت تهیه محیط کشت Zarrouk از شرکت Merck آلمان تهیه شدند.) و در دمای 30 درجه سانتی گراد با دوره نوری 12 ساعت روشنایی و 12 ساعت تاریکی انکوبه شد (15). پس از رسیدن اسپیرولینا به مرحله رشد لگاریتمی، استخراج ژنوم با استفاده از روش تغییر یافته جداسازی ژنوم از بافتهای گیاهی تازه، با استفاده از CTAB انجام گردید. بدین صورت که پس از جمع آوری توده سلولی، به میکروتیوب حاوی این توده 400 میکرولیتر بافر استخراج Tris-HCl (pH:8) 100 میلی­مولار، EDTA 20 میلی­مولار، NaCl 4/1 میلی­مولار، CTAB 5/2 درصد وزنی/حجمی، مرکاپتواتانول2/0 درصد حجمی/حجمی) اضافه و بمدت 15 دقیقه در فریزر 70- درجه قرار داده شد. پس از آن توده سلولی با استفاده از روشهای فیزیکی در بافر استخراج کاملاً حل شد. سوسپانسیون به دست آمده بمدت30 دقیقه در دمای 60 درجه سانتی گراد قرار داده شد. پس از این مدت، نمونه کاملاً یکنواخت گردید. در این مرحله استخراج با کلروفرم با حجمی برابر با حجم نمونه انجام شد. استخراج با کلروفرم بیش از یکبار انجام شد. پس از افزودن کلروفرم، نمونه بآرامی مخلوط شده و 6 دقیقه در دور 6000 سانتریفیوژ شد. فاز آبی به میکروتیوب جدید منتقل شد و حجم برابر آن ایزوپروپانول به آن افزوده شد. توده DNA در این مرحله رسوب نمود. این توده با سانتریفیوژ در دور 12000 و بمدت 5 دقیقه جمع آوری شد. مایع رویی دور ریخته شد و به توده ژنوم 400 میکرولیتر آب مقطر استریل افزوده شد. سپس بترتیب بمیزان 1/0 حجم، استات سدیم 3 مولار و 2 برابر حجم، اتانل به نمونه افزوده گردید. رسوب  DNAبا سانتریفیوژ دور 12000 بمدت 5 دقیقه جمع آوری و سپس در زیر هود خشک شد. DNA استخراج شده در 200 میکرولیتر بافر TE حل شد (3).

طراحی پرایمر و تکثیر ژن زیرواحد آلفا فیکوسیانین: باتوجه به توالی ژن زیرواحد آلفا فیکوسیانین S. platensis دربانک ژن (accession no. AY804216) و نقشه ناقل +pET-43.1a، آغازگرهای لازم جهت تکثیر طراحی و توسط شرکت تکاپو زیست سنتز گردید. توالی آغازگر پیشرو(Forward primer)  شامل 5´GGGAATTCCATATGAAAA CCCCCCTAACCGAAGCAGTTTC3´ و آغازگر معکوس به صورت (Reverse primer) 5´ATAAGAA TGCGGCCGCGCTTAGGGCGTTG ATCGCGTAGTCG3´ بود. در آغازگر پیشرو جایگاه برشی برای آنزیم NdeI و در آغازگر معکوس جایگاه برشی برای آنزیم NotI تعبیه شد. جهت افزایش کارآیی برش آنزیمهای برشی، دو توالی اضافی بعنوان لنگرگاه آنزیم، به ابتدای آغازگرها افزوده گردید.

تکثیر قطعه مورد نظر با استفاده از دستگاه ترمال سایکلر(شرکت BioRad) و در حضور100 نانوگرم  DNAژنومی، 5/1 میلی­مولار MgCl2، 2/0 میلی­مولار dNTP، 4/0 میکرومولار از آغازگرهای رفت و برگشت، 5/1 واحد از آنزیمTag DNA Polymerase  و 5/2 میکرولیتر بافر PCR (تهیه شده از شرکت سیناژن) انجام شد. برنامه دمایی و زمانی بهینه واکنش، با دمای 94 درجه سانتی گراد بمدت 5 دقیقه جهت واسرشت سازی اولیه آغاز شد و با 35 چرخه، 94 درجه بمدت30 ثانیه، 64 درجه بمدت 30 ثانیه و 72 درجه بمدت 35 ثانیه ادامه و در نهایت با 72 درجه سانتی گراد بمدت 10 دقیقه خاتمه یافت. جهت تأیید تکثیر، محصول PCR بر روی ژل آگارز 1 درصد و رنگ آمیزی اتیدیوم بروماید (μg/ml 5/0) بررسی شد (18).

همسانه­سازی ژن زیرواحد آلفا فیکوسیانین: ناقل بیانی و محصول PCR با استفاده از آنزیمهای برشیNdeI  و NotI (تهیه شده از شرکت TAKARA ژاپن) بطور جداگانه برش داده شدند و با استفاده از کیت تخلیص از ژل (شرکت Bioneer) خالص سازی شدند. در نهایت واکنش اتصال در دمای 16 درجه بمدت 14 ساعت توسط آنزیم  T4 DNA Ligase (TAKARA ژاپن) انجام گردید. پس از عمل ترانسفورماسیون به روش شوک حرارتی(18)، باکتریDH5α E.coli تراریخته برروی محیط گزینشگر حاوی µg/ml 100 آنتی­بیوتیک آمپی­سیلین کشت داده شد. جهت تأیید صحت همانند­سازی، کلنیها با استفاده از روشهایColony PCR  و هضم آنزیمی ناقلهای حاصل از کلنیهای مثبت، مورد بررسی قرار گرفتند. در نهایت یکی از ناقلهای همسانه­سازی شده جهت تأیید نهایی تعیین توالی شد.

بررسی بیان ژن زیرواحد آلفا فیکوسیانین: جهت بررسی بیان، انتقال سازه به باکتری بیانی اشرشیاکلی BL21 انجام شد. بمنظور القای بیان، اشرشیاکلی BL21 حاوی ناقلpET43.1a+-cpcA  به محیط کشت  TBانتخابی حاوی µg/ml 100 آمپی­سیلین تلقیح گردید و در 37 درجه در دور rpm 250 انکوبه گردید. پس از رسیدن OD 600 به 4/ 0و نمونه­گیری بعنوان کنترل منفی،  IPTGبا غلظت نهایی 1 میلی­مولار به محیط کشت باکتریایی افزوده شد (2). پس از کاهش دما تا 29 درجه، نمونه گیری در زمانهای1،2،4و8 ساعت بعد از القاء انجام شد. در نهایت پروتئین کل به روش رسوب­گیری از باکتری استخراج گردید و آشکارسازی پروتئینها با استفاده از آنالیز SDS-PAGE 5/12٪ و رنگ آمیزی کوماسی برلیانت بلو R250مورد بررسی قرارگرفت. تمامی محلولهای مورد استفاده در SDS-PAGE و رنگ آمیزی طبق دستورالعمل Roche Applied Science تهیه گردید (16).

نتایج

تکثیر ژن زیرواحد آلفا فیکوسیانین: ژن زیرواحد آلفا فیکوسیانین با استفاده از آ‎غازگرهای اختصاصی طراحی شده و ژنوم استخراج شده اسپیرولینا پلتنسیس بعنوان الگو تکثیر گردید (شکل 1).

انجام عمل همانند­سازی و بررسی صحت آن: پس از هضم آنزیمی ناقل بیانی و ژن زیرواحد آلفا فیکوسیانین، طی فرآیند اتصال و در کنار آنزیم  T4لیگاز، ژن زیرواحد آلفا فیکوسیانین وارد ناقل  pET43.1a+شد. در نهایت حضور ژن زیرواحد آلفا فیکوسیانین در ناقل بیانی با استفاده از روشهای Colony PCR (شکل 2)، هضم آنزیمی (شکل 3) و تعیین توالی (شکل 4)، تأیید شد.

 

شکل1- محصول PCR ژن زیرواحد آلفا. چاهک1: محصول حاصل ازتکثیر ژن زیرواحد آلفا فیکوسیانین، چاهک M: نشانگرمولکولی Kb 1.

 

شکل2- تأیید حضور ژن زیرواحد آلفا فیکوسیانین در ناقل با استفاده از تکنیک Colony PCR. چاهک‌1: کلنی حاوی ناقل دارای ژن، چاهک2: کلنی حاوی ناقل بدون ژن(کنترل منفی)، چاهک M: نشانگر مولکولی Kb1.

 

شکل3- تأیید حضور ژن زیرواحد آلفا فیکوسیانین در ناقل با استفاده از هضم آنزیمی. چاهک1: خروج ژن زیرواحد آلفا فیکوسیانین از ناقل پس از انجام هضم آنزیمی، چاهک M: نشانگر مولکولی kb1.

 

شکل4- نتیجه Blast  توالیهای به دست آمده از تعیین توالی ژن زیرواحد آلفا فیکوسیانین در بانک ژن

 

شکل5- آنالیز SDS-PAGE زیرواحد آلفا فیکوسیانین قبل و بعد از القاء با IPTG. ستون1: باکتری BL21 حاوی ناقل pET-43.1a+ قبل از القاء، ستون2: باکتری BL21 حاوی ناقل pET-43.1a+ بعد از القاء، ستون3: باکتری BL21 حاوی ناقل pET-43.1a+-cpcA قبل از القاء، ستونهای 4 تا 7: باکتری BL21 حاوی ناقل pET-43.1a+-cpcA، بترتیب 1، 2، 4 و 8 ساعت پس از القاء، ستون M: نشانگر 10- 200 کیلودالتون.


بررسی بیان با استفاده از آنالیزSDS- PAGE: سوسپانسیونهای باکتریایی در زمانهای قبل و 1،2،4و 8 ساعت پس از افزودن IPTG تهیه شد و پروتئین کل از باکتری استخراج گردید. در بررسی SDS- PAGE نمونه­های القایی، باند قوی پروتئینی در محدوده 25-20 کیلو دالتون نشانگر پروتئینی مشاهده شد، در حالی که در نمونه­های کنترل منفی و غیر­القایی هیچ گونه باندی مشاهده نشد (شکل 5). با توجه به وزن مولکولی زیرواحد آلفا فیکوسیانین همراه با Tag های تعبیه شده در انتهای پروتئین بیان شده (His tag, HSV tag ) که حدود 92/20 کیلو دالتون محاسبه شد و همچنین عدم وجود باند پروتئینی مذکور در نمونه­های قبل از القاء، بیان ژن زیرواحد آلفا فیکوسیانین در سیستم بیانی اشرشیاکلی تأیید شد. همچنین نمونه­های2 و4 ساعت بعد از القاء، باند قویتری را نسبت به سایر زمانهای القاء نشان دادند.

بحث

فیکوسیانین رنگدانه جذب نوری است که بعنوان رنگ در مواد غذایی و آرایشی مورد استفاده قرارمی­گیرد و همچنین پتانسیلی جهت درمان بیماریهای ایجاد شده توسط استرسهای اکسیداتیو محسوب می­شود (14). علاوه بر مشکلات تولید فتوتروفی فیکوسیانین، استخراج فیکوبیلی پروتئینها از سیانوباکترها مشکل است چرا که کوچک و دارای دیواره سلولی مقاومی هستند. روشهای بسیاری جهت استخراج و خالص­سازی فیکوسیانین انجام شده است، اما هر­کدام از این روشها صرف نظر از مزایا و معایب، هزینه بر هستند (19 و 22). با توجه به نقش مطلوب این پروتئین و مشکلات تولید آن از سایر منابع، سیستم ساده و ارزانی که تولید آن را در مقیاس انبوه و قیمت ارزان ممکن سازد، مورد توجه قرارگرفته است. تولید فیکوسیانین نوترکیب می­تواند یکی از این سیستمها باشد.

امروزه تقاضای زیادی برای تولید پروتئینهای نوترکیب وجود دارد. بدین منظور سیستمهای بیان ژن باکتریایی، قارچی، حشره، پستانداران و گیاهان برای تولید این پروتئینها به کار می روند. در حال حاضر پروتئینهای با ارزش دارویی و اقتصادی ترجیحاً در سلولهای باکتریایی تولید می­شوند (20). انتخاب یک سیستم بیانی برای تولید پروتئینهای نوترکیب در سطح بالا به فاکتورهای زیادی وابسته است. این فاکتورها، شامل ویژگیهای رشد سلولی، سطوح بیان داخل و خارج سلولی، تغییرات پس از ترجمه­ای و فعالیت زیستی پروتئین مورد نظر است. از آنجایی که ژنهای فیکوسیانین از سیستم پروکاریوتی جدا می­شوند و همچنین عدم نیاز آنها به فرآیندهای پس رونویسی و پس ترجمه­ای، اشرشیاکلی می­تواند میزبان مناسبی برای تولید آن باشد.

بنابراین هدف از این تحقیق جداسازی، همسانه­سازی و بیان ژن زیرواحد ‌آلفا فیکوسیانین در سیستم بیانی مناسب و شناخته شده در باکتری اشرشیاکلی بود. سیستم بیانی pET43.1a+ که در تحقیق حاضر استفاده شد، یکی از قوی­ترین سیستمها برای همسانه­سازی و بیان پروتئینهای نوترکیب در اشرشیاکلی است، زیرا این ناقل دارای پروموتر قوی T7 جهت افزایش نسخه برداری ژن هدف است. همچنین بمنظور پیش بینی فرآیند شناسایی و تخلیص پروتئین تولید شده در پژوهشهای آتی، آنزیمهای برشی بگونه­ای انتخاب شد که توالی His tag و HSVtag در انتهای ژن زیرواحد آلفا افزوده گردد. انتهای پروتئین حاصل از بیان این ژن، دارای 6 اسید آمینه هیستیدین بوده و توسط آنزیم Anti-His tag از سایر پروتئینهای باکتریایی قابل جداسازی می­باشد. در این صورت پروتئین نوترکیب تولید شده به صورت متصل به  His tag را می­توان با گذراندن از ستونهای کروماتوگرافی ویژه، خالص سازی کرد. HSV tag شامل 11 اسیدآمینه QPELAPEDPED مشتق شده از گلیکوپروتئین D ویروس هرپس است که همچنین می­تواند در خالص­سازی پروتئین نوترکیب کمک کند. این توالیها بدلیل کوچک بودن، تغییری در ساختار بیوشیمیایی پروتئین نوترکیب ایجاد نمی­کنند.

باند قوی پروتئینی مشاهده شده در آنالیز SDS-PAGE حاکی از بیان بالای پروتئین نوترکیب در باکتری اشرشیاکلی است که دلایل متعددی در این فرآیند تأثیرگذار بوده است. باکتری اشرشیاکلی و جلبکهای سبزآبی هر دو جزء باکتریهای حقیقی­اند. شباهت بالای codon usage اسپیرولینا و اشرشیاکلی، می­تواند دلیلی بر بیان بالا باشد. همچنین این شباهت، نیاز به بهینه کردن کدونی (codon optimization) را از بین می­برد. ناقلهای بیانی نوترکیب جهت بیان بالای ژن به پروموتر و ترمیناتور قوی نیاز دارند. سیستم بیانی pET مورد استفاده در این پژوهش با داشتن پروموتر وترمیناتور قوی نیز سبب بیان بالای ژن می­شود. این سیستم دارای پروموترT7  است که تنها توسط RNA پلیمراز باکتروفاژT7 قادر به شناسایی است این RNA پلیمراز با سرعتی 5 برابر RNA پلیمراز باکتریایی عمل می کند، بدین معنی که تحت این پروموتر بیان ژن در سطح بالا انجام پذیراست (20). سیستم بیانیBL یکی از قوی­ترین سیستمها برای بیان پروتئینهای نوترکیب در اشرشیاکلی است. ژنوم این باکتری دارای یک نسخه کروموزومی از ژن  RNA پلیمراز باکتریوفاژ T7است که تحت کنترل پروموتر  Lacاست و بیان آن با IPTG تنظیم می­شود. اگر  IPTGبا غلظت مناسب و در زمانی که باکتری به  ODبهینه رسیده باشد، به محیط کشت افزوده گردد، همانطور که در این پژوهش مشاهده شد، به تولید بالای پروتئین نوترکیب کمک می­کند. بعبارت دیگر بیان قابل القاء که توسط پروفاژ DE3 باکتری اشرشیاکلی سویه BL امکان پذیر می­شود این فرصت را برای باکتری فراهم می­کند تا تولید پروتئین نوترکیب زمانی آغاز شود که باکتری به OD بهینه رسیده باشد.

با توجه به اهمیت دارویی، غذایی و آرایشی فیکوسیانین و اینکه تاکنون گزارشی مبنی بر تولید فیکوسیانین و یا کشت اسپیرولینا پلتنسیس به صورت صنعتی جهت استخراج فیکوسیانین در ایران عنوان نشده است. انجام موفق این تحقیق می­تواند زمینه­ساز تولید صنعتی و خالص فیکوسیانین باشد.

1- کیانی ج.، شمس آرا م.، 1384، اصول بیان پروتئینهای نوترکیب در باکتری اشرشیاکلی. انتشارات اندیشه ظهور، تهران.

 

2- Abdolrasouli N., Memari H.R., Ardakani M.R., Ebrahimi M.A., Ebrahimi N., 2013, Production of Human Alpha 2b Interferon in E. coli Expression System. Jundishapur Sci. Med. J., 12: 325-334.

3- Berrendero E., Perona E., Mateo P., 2008, Genetic and morphological characterization of Rivularia and  Calothrix (Nostocales, Cyanobacteria) from running water. Int. J. Syst. Evol. Micr., 58: 447-460.

4- Cevallos G.C., Barrón B.L., Sánchez J.V., 2008, Toxicologic Studies and Antitoxic Properties of Spirulina. In: Gershwin M.E., Belay A., (eds) Boca Raton: CRC Press, 28-44.

5- Cohen Z., 1997, The Chemicals of Spirulina. In: Vonshak A (Ed.) Spirulina platensis (Arthrospira): Physiology, cell-biology and biotechnology. Taylor & Francis, London, 175-204.

6- Eriksen N.T., 2008, Production of phycocyanin-a pigment with applications in biology, biotechnology, foods and medicine: Min-Rev. Appl. Microbiol. Biotechnol., 80: 1-14.

7- Georgiou G., 1996, Expression of proteins in bacteria, in Protein Engineering: Principles and Practice. Wiley Liss, New York, USA.

8- Guan X., Qin S., Su Z., Shao F., Ge B., Li F., Tang X., 2007, Combinational biosynthesis of a fluorescent cyanobacterial holo-a phycocyanin in Escherichia coli by using one expression vector. Appl. Biochem. Biotechnol., 142: 52-59.

9- Guan X., Zhang W., Zhang X., Li Y., Wang J., Lin H., Tang X., Qin S., 2009, A potent anti-oxidant property: fluorescent recombinant α-phycocyanin of Spirulina. J. Appl. Microbiol., 106: 1093-1100.

10- Hodgson J., 1993, Expression systems: A user’s guide. Emphasis has shifted from the vector construct to the host organism. Bio/Technology, 11: 887-893.

11- Jeamton W., Dulsawat S., Laoteng K., Tanticharoen M., Cheevadhanark S., 2011, Phycocyanin promoter of Spirulina platensis controlling heterologous expression in cyanobacteria. J. Appl. Phyco., 23: 83-88.

12- Kawata Y., Yano S., Kojima H., Toyomizu M., 2004, Transformation of Spirulina platensis Strain C1 (Arthrospira sp. PCC9438) with Tn5 Transposase-Transposon DNA-Cation Liposome Complex. Mar. Biotechnol., 6: 355-363.

13- Liu Y., Xu L., Cheng N., Lin L., Zhang C., 2000, Inhibitory effect of phycocyanin from Spirulina platensis on the growth ofhuman leukemia K562 cells. J. Appl. Phyco., 12: 125-130.

14- Minkova K.M., Tchernov A.A., Tchorbadjieva M.I., Fournadjieva S.T., Antova R.E., Busheva M.Ch., 2003, Purification of C-phycocyanin from Spirulina (Arthrospira) fusiformis. J. Biotechnol., 102: 55-59.

15- Raoof B., Kaushik B.D., Prasanna R., 2006, Formulation of a low-cost medium for mass production of Spirulina. Biomass Bioenergy, 30: 537-542.

16- Roche molecular biochemicals, 2011, Lab FAQS - find a quick solution. 4th Edition, Mannheim: Roche Diagnostics GmbH, 192.

17- Romay C., Armesto J., Remirez D., Gonzalez R., Ledon N., Garcia I., 1998, Antioxidant and anti-inflammatory properties of C-phycocyanin from blue-green algae. Inflamm. Res., 47: 36-41.

18- Sambrook J., Russel D.W., 2001, Molecular cloning, a laboratory manual. 3rd Edition, New York: Cold Spring Harbor Laboratory.

19- Soni B., Trivedi U., Madamwar D., 2008, A novel method of single step hydrophobic interaction chromatography for the purification of phycocyanin from Phormidium fragile and its characterization for antioxidant property. Biore. Technol., 99: 188-194.

20- Sørensen H.P., Mortensen K.K., 2005, Advanced genetic strategies for recombinant protein expression in Escherichia coli. J. Biotechnol., 115: 113-128.

21- Tooley A.J., Cai Y.A., Glazer A.N., 2001, Biosynthesis of a fluorescent cyanobacterial C-phycocyanin holo-a subunit in a heterologous host. Proc. Natl. Acad. Sci., 98: 10560-10565.

22- Zhu Y., Chen X.B., Wang K.B., Li Y.X., Bai K.Z., Kuang T.Y., Ji H.B., 2007, A simple method for extracting C-phycocyanin from Spirulina platensis using Klebsiella pneumonia. Appl. Microbiol. Biotechnol., 74: 244-248.