نوع مقاله: مقاله پژوهشی

نویسندگان

1 هیات علمی گروه زیست شناسی دانشکده علوم دانشگاه گلستان

2 کارشناس آزمایشگاه گروه زیست شناسی دانشکده علوم دانشگاه گلستان

چکیده

، پروتئین کوچکی است که در کلروپلاست جای دارد. این پروتئین نخستین بار در غربالگری گیاهچه‌های آرابیدوپسیس مقاوم به ترهالوز (Trehalose Resistant) شناخته شده است. هدف از این تحقیق، بررسی فیزیولوژیکی و مولکولی گیاهان تراریخت‌شده با ژن TRR14 در مقایسه با گیاهچه‌های وحشی آرابیدوپسیس در تنش شوری است. به این منظور، بذر‌های گیاه وحشی آرابیدوپسیس و تراریخت شده با ژن TRR14 در محیط کشت MS حاوی غلظت‌های مختلف نمک (0، 75، 100 و 150 میلی مولار ) کشت شدند. نتایج نشان داد که در تیمار شوری درصد جوانه‌زنی و فعالیت آنزیم ترهالاز در گیاهچه‌های تراریخت بالاتر از گیاهچه وحشی است. همچنین این نتایج نشان داد که با افزایش غلظت نمک میزان آنتوسیانین در گیاهچه وحشی به طور قابل توجهی در مقایسه با گیاهچه تراریخت افزایش یافت. نتایج حاضر نشان داد که در تیمار 75 میلی‌مولار نمک، غلظت سدیم در گیاهچه وحشی به‌طور قابل ملاحظه‌ای افزایش می‌یابد. سنجش پتاسیم نیز نشان داد که میزان آن در گیاهچه وحشی رشد‌ یافته بر روی محیط MS ، تقریبا سه برابر گیاهچه تراریخت است. اما تیمار 75 میلی‌مولار نمک، سبب کاهش میزان پتاسیم در هر دو نوع گیاهچه‌ها شد. همچنین با افزایش میزان نمک شکل و اندازه سلول‌های اپیدرمی تغییر یافته و تعداد روزنه در واحد سطح در گیاهچه‌های وحشی افزایش یافت، در حالیکه این فاکتور در گیاهچه تراریخت تغییری نشان نداد. بررسی الگوی بیان ژن نیز نشان داد که تیمار شوری، سبب افزایش بیان ژن‌های ترهالاز و TRR14 شد.

کلیدواژه‌ها

عنوان مقاله [English]

An investigation on some physiological and molecular characterization of TRR14 Re-transformed Arabidopsis plant under salt stress

نویسندگان [English]

  • Mahnaz Aghdasi 1
  • Nooshin Moghadam 2

1 Golestan university

چکیده [English]

TRR14 is a small protein which is located in chloroplast. This protein was first identified in screening of trehalose resistant (TRR14) Arabidopsis seedlings. The aim of present study was physiological and molecular investigation of TRR14 re-transformed (T17) seedlings under salt stress, compared to wild type Arabidopsis seedlings (WT). For this purpose, WT and T17 seeds were grown on MS medium complemented with 0, 75, 100 and 150 mM NaCl. The results showed that under salt stress, the germination rate and trehalase activity in T17 seedlings were higher than WT. Meanwhile the results showed that anthocyanin level in WT seedlings was higher than T17 under salt stress. The Na level was highly increased in WT seedlings under 75 mM NaCl treatment, compared to T17 seedlings. The K measurements revealed that the K level in T17 seedling was 3 times more than WT seedling when grown on MS medium. But K level was decreased under 75 mM NaCl treatment in both WT and T17 seedlings. On the other hand, by adding NaCl to medium culture, the shape and size of epidermal cells were changed in both WT and T17 seedlings. While stomata numbers increased in WT leaves under NaCl treatment, it remained unchanged in T17 seedlings. The gene expression pattern showed that trehalase and TRR14 expression were increased under salt stress.

کلیدواژه‌ها [English]

  • TRR14
  • Salt stress
  • Germination rate
  • Gene expression
  • trehalase

بررسی برخی ویژگیهای فیزیولوژیکی و مولکولی گیاهان تراریخت شده با ژن TRR14 در تیمار شوری

مهناز اقدسی* و نوشین مقدم

گرگان، دانشگاه گلستان، دانشکده علوم، گروه زیست شناسی

تاریخ دریافت: 17/10/93              تاریخ پذیرش: 3/9/94 

چکیده

TRR14، پروتئین کوچکی است که در کلروپلاست جای دارد. این پروتئین نخستین بار در غربالگری گیاهچه­های آرابیدوپسیس مقاوم به ترهالوز (Trehalose Resistant) شناخته شده است. هدف از این تحقیق، بررسی فیزیولوژیکی و مولکولی گیاهان تراریخت­شده با ژن TRR14 در مقایسه با گیاهچه­های وحشی آرابیدوپسیس در تنش شوری است. بدین منظور، بذر­های گیاه وحشی آرابیدوپسیس و تراریخت شده با ژن TRR14 در محیط کشت MS حاوی غلظتهای مختلف نمک (0، 75، 100 و 150 میلی مولار ) کشت داده شدند. نتایج نشان داد که در تیمار شوری درصد جوانه­زنی و فعالیت آنزیم ترهالاز در گیاهچه­های تراریخت بالاتر از گیاهچه وحشی است. همچنین این نتایج نشان داد که با افزایش غلظت نمک میزان آنتوسیانین در گیاهچه وحشی به طور قابل توجهی در مقایسه با گیاهچه تراریخت افزایش یافت. نتایج حاضر نشان داد که در تیمار 75 میلی­مولار نمک، غلظت سدیم در گیاهچه وحشی به­طور قابل ملاحظه­ای افزایش می­یابد. سنجش پتاسیم نیز نشان داد که میزان آن در گیاهچه وحشی رشد­ یافته بر روی محیط MS ، تقریباً سه برابر گیاهچه تراریخت است. اما تیمار 75 میلی­مولار نمک، سبب کاهش میزان پتاسیم در هر دو نوع گیاهچه­ها شد. همچنین با افزایش میزان نمک شکل و اندازه سلولهای اپیدرمی تغییر یافته و  تعداد روزنه در واحد سطح در گیاهچه­های وحشی افزایش یافت، در حالی که این فاکتور در گیاهچه تراریخت تغییری نشان نداد. بررسی الگوی بیان ژن نیز نشان داد که تیمار شوری، سبب افزایش بیان ژنهای ترهالاز و TRR14 شد.

واژه های کلیدی: TRR14،، تنش شوری، جوانه زنی ، بیان ژن، ترهالاز

* نویسنده مسئول، تلفن: 09101062204 ، پست الکترونیکی: m.aghdasi@gu.ac.ir 

مقدمه

 

شوری یکی از عوامل مهم محدودکننده در تولید محصولات کشاورزی و زراعی است. نزدیک به 800 میلیون هکتار از خشکیهای سطح کره زمین در شرایط شوری قرار دارند (22). تنش شوری روی گیاهان اثرات زیان باری را بر جای می­گذارد. با شروع و توسعه تنش شوری در گیاه، همه فرآیند­های اصلی همانند فتوسنتز، ساخت پروتئینها، متابولیسم چربیها و تولید انرژی آسیب می­بینند (9). گیاهان در طی تکامل مکانیسمهای محافظتی مختلفی برای غلبه بر شرایط نا­خواسته محیطی به کار گرفته­اند. در پاسخ به تنشهای محیطی  بسیاری از جنبه­های فیزیولوژیک و متابولیسم گیاه در گیر شده و یک شبکه سیگنالینگ پیچیده برای سازگاری گیاهان با این شرایط پدید می­آید (35). در پاسخ به شوری، ژنهای زیادی تنظیم می­شوند که محصول آنها به طور مستقیم یا غیرمستقیم در این پدیده دخالت دارند. این ژنها در سنتز اسمولیت­ها، کانالهای یونی، گیرنده­ها، سیگنالینگ کلسیم و سایر سیگنالهای تنظیمی نقش دارند (17). بیشتر گیاهان اسمولیت­هایی را در پاسخ به تنش خشکی و شوری سنتز و انباشته می­کنند. برخی گیاهان با تولید اسمولیت­هایی نظیر مانیتول، اونونیتول، ترهالوز، بتائین یا فروکتان بسیاری از تنشهای محیطی را تحمل می­کنند (33).

ترهالوز دی­ساکاریدی است که از دو مولکول گلوکز با پیوند آلفا 1 و 1 ساخته شده است. این قند در طیف وسیعی از موجودات زنده اعم از باکتریها، قارچها، نماتودها، حشرات، سخت­پوستان و گیاهان وجود دارد و می­تواند به عنوان منبع کربن و انرژی، مورد استفاده موجودات زنده قرار گیرد. پیش ماده این قند ترهالوز-6-فسفات (T6P) است که از اتصال گلوکز-6-فسفات و UDP- گلوکز و با دخالت ترهالوز-6-فسفات سینتاز (TPS) ساخته می شود. سپس T6P توسط آنزیم ترهالوز-6-فسفات فسفاتاز (TPP) دفسفریله شده و ترهالوز تولید می شود. در مسیر متابولیسم ترهالوز در گیاهان، این قند توسط آنزیم ترهالاز شکسته شده و به دو مولکول گلوکز تجزیه می شود (11). میزان قند ترهالوز در موجودات زنده بسیار اندک است و تا مدتها تصور بر آن بود که بسیاری از گیاهان فاقد این قند هستند (20). ترهالوز در زندگی گیاهان نقشهای متعدد مهمی را ایفا می­کند؛ که از آن جمله می­توان تأثیر آن بر گلدهی، رشد گیاه، مصرف کربن، مقاومت به تنش و فتوسنتز را نام برد ( 24، 25، 28، 29، 31 و 32). اخیراً مشخص شده است که قند ترهالوز نقش مهمی در مقاومت به تنش در گیاهان دارد. تراریخت شدن گیاه تنباکو با ژن ترهالوز 6- فسفات سنتاز مخمر (ScTPS1) تحت پروموتور روبیسکو یا CaMV 35S promotor سبب افزایش مقاومت آن به تنش خشکی شده است . همچنین ثابت شده است که برگهای گیاهان تراریخت شده با این ژن از توازن آبی بهتری برخوردار هستند (13 و 14). از طرفی دیگر تراریخت شدن گیاهان با ژن ترهالوز 6- فسفات سنتاز سبب تولید گیاهان مقاوم به انواع تنشها مثل خشکی، سرما و شوری در تک­لپه­ایها و در دو لپه­ایها شده است (13 و 20). 

TRR14، پروتئین کوچکی به طول 139 اسید آمینه است که توسط ژن At4g10300 کد می شود. این پروتئین نخستین بار در غربالگری گیاهچه­های Arabidopsis مقاوم به قند ترهالوز (Trehalose Resistance ) شناسایی شد و به همین جهت TRR14 نامیده شد. نقش پروتئین TRR14 در گیاه آرابیدوپسیس به درستی شناخته نشده است. اما نتایج حاصل از آنالیز ژنتیکی و بیان ژن نشان داد که بیان بالای ژن  TRR14 در گیاه Arabidopsis سبب مقاومت این گیاه به غلظت قند ترهالوز می شود. این نتایج نشان داد که پروتئین TRR14 در سیگنالینگ قند ترهالوز در گیاهان نقش دارد (5). بررسیهای اولیه نشان داده که تراریخت­شدن گیاه Arabidopsis با ژن TRR14 سبب افزایش مقاومت این گیاهان به تنشهای شوری و خشکی شده است. در این تحقیق نشان داده شده که گیاهان تراریخت رشد یافته در محیط کشت حاوی 100 میلی­مولار نمک، میزان کلروفیل a، کلروفیل b، کلروفیل کل، فعالیت آنزیم کاتالاز و پراکسیداز بالاتر از گیاهچه های وحشی بود (6). در حالی که گیاهچه­های جهش یافته که فاقد بیان ژن TRR14 بودند در تنش شوری و خشکی حساس­تر بوده­اند. به علاوه این نتایج به وضوح نشان می­دهد که پروتئین TRR14 می تواند با اثر بر مکانیسمهای فیزیولوژیکی مهم گیاه نظیر تولید سیستم ریشه‌ای گسترده برای جذب آب و موادغذایی و میزان کلروفیل مناسب برای حفظ فتوسنتز در بقاء و افزایش ماندگاری گیاه در شرایط تنش نقش داشته باشد. (7). با توجه به آنکه بالا رفتن میزان قند ترهالوز در گیاهان سبب افزایش مقاومت به تنش می شود (13) و از طرفی چون پروتئین TRR14 در سیگنالینگ قند ترهالوز نقش دارد به نظر می­رسد که TRR14 به نوعی در مقاوم نمودن گیاهان به تنش نقش داشته باشد. هدف از تحقیق حاضر، مقایسه برخی ویژگیهای فیزیولوژیکی و مولکولی گیاه آرابیدوپسیس تراریخت TRR14 در مقایسه با گیاه وحشی در تنش شوری است.    

مواد و روشها 

شرایط رشد و کشت گیاه: در این آزمایش از بذر گیاه  Arabidopsis thaliana رقم کلمبیا صفر (Col-0)  و گیاه تراریخت شده با ژنTRR14   (T17)استفاده شد (6). بذرها ابتدا به مدت 10 دقیقه در محلول 70 درصد اتانل و سپس10 دقیقه در محلول 20 درصد  آب ژاول ضد عفونی شده و در آخرین مرحله 5 بار با آب مقطر استریل شستشو داده شدند. سپس بذر­ها در محیط­ موراشیگ و اسکوگ) (MS حاوی غلظتهای مختلف 0، 75، 100، 150 میلی­مولار کلرور سدیم کشت شدند(23). در هر پتری 40-50 بذر و هر تیمار با 5 تکرار انجام شد. به منظور استریفیکاسیون، بذرها به مدت 2-3 روز در دمای 4 درجه سانتی گراد نگهداری شده و بعد به اتاق کشت با دمای 2 ±24 درجه سانتی گراد تحت شرایط روز بلند (16 ساعت روشنایی/ 8 ساعت تاریکی) و شدت نور 150 میکرومول فوتون بر مترمربع بر ثانیه انتقال داده شدند. بعد از 16 روز از کشت­، سرعت جوانه زنی بذرها مورد بررسی قرار گرفت.

اندازه­گیری شاخص روزنه­ای: جهت تعیین شاخص روزنه­ای، تعداد روزنه ها در واحد سطح برگ (یک سانتیمتر مربع) در زیر میکروسکوپ نوری معمولی و نورمارسکی (Jena, Germany) شمارش شد. سپس تعداد کل سلول اپیدرم، روزنه و تعداد کرک­ها در واحد سطح شمارش شده و با استفاده از فرمول زیر محاسبه شد:

 

اندازه گیری میزان آنتوسیانین: اندازه­گیری آنتوسیانین به روش میتا  و همکاران (1997) انجام شد(19). مقدار 02/0 گرم بافت تازه گیاه در ازت مایع خرد شده و سپس 4 میلی لیتر محلول 1 درصد اسید کلریدریک در متانول به آن افزوده و به مدت 24 ساعت در یخچال قرار داده شد. محلول حاصل به مدت 10 دقیقه در 13000 دور سانتریفیوژ شد. جذب نور در فاز رویی با استفاده از روش اسپکتروفتومتری در طول موجهای 530 و 757 نانومتر خوانده شد و با استفاده از فرمول زیر میزان نسبی آنتوسیانین تعیین شد:

A= A550- (0.25 A657)

A= میزان نسبی آنتوسیانین

A530و A657 به ترتیب جذب نور نمونه در طول موجهای 530 و 657 نانومتر است.

اندازه­گیری فعالیت آنزیم­ ترهالاز:  بر مبنای میزان گلوکز آزاد شده در واحد زمان با استفاده از روش اسپکتروفتومتری  بر اساس تلفیقی از دو روش پرادو و همکاران (1998) و مولر و همکاران (2001) انجام شد (21 و26). به این منظور  05/0 گرم از بافت تازه گیاهی  با 5 میلی لیتر بافر استخراج (شامل محلول 50 میلی مولار  مورفولین اتان سولفونیک اسید (MES) با pH:6.8، محلول 1 میلی مولار فنیل متیل سولفونیل فلوراید ، محلول 1 درصد تریتون X100 و  محلول 1 درصد پلی ونیل پیرولیدون) در  هاون چینی سرد هموژن شد. پس از 2 ساعت قرارگرفتن در دمای صفر درجه سانتی گراد، سانتریفیوژ به مدت 15 دقیقه انجام شد. به­منظور سنجش فعالیت آنزیم ترهالاز ، ابتدا 700 میکرولیتر  از بافر50 میلی­مولار MES به همراه 100 میکرولیتر از محلول 100 میلی مولار ترهالوز درون لوله آزمایش ریخته و به آن 200 میکرولیتر عصاره گیاهی اضافه شد. سپس جهت تعیین بهترین زمان برای سنجش  میزان گلوکز آزاد شده در اثر فعالیت آنزیم ترهالاز نمونه ها در 4 بازه زمانی 0، 15، 35 و 45 دقیقه در دمای 35 درجه سانتی گراد قرار گرفتند. در نهایت بازه زمانی 0 و 45 دقیقه انتخاب شد. به منظور توقف فعالیت آنزیم ترهالاز نمونه ها به مدت 5 دقیقه در بن ماری  با دمای 100 درجه سانتی گراد قرار داده شد. در نهایت میزان فعالیت آنزیم ترهالاز بر اساس میکروگرم گلوکز آزاد شده بر گرم وزن تر گیاه در دقیقه محاسبه گردید.

اندازه گیری میزان سدیم و پتاسیم: مقدار 50 میلی­گرم از نمونه­های خشک آسیاب شده به مدت 5/0 ساعت در دمای 300 درجه سانتی گراد و سپس 4 ساعت در دمای 550 درجه در کوره الکتریکی قرار گرفتند. پس از سرد شدن به هر کدام از ظروف حاوی خاکستر گیاهی، 1 میلی­لیتر اسید کلریدریک 6 نرمال اضافه شد. سپس حجم محلول با آب مقطر به 50 میلی­لیتر رسانده شد. برای اندازه­گیری میزان سدیم و پتاسیم از دستگاه فلیم فلومتر استفاده شد. غلظت یونهای سدیم و پتاسیم در نمونه­های گیاهی با استفاده از منحنی استاندارد و بر حسب میلی­گرم در گرم وزن خشک بافت محاسبه شد.

استخراج RNA و RT-PCR: استخراج RNA از گیاهچه­های آرابیدوپسیس طبق روشSambrok و Russell (2001) صورت گرفت (27).

واکنش RT-PCR با استفاده ازکیت Prime Script One Step RT-PCR (TAKARA BIO  INC Japanese) انجام شد. این واکنش در حجم کلی25 میکرو­لیتر با محتوی 2 میکروگرم RNA، 1 واحد آنزیم Prime Script، 5/12 میکرولیتر بافر آنزیم Prime Script، 5/0 میکرولیتر از هر یک از پرایمرهای رفت و برگشت در دستگاه PCR با برنامه حرارتی واسرشته شدن در دمای 94 درجه به مدت 2 دقیقه برای چرخه اول و برای چرخه دوم به بعد به مدت 30 ثانیه، اتصال آغازگرها در دمای 60 درجه به مدت 30 ثانیه و بسط در دمای 72 درجه به مدت 1 دقیقه درجه انجام شد. محصول PCR با استفاده از دستگاه الکتروفورز روی ژل آگارز 2 درصد جداسازی شد. در پایان ژلهای به دست آمده با اتیدیوم بروماید رنگ آمیزی شدند.

طراحی پرایمر: پرایمرهای رفت و برگشت ژنهای مورد بررسی (TRE: gctgcaccacgaaccagtaga , ttcttcgttctccacgttgga)، (TRR14: attgtgagcaactgggatg and tagatggggacggtggag) و  (Actin: gtagatggggacggtggag and aacttgatcgggatatggagtg)ّ به کمک نرم افزار Primer 3 طراحی و از شرکت امینسان تهیه گردیدند.

آنالیز آماری: کلیه آزمایشات با 4 تکرار در قالب طرح آزمایشی کاملاً تصادفی انجام شد و در تمام اندازه­گیریها رسم نمودار با نرم افزار Excel و آنالیز داده­ها با نرم افزار SAS و آزمون دانکن محاسبه شد.

نتایج

اثر تیمار شوری بر جوانه­زنی:  بررسی در­صد جوانه­زنی بذر گیاه وحشی (WT) و گیاهان تراریخت (T17) در محیط حاوی غلظتهای مختلف نمک نشان داد که  جوانه­زنی بذور گیاهچه های وحشی از روز دوم  شروع شده و تا روز هشتم تقریباً 92 درصد بذرها جوانه زدند. اما در محیط حاوی 75 میلی­مولار نمک جوانه زنی از روز دوم شروع شده و تا روز دهم تنها 60 درصد از بذرها جوانه زدند. در حالی که در غلظت 100 میلی­مولار نمک تنها 20 درصد از بذرها جوانه زده و در غلظت150 میلی­مولار نمک اصلاً بذرها قادر به جوانه­زنی نبودند (شکل ا-الف ). بررسی در­صد جوانه­زنی بذور گیاهان تراریخت  نیز نشان داد که جوانه­زنی از روز دوم شروع شده و تا روز چهارم 98 درصد بذرها جوانه زدند. ازطرفی بررسی جوانه­زنی بذرهای گیاهان تراریخت در محیط کشت حاوی 75 میلی­مولار نمک، نشان داد که جوانه­زنی از روز دوم شروع شده و تا روز چهارم 90 درصد از بذرها جوانه زدند. اما جوانه زنی این بذور در محیط حاوی 100 میلی­مولار نمک از روز دوم شروع شده و تا روز دهم تنها 78 درصد بذرها جوانه ­زدند. با افزایش غلظت نمک تا 150 میلی مولارنیز تنها 15 درصد بذرها قابلیت جوانه زنی از خود نشان دادند (شکل 1-ب). همچنین این نتایج نشان داد که گیاهچه­های وحشی در تنش 100 میلی مولار نمک ابتدا به رنگ سفید درآمده و پس از مدتی از بین رفتند؛ اما گیاهچه­های تراریخت در همین محیط قادر به ادامه حیات بودند.

 

 

  

شکل 1- درصد جوانه­زنی الف(گیاهچه­های وحشی(WT) و ب( گیاهان تراریخت شده با ژن TRR1­4­(T17) بر روی محیط کشت MS حاوی غلظتهای مختلف NaCl در طی یک دوره 16 روزه.

 


انداره گیری میزان آنتوسیانین: در گیاهچه­های وحشی و تراریخت در غلظتهای مختلف نمک، نشان داد که در محیط فاقد نمک بین این دو نوع گیاه تفاوتی از نظر میزان آنتوسیانین وجود ندارد. اما در غلظت 75 میلی­مولار نمک، میزان آنتوسیانین در گیاهچه­های وحشی بیش از پنج برابر افزایش نشان داد. گیاهچه­های تراریخت نیز با تیمار شوری افزایش دو برابری در میزان آنتوسیانین خود نشان دادند. میزان آنتوسیانین در گیاهچه­های  وحشی و تراریخت رشد­یافته در محیط حاوی 100 میلی مولار نمک تفاوت معنی­داری را با گیاهچه­های رشد یافته در محیط کشت حاوی 75 میلی مولار نمک نشان نداد (شکل-2).

 

شکل 2- اثر تیمار غلظتهای مختلف NaCl بر میزان آنتوسیانین در گیاهچه­های وحشی (WT)  و تراریخت شده با ژن TRR17(T17)پس از 16 روز.  داده ها، حاصل میانگین چهار تکرار است.

 اندازه گیری سدیم، پتاسیم و نسبت پتاسیم به سدیم: نتایج حاصل نشان داد که در محیط فاقد نمک، میزان سدیم در گیاهچه­های وحشی و تراریخت با یکدیگر برابر است.  با تیمار شوری میزان سدیم در گیاهچه­های وحشی به طور معنی داری افزایش یافت؛ اما میزان سدیم در گیاهچه­های تراریخت به طور معنی­داری کمتر از گیاهچه­های وحشی است. میزان سدیم در گیاهچه های وحشی و تراریخت رشد یافته در محیط حاوی 100 میلی مولار نمک تفاوت معنی­داری را با یکدیگر نشان ندادند (شکل 3-الف)

اندازه­گیری میزان پتاسیم نیز نشان داد که در محیط فاقد نمک، میزان پتاسیم در گیاهچه­های وحشی سه برابر بیشتر از گیاهچه­های تراریخت رشد یافته در همین محیط است. با تیمار شوری میزان پتاسیم در گیاهچه­های وحشی و تراریخت کاهش یافت. از طرفی دیگر میزان پتاسیم در گیاهچه­های وحشی رشد یافته در محیط حاوی 100 میلی مولار کاهش چشمگیری را نشان داده در حالی که در همین محیط میزان پتاسیم در گیاهچه­های تراریخت افزایش 12 برابری را نشان داد (شکل 3-ب).

بررسی نسبت پتاسیم به سدیم نیز نشان داد که در محیط فاقد نمک و محیط حاوی 75 میلی­مولار نمک، این نسبت در گیاهچه­های وحشی بالاتر از گیاهچه­های تراریخت است؛  اما با افزایش میزان نمک تا 100 میلی مولار، این نسبت در گیاهچه­های تراریخت بالاتر از گیاهچه­های وحشی بوده است (شکل 3-ج).

 

  

  

شکل 3- اثر تیمار غلظتهای مختلف NaCl بر میزان الف) سدیم، ب) پتاسیم و  ج) نسبت پتاسیم به سدیم (K/Na) در گیاهچه­های وحشی (WT)  و تراریخت شده با ژن TRR14(T17)پس از 16 روز.  داده ها، حاصل میانگین چهار تکرار می باشد.

 


اثر تیمار شوری بر تعداد روزنه­های سطح برگ: بررسی وضعیت سلولهای اپیدرم برگ گیاهچه­های وحشی و تراریخت ­شده که در محیط فاقد نمک رشد یافته­اند، نشان داد شکل سلولها مشابه یکدیگر است. سلولهای اپیدرمی در گیاه وحشی و تراریخت شکل مشخصی نداشته و حاشیه  سینوسی دارند (شکل 4- الف). بررسیهای انجام شده نشان داد که بین تیمار صفر و 75 میلی­مولار نمک، تفاوت معنی­داری در شکل و وضعیت سلولهای اپیدرم و روزنه گیاهچه وحشی و تراریخت وجود ندارد؛ اما در گیاهچه­های وحشی رشد یافته در محیط حاوی 100 میلی­مولار نمک، شکل سلولهای اپیدرم تغییر یافته و حاشیه سلولها صاف شده­اند. از طرفی دیگر در این شرایط اندازه سلولها نیز کوچک شده است. همچنین روزنه­ها نیز از نظر اندازه کوچک­تر شده اما تعداد روزنه­ها در واحد سطح افزایش یافته است (شکل 4-ب). تعداد روزنه­ها در واحد سطح اپیدرم گیاهچه­های وحشی رشد­یافته بر روی محیط MS، برابر با 3/1±9 است؛ در حالی که در تیمار 100 میلی­مولار نمک تعداد روزنه به 1/2± 20 افزایش یافته است. در مقابل در گیاهچه­های تراریخت رشد­یافته در محیط فاقد نمک تعداد روزنه در واحد سطح 3/1±11 می­باشد که تفاوت معنی­داری را با تعدادروزنه­ها در واحد سطح گیاهچه­های وحشی نشان نمی­دهد. همچنین این نتایج نشان داد که در گیاهچه­های T17  رشد یافته در محیط حاوی 100 میلی­مولار نمک، اندازه سلولها ثابت باقی مانده اما جداره­های سلولی اندکی تغییر یافته و صاف شده­اند (شکل 4– ج). در این گیاهچه­ها  با تیمار نمک، تعداد روزنه­ها در واحد سطح اندکی کاهش نشان داد (2/1±8). نگاهی به داده­های جدول 1 نشان می­دهد که شاخص روزنه­ای در دو گیاهچه وحشی و تراریخت رشد ­یافته بر محیط MS تقریباً مشابه است. اما با تیمار نمک، این فاکتور در گیاهچه­های وحشی افزایش چشمگیری یافته در حالی که در گیاهچه­های ترایخت شاخص روزنه­ای اندکی کاهش یافته است (جدول 1).

جدول 1- شاخص روزنه­ای در گیاهچه­های وحشی (WT)  و تراریخت شده با ژن TRR17(T17)  پس از 16 روز رشد بر روی محیط MS و یا محیط MS حاوی 100 میلی مولار نمک.  داده ها، حاصل میانگین 4 تکرار است.

MS+NaCl

MS

Plant

31/0

23/0

WT

19/0

22/0

T17

 

  

شکل 4- اپیدرم و روزنه برگیاهچه­های وحشی آرابیدوپسیس (WT) وتراریخت­شده با ژن TRR14(T17)الف) تصویر میکروسکوپ نوری معمولی از اپیدرم گیاهچه­های وحشی بر روی محیط MS با بزرگنمایی 40، ب)تصویر میکروسکوپ نورمارسکی  از اپیدرم  گیاهچه­های وحشی بر روی محیط MS حاوی غلظت 100 میلی­مولار نمک با بزرگنمایی 10 و ج) تصویر میکروسکوپ نورمارسکی از اپیدرم گیاهچه­های T17 بر روی محیط MS حاوی غلظت 100 میلی­مولار نمک با بزرگنمایی 10.


بررسی فعالیت آنزیم ترهالاز: بررسی میزان فعالیت آنزیم ترهالاز در گیاهچه­های وحشی و تراریخت، نشان داد که در محیط فاقد نمک، فعالیت این آنزیم در گیاهچه­های تراریخت به طور معنی­داری بالاتر از گیاهچه­های وحشی است. نتایج نشان داد که با افزایش غلظت نمک در محیط کشت فعالیت این آنزیم در گیاهچه­های وحشی به طور معنی­داری افزایش می­یابد. اما فعالیت آنزیم ترهالاز در گیاهچه­های تراریخت با تیمار شوری تغییر معنی­داری را نشان نداد  (شکل- 5).

بررسی الگوی بیان ژن ترهالاز: بررسی وضعیت الگوی بیان ژن گیاهچه­های رشد­یافته در محیط MS، نشان داد که بیان ژن ترهالاز (TRE) در گیاهچه­های تراریخت بالاتر از گیاهچه­های وحشی است؛ اما با تیمار نمک بیان این ژن در گیاهچه­های وحشی به طور چشمگیری افزایش می یابد. همچنین در گیاهچه­های تراریخت نیز تغییر اندکی درالگوی بیان ژن ترهالاز مشاهده می شود (شکل 6- الف).

 

 

شکل 5- اثر تیمارغلظتهای مختلف NaCl بر فعالیت آنزیم ترهالاز در گیاهچه­های وحشی(WT)  و تراریخت شده با ژن TRR14(T17)  پس از 16 روز.  داده ها، حاصل میانگین 4 تکرار می باشد.

 

  

شکل 6- اثر تیمارغلظتهای مختلف NaCl بر الگوی بیان ژن الف) ترهالاز و ب) TRR14 در گیاهچه­های وحشی (WT)  و تراریخت شده با ژن TRR14(T17)  پس از 16 روز.

بررسی الگوی بیان ژن : TRR14: نتایج حاصل از بررسی بیان ژن  در دو گروه گیاهچه­های وحشی و تراریخت شده با همین ژن، نشان داد که در گیاهچه­های تراریخت میزان بیان این ژن بالاتر از گیاهچه­های وحشی است؛ که  این امر تأییدی بر تراریخت شدن این گیاه است.  بررسی الگوی بیان ژن TRR14، نشان داد که بیان این ژن در گیاهچه­های وحشی تیمار شده با غلظتهای مختلف نمک نسبت به گیاهچه­های وحشی رشد یافته در محیط فاقد نمک افزایش اندکی نشان می­دهد؛ اما در گیاهچه های رشد یافته در محیط حاوی 100 میلی مولار نمک میزان بیان این ژن نسبت به گیاهچه­های رشد یافته در محیط کشت فاقد نمک، افزایش بیشتری نشان می­دهد. در گیاهچه­های تراریخت نیز بیان ژن TRR14،  درغلظتهای مختلف نمک افزایش یافته است (شکل 6- ب).

بحث

TRR14 پروتئین ناشناخته کوچکی به طول 139 اسیدآمینه است. آنالیز فیلوژنی آشکار کرد که TRR14 یک عضو کوچک و منشعب از خانواده ژنی درآرابیدوپسیس است.  پروتئین TRR14 در کلروپلاست جای داشته و در تمام بافتها  بیان می شود (6). این پروتئین دارای 6 همولوگ در گیاه آرابیدوبسیس است و پارالوگهای این پروتئین در برنج و یونجه نیز شناسایی شده است (15 و 18). این پروتیین دارای دومین کیوپین منفرد با ساختار سوم است (10) گزارشها نشان داده که پروتئینهای با ساختار کیوپین مانند ژرمین و پروتئین های مشابه ژرمین در پاسخ به تنشها نقش دارند (8 و 10).  

 نتایج تحقیقات حاضر نشان داد که تراریخت­شدن گیاه Arabidopsis thaliana با ژن TRR14، سبب افزایش درصد جوانه­زنی و میزان ماندگاری گیاهچه­ها در تنش شوری می شود. همان­گونه که پیش از این نیز نشان داده شد؛ تنش شوری سبب کاهش جوانه­زنی و میزان ماندگاری در این گیاه می شود (16). اثر شوری بر جوانه­زنی تعدادی از گیاهان زراعی نظیر گندم و بادام زمینی مورد بررسی قرار گرفته است. این نتایج نشان می­دهد که با افزایش شوری درصد جوانه زنی کاهش می­یابد (1 و 4). پیش از این نیز بررسیهای انجام شده بر روی گیاهان فاقد ژن TRR14 نشان داده که این گیاهان قادر به جوانه زنی در محیط کشت حاوی نمک نبوده و در مقایسه با گیاهان وحشی حساسیت بیشتری به نمک دارند (6). نتایج حاضر نشان داده که تراریخت شدن گیاهان با ژن TRR14  می تواند سبب افزایش میزان جوانه زنی در محیط حاوی نمک شود.

تنش شوری سبب افزایش جذب سدیم توسط گیاه می شود (12) که نتیجه آن افزایش میزان سدیم در دو بخش هوایی و ریشه گیاه است. از طرفی شوری سبب کاهش میزان پتاسیم بخش هوایی و ریشه می شود (3).  نتایج حاضر نیز نشان داده که تنش شوری سبب افزایش میزان سدیم در گیاهچه­های وحشی و تراریخت شده است؛ اما میزان جذب سدیم در گیاهچه­های وحشی به مراتب بالاتر از گیاهچه تراریخت بوده است. نکته مهم و قابل توجه در ارتباط با گیاهچه­­های تراریخت آن است که میزان پتاسیم داخلی این گیاهچه­ها در شریط عاری از تنش، 3 برابر کمتر از گیاهچه وحشی است. اما با تیمار 75 میلی­مولار نمک، میزان پتاسیم در هر دو نوع گیاهچه کاهش یافته است. علاوه بر این، گیاهچه­های تراریخت در تیمار 100 میلی­مولار نمک توانسته­اند نسبت پتاسیم به سدیم را در خود بالا نگه ­دارند. بررسیها نیز نشان داده که چنانچه گیاه بتواند در تنش شوری توانایی جذب پتاسیم را نسبت به سدیم) K+/Na+ ( بالا نگه دارد قادر به مقاومت به تنش شوری خواهد بود (34).

یکی از نشانه­های تنش بر روی گیاهان تجمع آنتوسیانین می­باشد (30).  نتایج حاضر نیز نشان داد که گیاهچه های تراریخت نسبت به گیاهچه­های وحشی در تنش شوری میزان آنتوسیانین کمتری انباشته کرده­اند که تأییدی بر مقاومت نسبی گیاهان تراریخت نسبت به تنش شوری است. گزارشهای پیشین نیز نشان داد که در تیمار شوری میزان فعالیت آنزیمهای آنتی اکسیدان در گیاهان تراریخت بالاتر از گیاهچه­های وحشی بوده که نشان دهنده فعال شدن سیستمهای آنتی اکسیدان جهت مقابله با تنش شوری بوده است (7).  

از جمله اثرات تنش بر گیاهان، تغییر تعداد و اندازه سلولهای اپیدرمی و روزنه است (2). در نتایج حاضر، گیاهچه­های تراریخت استراتژی کاهش تعداد روزنه در واحد سطح را به کار بسته­اند تا در این شرایط از به هدر رفتن آب جلوگیری کنند. وان هوت و همکارن در سال 2013 نشان داده­اند که در گیاهان تراریخت آرابیدوپسیس مقاوم به خشکی، تعداد روزنه­های  برگ در واحد سطح گیاه در شرایط تنش کمترشده که نتیجه آن کاهش کمتر آب گیاه و مقاومت بهتر گیاهچه­های تراریخت در تنش خشکی بوده است (32).

بررسی الگوی بیان ژن نیز نشان داده که بیان ژن ترهالاز در گیاهچه­های تراریخت بالاتر از گیاهچه وحشی است؛ که این امر باید در بررسیهای آتی مورد بحث بیشتری قرار گیرد تا رابطه بین بیش بیانی TRR14 و ترهالاز مشخص شود. پیش از این نیز نشان داده شده که TRR14 در سیگنالینگ قند ترهالوز نقش دارد و ممکن است افزایش بیان ترهالاز در گیاهان تراریخت همین امر باشد. تیمار شوری سبب افزایش بیان ژن ترهالاز در گیاهچه وحشی شده است که به موازات آن افزایش معنی­دار در فعالیت آنزیم ترهالاز نیز دیده می شود. در مقابل تغییر اندکی در میزان بیان ژن ترهالاز در گیاه تراریخت دیده شده است. اندازه­گیری فعالیت آنزیم ترهالاز نیز نشان داده که تنش شوری تغییر معنی­داری را در فعالیت این آنزیم در گیاهان تراریخت ایجاد نکرد. نتایج تحقیقات وان هوت و همکاران در سال 2013 نشان داد که تراریخت­­شدن گیاه Arabidopsis thaliana با ژن ترهالاز سبب افزایش مقاومت گیاهچه­ها به تنش خشکی می شود. اگرچه باید در نظر داشت که در گزارش وان­هوت و همکاران  فعالیت آنزیم ترهالاز در گیاهچه های تراریخت 100 برابر بالاتر از گیاهچه­های وحشی بود (32). در حالی که در تحقیق حاضر میزان افزایش فعالیت این آنزیم چندان بالا نبوده است. بنابراین به نظر نمی­رسد که در این تحقیق علت مقاومت گیاهان تراریخت به تنش شوری ناشی از افزایش فعالیت آنزیم ترهالاز باشد.

بررسی الگوی بیان TRR14 نیز نشان داده که شوری سبب افزایش بیان این ژن می شود و همین امر نشان­دهنده نقش این ژن در مقاومت به شوری در گیاه  Arabidopsisاست. پیش از این نیز بررسیهای انجام شده بر روی گیاهان جهش یافته در ژن TRR14 نشان داده که این گیاهان در مقایسه با گیاهان وحشی آرابیدوپسیس نسبت به تنش شوری حساسیت بیشتری دارند (6). این نتایج نشان می دهد که تراریخت شدن گیاهان با ژن TRR14  می تواند سبب افزایش مقاومت آنها به تنش شوری شود.

در مجموع به نظر می­رسد که گیاه Arabidopsis  تراریخت  شده با ژن TRR14 با کاهش تعداد روزنه در واحد سطح توانسته با شوری مقابله نماید. با توجه به آنکه در گیاه تراریخت میزان پتاسیم سه برابر کمتر از گیاه وحشی می باشد، بنابراین کارهای بیشتری در این زمینه به ویژه بر روی کانالهای پتاسیم و یا بیان ژنهای مرتبط لازم است صورت گیرد تا نقش واقعی ژن TRR14 در مقاومت به تنش روشن شود.

1-      افشار­محمدیان، م.، ابراهیمی نوکنده، س.، دمسی، ب.، و جمال امیدی، م.، 1394. بررسی تاثیر سطوح مختلف شوری بر جوانه زنی و شاخص های رشد چهار رقم بادام زمینی. مجله پژوهش­های گیاهی. 28(1): 33-23.

2-      اقدسی، م.، 1380. تغییرات ریختی و تشریحی پنبه در تنش شوری ناشی از کلرور سدیم. مجله علوم کشاورزی و منابع طبیعی. 8: 88-79.

3-      بندانی، م.، و عبدلزاده، ا.، 1386. اثر تغذیه سیلیکون در تحمل به شوری در گیاه پوکسینلیا دیستنس (Puccinelliadistans). مجله علوم کشاورزی و منابع طبیعی. 14: 119-114.

4-      قلی نژاد، م.، .1393 تاثیر سطوح مختلف شوری بر جوانه زنی و رشد گیاهچه ژنوتیپ های مختلف گندم. مجله پژوهش­های گیاهی. 27 (2): 287-276.

 

5-       Aghdasi, M. 2007. Analysis of trehalose-6-phosphate control over carbon allocation and growth in plants. PhD Thesis, Utrecht University.

6-       Aghdasi M,Fazli F and Bagherieh-Najar B, 2012. Analyses of Arabidopsis trr14 T-DNA insertion Mutants Reveal an Essential Role in Seed Germination. Plant Mol Biol Reporter, 30: 319-329.

7-       Aghdasi M, Fazli F and Bagherieh-Najar B, 2012. Cloning and expression analysis of Arabidopsis TRR14 gene under salt and drought stress. J Cell Mol Res, 4: 1-10.

8-       Berna A and Bernier F. 1999. Regulation by biotic and abiotic stress of the wheatgermin gene encoding oxalate oxidase, an H2O2-producing enzyme. Plant Mol Biol, 39:539-459. 

9-       Brugnoli E and Lauter M, 1991. Effects of salinity conductance, photosynthesis capacity and carbon isotope discrimination of salt tolerant and salt –sensitive C3 non-halophytes. Plant Physiol, 95:628-635.

10-   Dunwell JM, Culham A, Carter CE, Sosa-Aguirve CR and Goodenough PW, 2001. Evolution of function divercity in the Cupin superfamily. Trends Biochem Sci. 26:740-745.

11-   Elbin AD, Pan YT, Pastuszak I and Carroll D, 2003. New insights on trehalose: a mollification molecule. Glycobiology, 13: 17R-27R.

12-   Garcia-Lidon JM, Ortiz JM, Garcia-Leqaz M and Creda A, 1998. Role of root Stock and scion on root and leaf ion accumulation in lemon trees grown under saline condition, Fruits, 53: 89-97.

13-   Holmstrom KO, Mantyla E Welenin B, Mandal A and Palva ET, 1996. Drought tolerance in tobacco. Nature, 379: 683-684.

14-   Karim S, Lundeh D, Holmostro M, Mandal A and Pirhonen M, 2005. Structural and functional characterization of AtPTR3, a stress induced peptide transporter of Arabidopsis. J Mol Model, 11: 226-236.

15-   Kim JY, Park SG, Jung B, Jung C, Ann S, Gho K, Han O and Kung H, 2007. Functional characterization of a glycin-rich RNA-binding proein 2 inArabidopsis thaliana under abiotic stress conditions. Plant J, 50: 439-451.

16-   Kuak KJ, Kim YO and Kang H, 2005. Characterization of transgenic Arabidopsis plant overexpressing GR-RBP4 under high salinity, dehydration or cold stress. J Exp Bot, 56: 3007-3016.

17-   Mahajan S, Pandey GK and Tuteja N, 2008. Calcium- and salt-stress signaling in plants: shedding light on SOS pathway. Archives of Biochemistry and Biophysics, 471: 146–158.

18-   Marcher-BauerA and Bryant SH, 2004. CD-Search: protein domain annotation on the fly. Nucleic Acids Res, 32:W327–W33.

19-   Mita S, Murano N, Akaike M and Nakamura K, 1997. Mutants of Arabidopsis thaliana with pleiotropic effects on the expression of the gene for beta-amylase and on the accumulationof anthocyanin thatis inducible by sugars. Plant J, 11: 841-851.

20-   Muller, J., Boller, T., and Wiemken, A. 1995. Trehalose and trehalase in plants: recent developments. Plant Sci, 8: 112-119.

21-   Muller, J., Aeschbacher, R.A., Wingler, A., Boller, T. and Wiemken, A, 2001.Trehalose and trehalase in Arabidopsis. Plant Physiol, 125: 1086-1093.

22-   Munns, R. and Tester, M. 2008. Mechanisms of salinity tolerance. Ann Rev Plant Biol, 59: 651–681.

23-   Murashige T and Skoog F, 1962. A revised medium for rapid growth and bioassays with tobacco tissue cultures. Plant Physiol, 15: 473-479.

24-   Nunes C, Scluepmann H, Delatte T, Wingler A,  Silva AB, Feverio PS, Jansen M, Fiorani F, Wiese A, Paul M, 2013. Regulation of growth by trehalose pathway. Plant Signal Path, 8:1-3.

25-   Pellny TK, Ghannoum O, Conroy JP, Schluepmann H, Smeekens S, Andralojc J, Krause KP, Goddijn O and Paul MJ, 2004. Genetic modification of photosynthesis with E. coli genes for trehalose synthesis. Plant Biotech J, 2: 71–82.

26-   Prado FE, Gonzalez JA, Boero C and SampietroA R, 1998. A simple and sensitive method for determining reducing sugars in plant tissues. Application to quantify the sugar content in quinoa seedlings. Phytochem Analysis, 9: 58-63.

27-   Sambrook J and Russell DW, 2001. Molecular Cloning: Lalaboratory manual. Cold Spring Harbor Laboratory Press, New York.

28-   Schluepmann H, Pellny T, Van Dijken A, Smeeekens S and Paul M, 2003. Trehalose- 6-phosphate is indispensable for carbohydrate utilization and growth in Arabidopsis thaliana. Proc Nat Acad Sci USA, 100: 6849–6854.

29-   Schluepmanne H, Van Dijken A, Aghdasi M,Wobbes B, Pual M and Smeekens S, 2004. Trehalose mediated growth inhabitation of Arabidopsis seedlings is due to trehalose-6- phosphate accumulation. Plant Physiol, 135: 879-890.

30-   Teng S, Keurentjes J, Bentsink L, Koornneef M and Smeekens S, 2005. Sucrose-Specific Induction of Anthocyanin Biosynthesis in Arabidopsis Requires the MYB75/PAP1 Gene. Plant Physiol, 139: 1840-1852.

31-   Van Dijken AJ, Schluepmann H and Smeekens SC, 2004. Arabidopsis trehalose-6-phosphate synthase 1 is essential for normal vegetative growth and transition to flowering. Plant Physiol, 135: 969-977.

32-   Van Houtte H, Vandesteene L, Lopez-Galvis L, Lemmens L, Kissel E, Carpentier S, Feil R, Avonce N, Beeckman T, Lunn JE and Van Dijck P, 2013. Overexpression of the trehalase gene AtTRE1 leads to increased drought stress tolerance in Arabidopsis and involved in abscisic acid-induced stomatal closure. Plant Physiol, 161: 1158-1171.

33-   Yashida R, Hobo T and Ichimura K, 2002. ABA –activated SnRK2 protein kinase is required for dehydration stress signaling in Arabidopsis. Plant Cell Physiol, 43: 1473-1483.

34-   Zhang Q, Su LL and Wu S, 2008. Characterization and expression of a vacuolar Na+/H+antiporter gene from the monocot halophyte Aeluropuslittoralis. Plant Physiol Biochem, 46: 117-126.

35-   Zhu JK 2002. Salt and drought signal transduction in plants. Ann Rev Plant Physiol, 136: 2621-2632.