نوع مقاله: مقاله پژوهشی

نویسندگان

1 دانشجوی کنترل بیولوژیک بیماری های گیاهی دانشگاه تهران

2 استاد گروه گیاهپزشکی دانشگاه تهران

3 استادیار پژوهشکده تحقیقات کشاورزی، پزشکی و صنعتی سازمان انرژی اتمی ایران

4 دانش آموخته کارشناسی ارشد دانشگاه تهران

چکیده

چکیده
در این تحقیق، خصوصیات زیستی و مولکولی سویه Pseudomonas fluorescens UTPF5 به عنوان یک باکتری مهم بیوکنترل در ایران، مورد ارزیابی قرارگرفته است. تاثیر نانوذرات نقره، تاثیر باکتری در لاکاز قارچی و همچنین جنبه های مولکولی باکتری از جمله ردیابی ژن های phlA و phlD و hcnAB بررسی شد. مقدار بازدارندگی این سویه از بیماریزایی نماتد Meloidogyne javanica، تعیین شد. عصاره، سوسپانسیون و ترکیبات فرّار باکتری به ترتیب باعث کاهش 35، 25 و 85 درصدی در تفریخ تخم شده و افزایش مرگ و میر لارو در اثر عصاره و ترکیبات فرّار باکتری به ترتیب به میزان 53-34 و 85 درصد تعیین شد درحالی که سوسپانسیون باکتری در مرگ و میر لارو تاثیری ندارد. افزایش غلظت نانوذرات نقره از 25/0 تا 2 میکرولیتر بر لیتر سبب افزایش تشکیل بیوفیلم و از این غلظت به بعد روند کاهش در تشکیل بیوفیلم می شود. سویه UTPF5 واجد ژن های phlD، phlA و hcnAB است. افزودن عصاره باکتری به محیط کشت جدایه قارچی، بر تولید آنزیم لاکاز توسط آنها تاثیر داشت و میزان تولید آنزیم در سه غلظت منتخب عصاره باکتری تفاوت معنی داری در سطح احتمال 01/0 درصد نشان داد. در بررسی های گلخانه توانایی بیوکنترل بیمارگرهای هدف و افزایش رشد گیاهان به اثبات رسید. بطور کلی این سویه P. fluorescens UTPF5 اثرات بیوکنترلی بسیار خوبی نشان داد و ویژگی های مولکولی آن نیز از طریق ردیابی ژن های مهم مورد بررسی قرار گرفت.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Assessment of molecular and biological properties of Pseudomonas fluorescens UTPF5 biological agent of Meloidogyne javanica in tomato

چکیده [English]

Abstract
In this study, the biological and molecular features of Pseudomonas fluorescens UTPF5 is evaluated as an important bacterial in IRAN. Effect of silver nanoparticles, effect of bacteria on laccase and also molecular aspect of UTPF5 (detection of phlD, phlA and hcnAB genes) examined. In this research, biocontrol ability of Pseudomonas fluorescens UTPF5 was studied on the root knot nematode Meloidogyne javanica in tomato Also inhibition of nematode pathogenicity is determined. Bacterial extract, suspension and volatile causes 35%, 25% and 85% reduction in nematode egg hatching respectively. J2 mortality induces 34-53% and 85% in effect of bacterial extract and volatile respectively, whereas suspension has no effect in j2 mortality. Biofilm formation is promoted by 0/25-2 µL silver nanoparticle. The strain UTPF5 has phlD, phlA and hcnAB genes. Culture filtrate of bacteria effected laccase enzyme significantly. Considering the disease measurement following seed treatment with the bacterium, gall index, the number of galls and all eggs in root system were considerably reduced. Biocontrol potential and plant growth promotion is described by application of the bacterium in greenhouse trials. Generally UTPF5 has good biocontrol effect and also molecular features study with detection important genes.

کلیدواژه‌ها [English]

  • laccase
  • root knot nematode
  • silver nanoparticle

ارزیابی ویژگیهای مولکولی و زیستی باکتری  Pseudomonas fluorescens UTPF5 عامل بیوکنترل Meloidogyne javanica روی گوجه­فرنگی 

نگار باقری1، مسعود احمدزاده1*، حمیده افشارمنش2 و زهرا صابر باغبان1

1 تهران، دانشگاه تهران، گروه گیاهپزشکی

2 تهران، سازمان انرژی اتمی ایران، پژوهشکده تحقیقات کشاورزی، پزشکی و صنعتی

تاریخ دریافت: 7/12/93                تاریخ پذیرش: 2/3/94

چکیده

در این تحقیق، خصوصیات زیستی و مولکولی سویه Pseudomonas fluorescens UTPF5 به عنوان یک باکتری مهم بیوکنترل در ایران، مورد ارزیابی قرارگرفته است. تأثیر نانوذرات نقره، تأثیر باکتری در لاکاز قارچی و همچنین جنبه های مولکولی باکتری از جمله ردیابی ژنهای phlA و phlD و hcnAB بررسی شد. مقدار بازدارندگی این سویه از بیماری زایی نماتد Meloidogyne javanica، تعیین شد. عصاره، سوسپانسیون و ترکیبات فرّار باکتری بترتیب باعث کاهش 35، 25 و 85 درصدی در تفریخ تخم شده و افزایش مرگ و میر لارو در اثر عصاره و ترکیبات فرّار باکتری بترتیب بمیزان 53-34 و 85 درصد تعیین شد درحالی­که سوسپانسیون باکتری در مرگ و میر لارو تأثیری ندارد. افزایش غلظت نانوذرات نقره از 25/0 تا 2 میکرولیتر بر لیتر سبب افزایش تشکیل بیوفیلم و از این غلظت به بعد روند کاهش در تشکیل بیوفیلم می­شود. سویه UTPF5 واجد ژنهای phlD، phlA و hcnAB است. افزودن عصاره باکتری به محیط کشت جدایه قارچی، بر تولید آنزیم لاکاز توسط آنها تأثیر داشت و میزان تولید آنزیم در سه غلظت منتخب عصاره باکتری تفاوت معنی­داری در سطح احتمال 01/0 درصد نشان داد. در بررسیهای گلخانه توانایی بیوکنترل بیمارگرهای هدف و افزایش رشد گیاهان به اثبات رسید. بطور کلی این سویه P. fluorescens UTPF5 اثرات بیوکنترلی بسیار خوبی نشان داد و ویژگیهای مولکولی آن نیز از طریق ردیابی ژنهای مهم مورد بررسی قرار گرفت.

واژه های کلیدی: لاکاز، نانوذرات نقره، نماتد گره ریشه

* نویسنده مسئول، تلفن: 09122609100 ، پست الکترونیکی: ahmadz@ut.ac.ir 

مقدمه

 

در سه دهه اخیر تعداد زیادی از باکتریهای پروبیوتیک، شناسایی و تعداد کمی از آنها به صورت تجاری تولید شده­اند که باعث جلب توجه در استفاده از آنها به عنوان روش جایگزین مناسبی برای فرآورده­های شیمیایی شده­است (9). کاربرد وسیع ریزوباکتریهای تحریک کننده رشد گیاهی در محصولات مختلف علاوه برکاهش مصرف کودهای شیمیایی و آفت کشها سبب افزایش رشد گیاه و به تبع آن افزایش محصول می­شود. این عوامل با رقابت برای موادی از جمله آهن و یا تولید آنتی­بیوتیکها یا آنزیمهای لیزکننده قادر به کنترل همزمان بیماریهای گیاهی هستند (13).

ضرورت انجام این پژوهش که شامل دستیابی به باکتریهای مؤثر که قابلیت تجاری­سازی و کاربرد در سطح مزارع و باغات را داشته باشند، از اهمیت خاصی برخوردار است. معرفی این جدایه­ها برای توسعه کنترل بیولوژیک در کشور بسیار ضروری است.

عموماً قارچها در تقابل با آنتاگونیست­ها یا میکروارگانیسم­های رقابت­کننده دیگر، آنزیم اکسید­کننده فنول لاکاز را در منطقه برخورد، تولید می­نمایند که بنظر می­رسد در محافظت از آنها در برابر ترکیبات آنتی­بیوتیک و تنشهای اکسیداتیو سلولی نقش داشته باشند (6). القای لاکاز در برخی قارچها به عنوان روشی برای مقاومت به عوامل آنتاگونیست است (25 و 34). چهار ژن لاکاز در قارچ Rhizoctonia solani شناسایی شده است (32).

ترکیبات فرّار باکتریها مثل الکلها و آلدهیدها و ترکیبات آروماتیک و سولفیدها و کتونها باعث کاهش فعالیت لاکاز در قارچهای Magnaporthe oryzae و Gaeumannomyces graminis می­شوند. لاکازها در مسیر بیوسنتز ملانین نقش دارند و کاهش فعالیت آن سبب افزایش پیش­ماده سنتز ملانین که خاصیت آنتی­بیوتیکی دارد و در نتیجه باعث تجمع آن می­شود. بنابراین ترکیبات فرّاری که توسط آنتاگونیست­ها تولید می­شوند، می­توانند مکانسیمهای دفاع ساختاری و بیوشیمیایی را در قارچ القاء کنند. باکتری Pseudomonas fluorescens آنزیم لاکاز را القاء می­کند که در پلیمریزاسیون ملانین در R. solani دخالت دارد، القای لاکاز پاسخی به جریان ریزش کلسیم بوده که یک علامت سلولی هنگام تنش کشنده است (6). رادیکالهای آزاد ناشی از فعالیت لاکاز ترکیبات آنتی­بیوتیک را غیرسمی می­کنند (4). 

نماتد گره ریشه گوجه­فرنگی Meloidogyne javanica از عوامل خاکزاد است که مکانیسمهای مؤثر در کنترل بیولوژیک این نماتد در توسعه گال ریشه، تفریخ تخم و زنده­مانی به طور مستقیم با تولید متابولیتهای سمی یا به طور غیرمستقیم با افزایش مقاومت سیستمیک در گیاه اثر می­گذارند. افزایش مقاومت سیستمیک نیز باعث کنترل Meloidogyne روی گیاه گوجه­فرنگی تیمار شده با Pseudomonas می­شود (1).

ژنهای گزارشگر ابزاری مناسب را برای ردیابی بیان ژن در محیطهای طبیعی فراهم می­آورند. سیستم ژن گزارشگر، شامل ژنی است که فاقد پروموتر طبیعی خود بوده و تنها هنگامی می­تواند نسخه­برداری شود که به پایین دست یک پروموتر خارجی الحاق گردد. سیستم گزارشگر باید حساس بوده، تعیین کمیت آن براحتی امکان­پذیر باشد و به تغییر در فعالیت نسخه­برداری پاسخ دهد (14). ژنهای گزارشگر متعددی در مطالعات اخیر اکولوژی میکروبی مورد استفاده قرار گرفته­اند که می­توانند براساس فنوتیپهای منحصر بفرد خود تعیین کمیت شوند. ژن گزارشگر phlA-lacZ برای بررسی تأثیر عوامل محیطی مختلف بر تولیدDAPG (2,4-diacetylphloroglucinol)  در شرایط ریزوسفر با موفقیت مورد استفاده قرار گرفته­است (15، 16 و 20). با استفاده از تکنیک ژنهای گزارشگر، محققین بیان ژنهای بیوسنتزکننده آنتی­بیوتیکهایی چون PCA ، DAPG و Plt را در شرایط in situ به اثبات رسانیده­اند (19 و 20).

هدف از این پژوهش معرفی برخی خصوصیات مهم سویه UTPF5 P. fluorescens می­باشد. دانستن این خصوصیات در استفاده بهینه در شرایط مختلف زراعی و نیز در فرآیند تجاری­سازی نقش مهمی دارد.

مواد و روشها

تهیه باکتری UTPF5 P. fluorescens، قارچ R. solani و نماتد M. javanica : باکتری UTPF5 P. fluorescens از کلکسیون باکتریهای آنتاگونیست، قارچ Rhizoctonia solani از کلکسیون قارچ­شناسی و نماتد به طور خالص از گروه گیاهپزشکی دانشگاه تهران دریافت شد.

سنجش MIC (حداقل غلظت بازدارندگی) نانوذرات نقره روی UTPF5 P. fluorescens : برای این منظور آزمون بروش میکروتیترپلیت انجام شد. غلظتهای مورد استفاده نانوذرات شامل 25/0، 5/0، 1، 2، 4 و 8 میکرولیتر بر لیتر تهیه شدند، که در تمامی مراحل رقیق­سازی محلول نانوذرات نقره با استفاده از آب مقطر استریل، با 7=pH و در لوله­های استریل با حجم 50 میلی­لیتر انجام شد. روش کار (27) بدین صورت بود، که در هریک از چاهکهای میکروپلیت، 80 میکرولیتر محیط کشت استریل NB (Nutrient Broth) ریخته شد و سپس 40 میکرولیتر از غلظتهای مختلف محلول نانوذرات نقره به چاهکهای مورد نظر اضافه و در مرحله آخر نیز 80 میکرولیتر از سوسپانسیون باکتری با جذب، 5/0 برای رسیدن به حجم نهایی 200 میکرولیتر به چاهکها اضافه شدند سپس میکروپلیت بمدت 24 ساعت در دمای 28 درجه نگهداری شد. پس از 24 ساعت، جذب هر یک از چاهکها با استفاده از دستگاه الیزا ریدر و در طول موج 600 نانومتر اندازه­گیری شد (27).

سنجش MBC (حداقل غلظت باکتری­کشی) نانوذرات نقره روی UTPF5 P. fluorescens : پس از آماده­سازی محیط کشت NA (Nutrient Agar) حاوی غلظتهای 3، 5، 7، 10، 15، 20، 25، 30، 35، 40 و 45 میکرولیتر بر لیتر از ذرات نانونقره، از کشت 24 ساعت باکتری بر روی محیط NA یک لوپ به لوله حاوی ده سی سی آب مقطر استریل منتقل شد و بمدت پنج دقیقه ورتکس شد، جذب آنها با استفاده از دستگاه اسپکتروفتومتر روی 5/0 تنظیم، سپس سری رقت هفتم از باکتری تهیه شد. از سری رقت هفتم، 100 میکرولیتر روی محیط پخش شد. سپس نمونه بمدت 24 ساعت در دمای 28 درجه نگهداری شدند (27). رشد کلنیها پس از 40 ساعت شمارش شد.

بررسی اثر نانوذرات نقره بر تشکیل بیوفیلم جدایه باکتریایی UTPF5 P. fluorescens : آزمون بروش میکروتیترپلیت انجام شد. از کشت 24 ساعت باکتری روی محیط NA بمیزان یک لوپ داخل ظروف ارلن حاوی 50 سی سی محیط کشت TSB (Tryptic Soy Broth) منتقل شد و نمونه­ها بمدت 24 ساعت در شیکر انکوباتور با دمای 28 درجه و 135 دور در دقیقه نگهداری شدند. در هر یک از چاهکهای میکروپلیت 80 میکرولیتر محیط کشت TSB استریل ریخته شد و سپس 40 میکرولیتر از غلظتهای مختلف محلول نانوذرات نقره به چاهکهای مورد نظر اضافه و در مرحله آخر نیز 80 میکرولیتر از سوسپانسیون باکتری به چاهکها برای رسیدن به حجم 200 میکرولیتر اضافه شدند. سپس میکروپلیت بمدت 24 ساعت در دمای 28 درجه سانتی گراد نگهداری شد و در نهایت، جذب هر چاهک با طول موج 492 نانومتر و با استفاده از دستگاه الیزا ریدر مقدار تشکیل بیوفیلم اندازه­گیری شد (27).

بررسی اثر غلظتهای مختلف نانوذرات نقره بر تولید آنزیم لیپاز در جدایه باکتریایی UTPF5 P. fluorescens : محیط کشت مناسب برای بررسی لیپاز شامل 10 گرم پپتون، 5 گرم کلرور سدیم، 1/0 گرم کلرور کلسیم، 15 گرم آگار، 10 میلی­لیتر توئین 20 در یک لیتر آب مقطر است. محیط را داخل هشت ظرف ارلن تقسیم و غلظتهای 25/0، 5/0، 1، 2، 4، 8 و 10 میکرولیتر بر لیتر به محیط کشت اضافه و در پتریهای استریل تقسیم شدند. کشت 24 ساعته باکتری روی این محیطها کشت و بمدت 24 ساعت در 28 درجه سانتی گراد نگهداری شدند. پس از گذشت 24 ساعت با اندازه­گیری قطر رسوب اطراف کلنی باکتری که نشان­دهنده تجزیه توئین و تولید آنزیم لیپاز بود و با استفاده از فرمول زیر درصد بازدارندگی غلظتهای مختلف نانوذرات نقره از تولید آنزیم لیپاز محاسبه شد (27).

درصد بازدارندگی= قطر رسوبات اطراف شاهد- قطر رسوبات اطراف نمونه/ قطر رسوبات اطراف شاهد * 100

تولید لاکاز توسط R. solani در حضور غلظتهای مختلف عصاره باکتری: نحوه آماده­سازی قارچ برای این مرحله از آزمایشها بروش (5) انجام گرفت. پس از گذشت هفت روز از کشت قارچ در محیط زاپک، مایع 200 میکرولیتر از محیط مایع برداشته، با سرعت 5000 دور در دقیقه بمدت 10 دقیقه سانتریفیوژ شد. پنجاه میکرولیتر از مایع رویی به داخل ویال انتقال داده شد. در مرحله بعد با در نظر گرفتن تعداد نمونه­ها و اینکه هر نمونه نیاز به 50 میکرولیتر از مخلوط بافر سوکسینات سدیم 25 میلی­مولار با اسیدیته پنج و ABTS پنج میلی­مولار دارد و نیز با توجه به وزن مولکولی این دو ماده اقدام به تهیه این مخلوط شد. سپس50 میکرولیتر از آن بهر یک از نمونه­ها اضافه و پس از آن با استفاده از 900 میلی­لیتر آب مقطر، حجم نمونه­ها به یک میلی­لیتر رسید. بدین ترتیب نمونه­ها برای اندازه­گیری توسط اسپکتروفتومتر آماده شدند. پیش از اندازه­گیری نمونه­ها بمدت 30 دقیقه داخل انکوباتور در دمای 25 نگهداری شدند و پس از آن میزان نمونه­ها در طول موج 420 نانومتر توسط دستگاه اندازه­گیری شد. سپس درصد بازدارندگی از تولید آنزیم لاکاز توسط غلظتهای مختلف نانوذرات نقره با استفاده از فرمول زیر محاسبه شد (5):

درصد بازدارندگی= غلظت لاکاز در شاهد – غلظت لاکاز در نمونه/ غلظت لاکاز در شاهد × 100

افزودن غلظتهای مختلف عصاره باکتری به محیطهای کشت: R. solani - عصاره باکتری به سه نسبت حجم به حجم 5، 15 و 25 درصد به کشتهای 48 ساعته قارچ در محیط مایع زاپک اضافه شد و بمدت هفت روز در انکوباتور با دمای 28 درجه سانتی گراد در تاریکی و بدون تکان دادن نگهداری شدند. در نهایت 150 میکرولیتر از هر تیمار در 5000 دور بمدت 10 دقیقه سانتریفیوژ و 50 میکرولیتر از مایع رویی برای ارزیابی میزان فعالیت لاکاز استفاده شد (5).

تأثیر شرایط محیطی در القای لاکاز توسط R. solani در مجاورت با عصاره باکتری یا کشت همزمان با باکتری: فعالیت لاکاز در جدایه AG4 و باکتریایی UTPf5 و غلظت عصاره 15 درصد محیط کشت زاپک (5/1 میلی­لیتر عصاره در 10 میلی­لیتر محیط کشت) مورد استفاده قرار گرفت.

بررسی اثر عصاره کشت سوسپانسیون سلولی باکتری و ترکیبات فرّار UTPF5 روی تفریخ تخم M. javanica : با استفاده از روش صدیقی و همکاران (30)، مقدار تخم تفریخ شده محاسبه شد، همچنین روش صدیقی و شوکت (28)، برای اندازه­گیری تأثیر عصاره باکتری در مقدار تفریخ تخم نماتد استفاده شد. در مورد ترکیبات فرار از روش فرناندو و همکاران (7) با کمی تغییرات استفاده شد که باکتری در ظروف پتری دو قسمتی کشت داده، درب آن با پارافیلم بسته شد بعد از 24 ساعت 50 عدد تخم نماتد بسمت دیگر پتری اضافه شد، درب ظروف پتری با پارافیلم محکم شد و بعد از 72 ساعت بررسی صورت گرفت.

بررسی اثر عصاره کشت و سوسپانسیون باکتری و ترکیبات فرّار UTPF5 روی مرگ و میر لاروهای سن دوم M. javanica : طبق روش صدیقی و شوکت (28) با مقداری تغییرات، به منظور تعیین خصوصیت نماتدکشی سویه باکتریایی، یک میلی­لیتر از سوسپانسیون لاروهای تازه تفریخ شده (30 تا 40 لارو در هر میلی­لیتر) با دو میلی­لیتر از عصاره کشت باکتری به چاهکهای پلیت انتقال داده شد. عصاره کشت باکتری با درصدهای مختلف 25، 50، 75 و 100 نیز روی لاروها بکاربرده برده شد و مقدار مرگ و میر محاسبه شد. برای تعیین تغییر مرفولوژیکی لارو سن دوم بعد از 48 ساعت در معرض عصاره قرارگرفتن از چشمی عکاسی استفاده شد. ترکیبات فرّار نیز بهمان روش قبلی (7) اندازه­گیری شد و بعد از 24 و 48 ساعت تعداد لاروهای مرده محاسبه شد.

تعیین تحرک و جلب لاروهای سن دو نماتد با عصاره باکتری و سوسپانسیون باکتری: به منظور بررسی حرکت نماتدها از محیط آب آگار یک درصد استفاده شد. به این ترتیب که در وسط هر پتری محتوی آب آگار یک چاهک به قطر نیم میلی­متر ایجاد شد که درون هر چاهک عصاره باکتری با رقتهای 25، 50، 75 و 100 درصد و همچنین سوسپانسیون 108×8/1 (CFU/ml) باکتری ریخته­شده و در اطراف این چاهک به فاصله یک سانتیمتر از حاشیه پتری، چهار لارو سن 2 نماتد قرار داده شد؛ بعد از یک تا دو ساعت حرکت نماتدها بسمت چاهک (+) و بسمت خلاف جهت چاهک یا حاشیه پتری (-) اندازه­گیری شد. در ظروف شاهد بجای عصاره باکتری، آب به چاهکها اضافه شد (24)، بررسی حرکت نماتدها با قرار دادن پتریها در نور با زاویه 45 درجه و همچنین در زیر میکروسکوپ صورت گرفت (3).

استخراج تخم و لارو نماتد: برای استخراج تخم و به دست آوردن لارو سن دوم از روش هوسی و بارکر (11) استفاده شد. تخمهای استخراج شده در پتری حاوی آب قرار گرفته و در 25 درجه سانتی گراد نگهداری شد و لاروها به طور روزانه جمع­آوری شدند.

روش مایه­کوبی نماتد: با یک میله شیشه­ای در فاصله یک سانتیمتری طوقه گیاه سوراخی به عمق دو تا سه سانتیمتر در خاک ایجاد و به آرامی سوسپانسیون حاوی مخلوط تخم و لارو بمقدار 6500 عدد را طبق روش صدیقی و شوکت (29)  وارد این سوراخها کرده و دهانه آنها با خاک پر شد. همچنین مقدار نفوذ نماتد در حالتی که بذر با باکتری تیمار شده بود نیز بررسی شد.

تعیین مقدار نفوذ نماتد به ریشه: یک هفته بعد از تلقیح به طور کامل ریشه­ها را بیرون آورده و به منظور مشاهده لارو درون بافت ریشه رنگ­آمیزی شدند. ریشه­های آلوده حاوی نماتد بعد از شستشو با آب، بمدت یک دقیقه در لاکتوفنل اسیدفوشین درحال جوش قرار گرفتند، سپس بلافاصله ریشه­ها خارج شد و بعد از شستشو در زیر جریان آرام آب، ریشه­ها را در لاکتوفنل تنها بمدت 48 ساعت قرار داده تا رنگ از بافت ریشه­ها حذف شود. تعداد لارو نفوذ کرده به ریشه شمارش شدند. برای انجام این رنگ­آمیزی از روش اسیدفوشین لاکتوفنل استفاده شد که بافتهای حاوی نماتد را قرمز می­کند.

کنترل M. javanica توسط P. fluorescens UTPF5 در شرایط گلخانه­ای: در آزمایشهای گلخانه­ای از چهار روش برای تیمار بذور استفاده شد که شامل، تیمار بذر با باکتری، تیمار نشاها با باکتری، ریختن سوسپانسیون 108×8/1 باکتری و عصاره باکتری در خاک بود. چهار هفته بعد از کاشت بذور تیمار شده با باکتری و یک هفته بعد از نشاء و کاربرد سوسپانسیون و عصاره باکتری، تخم و لارو نماتد بمقدار 6000 عدد مخلوط تخم و لارو در اطراف ریشه­های گوجه­فرنگی به صورت ایجاد سه گودال با میله شیشه­ای و ریختن سوسپانسیون تخم و لارو به کار رفت. 60 روز بعد از مایه­کوبی نماتد، تمام گیاهان از ریشه به طور کامل درآمده و زیر شیر آب شسته شد، شاخه­ها از ریشه­ها جدا شد، درصد گلدهی و میوه در تیمار و شاهد محاسبه شد. وزن­تر و خشک ریشه و ساقه و طول آنها اندازه­گیری شد. قبل از خشک کردن ریشه­ها با استفاده از بیناکولر تعداد گالهای تولید شده بر روی تمام سیستم ریشه­ای شمارش شد.

تعیین شاخصهای بیماری: با استفاده از دو مقیاس شاخص گال بروش هوسی و جانسن (10) تعداد گال در کل سیستم ریشه­ای محاسبه و درصد شاخص گال تعیین شد. مقدار کل تخمها در ریشه با استفاده از روش استخراج تخم و شمارش آنها محاسبه شد.

اندازه­گیری کلروفیل: این اندازه­گیری بر مبنای روش آرنون (2) است. سپس با دستگاه الیزا ریدر مقدار جذب عصاره استخراج شده در طول موجهای 645 نانومتر، 663 نانومتر، 470 نانومتر، 480 نانومتر و 510 نانومتر قرائت شد.

با استفاده از روابط زیر مقدار کلروفیل a، کلروفیل b، کلروفیل کل و کاروتنوئید محاسبه شد.

  [(12.7× A663) – (2.69× A645)]×V / 1000× W= میلی­گرم کلروفیل a در هر گرم برگ تر 

= [(22.9× A645) – (4.69× A663)]×V / 1000× W  میلی­گرم کلروفیل b در هر گرم برگ تر 

[(20.2× A645) + (8.02× A663)]×V / 1000× W = میلی­گرم کلروفیل کل در هر گرم برگ تر 

  7.6×(A480)- 14.9 × (A510) × V/1000×W = میلی­گرم کاروتنوئید در هر گرم برگ تر 

A مقدار جذب در طول موج مورد نظر ، V حجم نهایی استون 80 درصد برحسب میلی­لیتر وW اندازه برگ تازه بر حسب گرم است.

ردیابی ژنهای phlA و phlD و hcnAB واکنش زنجیره­ای پلیمراز (PCR): از آغازگرهای اختصاصی برای ردیابی دو ژن مهم در سنتز دی استیل فلوروگلوسینول به نامهای phlA و phlD بشرح زیر استفاده شد. آغازگرهای phl2a و phl2b که برای تکثیر ژن phlD طراحی شده­اند 20 جفت بازی بوده و قادرند قطعه­ای بطول 745 جفت باز را تکثیر کنند (22). ردیف بازهای آغازگرها به صورت زیر است:

Phl2a (forward)         5´-GAG GAC GTC GAA GAC CAC CA -3´ 

Phl2b (reverse)          5´- ACC GCA GCA TCG TGT ATG AG -3´

آغازگرهای phl2a و phl2b ساخت شرکت MWG Biotech کشورآلمان است که دمای ذوب آنها بترتیب 4/59  و 4/61 درجه سانتی گراد است. باکتری روی محیط KB کشت داده و در دمای 27 درجه سانتی گراد بمدت 48 ساعت نگهداری شد.

تخریب سلولهای باکتری: به منظور تخریب سلولها مطابق روش زیر (33) استفاده شد.

مخلوط واکنش PCR: تکثیر در۲۰ میکرولیتر مخلوط واکنش انجام شد (جدول 1)(33).

 

جدول 1- مقادیر حجمی هر یک از مواد به کار رفته در ترکیب مخلوط واکنش PCR  با آغازگرهایphl2a  و phl2b

     مواد به کار رفته در واکنش                                          

حجم در واکنش (میکرولیتر)

آب دو بار تقطیر استریل

بافرxPCR۱۰

کلرید منیزیم ( MgCl2) (50 میلی­مول)

دی­متیل سولفوکسید ( DMSO) %۵

آلبومین سرم گاوی Bovine Serum Albumin=BSA mg/ml)20(

مخلوط دی نوکلئوزید تری فسفات ( dNTPs)

 ) 10 میلی­مول(

آغازگر   phl2a(10 پیکومول)

آغازگر phl2b(10 پیکومول)

آنزیم Smar Taq ( 5 واحد در هر میکرولیتر U/µl 5)

سلول متلاشی­­شده (cell lysate)

9

۲

۸/ ۰

1

5/0

۸/ ۰

 

۸/ ۰

۸/ ۰

3/0

4

حجم کل

20

 

 

مواد آورده شده در جدول 1 بجز سلولهای تخریب شده بترتیبی که نوشته شده در یک لوله 5/1 میلی­لیتری استریل ریخته­شده و بخوبی مخلوط شد. سپس مخلوط بمدت چند ثانیه با دور پایین ( 4000 دور) سانتریفیوژ شد. سلولهای تخریب شده به ازای هر جدایه در هر لوله 2/0 میلی­لیتری مخصوص PCR ریخته شده و سپس بهر لوله 16 میکرولیتر از مخلوط PCR اضافه شد. به منظور اطمینان از صحت آزمایش، در هر آزمایش از سویه CHA0 که دارای این ژن بود به عنوان شاهد مثبت و از بافر تخریب به عنوان شاهد منفی استفاده شد. لازم است تمام مراحل تهیه واکنش PCR روی یخ یا در جای خنک انجام گیرد.

برنامه حرارتی PCR : درب لوله­های فوق (2/0 میلی­لیتری) بخوبی بسته شد و بعد از یک سانتریفیوژ کوتاه و با دور پایین در داخل دستگاه ترموسایکلر قرار گرفت، سپس برنامه سیکل حرارتی PCR ( در 30 چرخه) با 5 درجه افزایش در دمای اتصال آغازگر بشرح زیر انجام گرفت (33).

  • 94 درجه، 2 دقیقه ( واسرشته سازی اولیه)، 94 درجه، ۳۰ ثانیه ( واسرشته سازی ثانویه)، 65 درجه، ۳۰ ثانیه (اتصال آغازگر با رشته DNA)، 72 درجه، 1 دقیقه ( بسط آغازگر)، 72 درجه، 10 دقیقه (بسط نهایی)

انجام PCR با آغازگرهای  phlA-1f و phlA-1f : این آغازگرها که برای تکثیر ژن phlA طراحی شده­اند 20 جفت بازی بوده و قادرند قطعه­ای بطول 418 جفت باز را تکثیر کنند (23). ردیف بازهای آغازگرها به صورت زیر است.

 phlA-1f (forward)         5´- TCA GAT CGA AGC CCT GTA CC-3´

 phlA-1r (reverse)           5´- GAT GCT GTT CTT GTC CGA GC-3´

این آغازگرها ساخت شرکت MWG Biotech کشور آلمان و دمای ذوب آنها 4/59 درجه سانتی گراد است. ابتدا یک لوپ از کلنی کشت دو روزه باکتری برداشته، در۵۰۰ میکرولیتر از محیط مایع KB داخل لوله­های 5/1 میلی­لیتری کشت شد. سپس نمونه­ها بمدت 16-14ساعت (فاز لگاریتمی) روی شیکر قرار گرفتند (23).

تخریب سلولهای باکتری: استخراج  DNAبه صورت مستقیم با تخریب سلولهای باکتری صورت گرفت. نتایج تخریب سلولی با استخراج DNA یکسان بوده است (23). به منظور تخریب سلولها، ۵ میکرولیتر از سوسپانسیون سلولی را با ۹۵ میکرولیتر بافرتخریب در یک لوله 2/0 میکرولیتری مخلوط کرده، سپس بمدت ۱۰ دقیقه در دمای ۹۹ درجه سانتی گراد داخل دستگاه ترموسایکلر حرارت داده شد. بافر تخریب همانند بافر ذکر شده در مورد  ردیابی ژن phlD  است.

 مخلوط واکنش PCR: تکثیر در۲۰ میکرولیتر مخلوط واکنش که مقادیر حجمی آن در جدول 2 آمده است،  انجام گرفت (23).

 

 

جدول 2- مقادیر حجمی هر یک از مواد به کار رفته در ترکیب مخلوط واکنش PCR با آغازگرهای  phlA-1f و phlA-1f

مواد به کار رفته در واکنش

حجم در واکنش(میکرولیتر)

آب دو بار تقطیر استریل

بافر x PCR۱۰

کلرید منیزیم ( MgCl2) (50 میلی­مول)

دی متیل سولفوکسید ( DMSO) %۵

مخلوط دی نوکلئوزید تری فسفات ( dNTPs)

 )10 میلی­مول(

آغازگر   phlA-1f(100 پیکومول)

آغازگر phlA-1r (100 پیکومول)

آنزیم Smar Taq ( 5 واحد در هر میکرولیتر U/µl 5)

سلول متلاشی­شده  (cell lysate)

3/9

۲

1

1

۸/ ۰

 

۸/ ۰

۸/ ۰

3/0

4

حجم کل

20

 

به منظور اطمینان از صحت آزمایش، در هر آزمایش از سویه CHA0 که دارای این ژن بود به عنوان شاهد مثبت و از بافر تخریب به عنوان شاهد منفی استفاده شد.

برنامه حرارتی PCR: برنامه حرارتی برای واکنش PCR و تکثیر قطعات DNA با کمی تغییر در روش رزونیکو (23) به صورت زیر تنظیم شد. این برنامه در 25 چرخه انجام گرفت.

94 درجه، ۵ دقیقه ( واسرشته سازی اولیه)، 94 درجه، ۳۰ ثانیه ( واسرشته سازی ثانویه)، 62 درجه، ۳۰ ثانیه (اتصال آغازگر با رشته DNA)، 72 درجه، ۴۵ ثانیه  ( بسط آغازگر )، 72 درجه، ۵ دقیقه (بسط نهایی)

برای مشاهده محصول PCR، الکتروفورز با ژل آگارز 1 درصد انجام گرفت. جهت رنگ­آمیزی باندهای DNA، ابتدا محلول اتیدیوم بروماید با غلظت 10 میلی­گرم در میلی­لیتر تهیه شد. برای مشاهده محصول و ثبت تصویر آن، از دستگاه Gel-Documentation استفاده شد.

انجام PCR با آغازگرهای PM2 وPM7-26R  برای ردیابی ژن hcnAB : بعد از تخریب سلولها PCR با استفاده از آغازگر مستقیم 31 نوکلئوتیدیPM2  و آغازگر معکوس 26 نوکلئوتیدی PM7-26R انجام گردید. این آغازگرها با استفاده از توالی توافقی hcn بین استرین CHA0 (کد دسترسی AF053760) و PAO1 Pseudomonas aeruginosa (کد دسترسی AF208523) طراحی شده بودند (31).

PM2 (Forward) TGCGGCATGGGCGTGTGCCATTGCTGCCTGG

PM7-26R (Reverse) CCGCTCTTGACTGCAATTGCAGGCC

PCR در 12 میکرولیتر شامل چهارمیکرولیتر از سوسپانسیون باکتری لایز شده، بافر PCR با مشخصات   (Amersham pharmacia, UPPsala, Sweden buffer,  PCR ×1) ، بوین سرم آلبومین (FLuka, Buchs, SG, Switzerland ; 0.5gl-1) ، 5 درصد دی متیل سولفوکساید (Fluka) ، 100 میکرولیتر از هر یک از نوکلئوتیدهای dATP، dCTP، dTTP، dGTP، (Amersham pharmacia)، 4/0 میکرومول از هر آغازگر و 4/1 واحد آنزیم Taq DNA Polymerase  انجام گرفت. واکنش تکثیر مطابق با قطعات تکثیر شده، با الکتروفورز ژل آگارز 5/1 درصد برای مدت حدود 5/1 ساعت در ولتاژ 160 از یکدیگر جدا شدند.

برنامه تکثیر ژن hcnAB با آغازگرهای PM2 و PM7-26R : 94 درجه، 2 دقیقه ( واسرشته سازی اولیه)، 94 درجه، ۳۰ ثانیه ( واسرشته سازی ثانویه)، 67 درجه، ۳۰ ثانیه ( اتصال آغازگر با رشته DNA)، 72 درجه، 1 دقیقه ( بسط آغازگر )، 72 درجه، 10 دقیقه (بسط نهایی)  

بررسی مولکولی استرین با استفاده از توالی نوکلئوتیدی 16S  rRNA- تکثیرrRNA  16S (PCR): استخراج DNA استرین UTPF5 براساس روش (33) انجام گرفت. در واکنش زنجیره­ای پلیمراز برای تکثیر 16S rRNA از آغازگر مستقیم PS16f و آغازگر معکوس PS16r استفاده شد.

PS16F (Forward) TGGCTCAGATTGAACGCTGGCGG

PS16r (Reverse) GATCCAGCCGCAGGTTCCCCTAC

مخلوط PCR شامل اجزای زیر بود (حجم نهایی با آب مقطر سترون به 35 میکرولیتر رسانده شد).

 

 

 

 

برنامه تکثیر rRNA 16S با استفاده از آغازگرهای PS16f و PS16r (8): oC 94، 5/2 دقیقه ( واسرشته سازی اولیه)، oC 94 ، ۳۰ ثانیه ( واسرشته سازی ثانویه)، oC 60 ، 1 دقیقه ( اتصال آغازگر با رشته DNA)،  oC ۷۲  ، 1 دقیقه ( بسط آغازگر)،  oC ۷۲ ،  10 دقیقه (بسط نهایی)

پس از انجام واکنش PCR، محصول بر روی ژل آگارز 5/1 درصد در 130 ولت بمدت 2 ساعت انجام شد و باند مورد نظر در هر نمونه بریده و برای بررسیهای بعدی نگهداری شد.

خالص­سازی محصول واکنش زنجیره ای پلیمراز: برای خالص کردن محصول واکنش زنجیره ای پلیمراز از کیت Wisard SV Gel and PCR Clean-Up System kit of Promega (Madison, WI) استفاده گردید. باندهای بریده شده درون لوله های میکروسانتریفیوژ قرار داده شد و وزن قطعه ژل حاوی باند تعیین شد. به ازای هر 10 میلی گرم قطعه ژل حاوی باند 10 میکرولیتر محلول باند شونده به غشا اضافه شد، پس از سانتریفیوژ، در دمای 55 درجه سانتی گراد در حمام آبی قرار گرفت و هر دو دقیقه یکبار ورتکس شد تا قطعه ژل کاملاً حل شود.

واکنش زنجیره ای پلیمراز جهت تعیین توالی: بدین جهت از کیت تعیین توالی Terminator V3-0 Cycle Sequencing  Kit استفاده گردید. آغازگرها استفاده شده PS16r و PS16f بودند. مخلوط واکنش تعیین توالی شامل اجزای زیر بود:

 

 

 

برنامه تکثیر rRNA 16s با آغازگرهای PS16f و PS16r : 95 درجه، 10 دقیقه ( واسرشته سازی اولیه)، 50 درجه، 5 دقیقه ( 99 سیکل)، 60 درجه، 4دقیقه  

تعیین توالی نمونه­ها: محصول حاصل از واکنش زنجیره­ای پلیمراز جهت تعیین توالی دارای اجزای اضافی، از جمله مواد مصرف نشده واکنش، بخصوص نوکلئوتیدهای نشاندار می باشد، جهت حذف این اجزا، خالص­سازی به وسیله ستونهای DNA grade و G-50 SepHadex انجام شد. تعیین توالی با استفاده از دستگاه 3100 genetic Analyser ABI Prism® انجام شد. توالیهای به دست آمده توسط نرم­افزار Sequencher package تحت سیستم مکینتاش (Macintosh) ویرایش گردیدند و برای مقایسه، از برنامه Molecular Evolutionary Genetics Analysis استفاده شد.

نتایج

تعیین MIC نانوذرات نقره بر UTPf5 - با افزایش غلظت نانوذرات نقره، کاهش معنی­داری در میزان جذب، در طول موج 600 نانومتر نسبت به شاهد در اکثر موارد مشاهده شده است. بیشترین اثر منفی بر میزان جذب باکتری در غلظت هشت میکرولیتر بر لیتر بوده است. نکته جالب توجه این است که غلظت 25/0 میکرولیتر بر لیتر سبب افزایش معنی­داری در مقایسه با شاهد، در میزان جذب شده، در نهایت نتایج حاصله نشان دادند که MIC نانوذرات نقره در مورد این باکتری 5/0 میکرولیتر بر لیتر است.

تعیین MBC نانوذرات نقره بر UTPF5 - همزمان با روند افزایش غلظت نانوذرات نقره، افزایش معنی­داری نیز در میزان درصد بازدارندگی از تشکیل کلنی این جدایه مشاهده شد. کمترین غلظت که سبب کاهش در تعداد کلنیهای باکتریایی شد سه میکرولیتر بر لیتر بود، بیشترین اثر این غلظت در بازدارندگی از تشکیل کلنی در باکتری  UTPF5، 63/70 درصد بود. نتایج نشان دادند که از رشد این جدایه در غلظتهای مختلف اعمال شده 100 درصد جلوگیری شد.

اثر غلظتهای مختلف نانوذرات نقره بر تشکیل بیوفیلم در جدایه UTPF5- غلظت هشت میکرولیتر بر لیتر بیشترین تأثیر را در جلوگیری از تشکیل بیوفیلم در این جدایه باکتریایی داشت اما نمی­توان ادعا کرد که افزایش غلظت، سبب ایجاد روند افزایشی یا کاهشی مشخص و منظمی در تشکیل بیوفیلم شده است. افزایش غلظت نانوذرات نقره بر جدایه­های مختلف تأثیرات متفاوت و معنی­داری بر تشکیل بیوفیلم داشته است. در مورد باکتری UTPF5 روند افزایش در غلظت نانوذرات از 25/0 تا 2 میکرولیتر بر لیتر سبب افزایش تشکیل بیوفیلم و از این غلظت به بعد روند کاهش در تشکیل بیوفیلم مشاهده شده است. در یک دید کلی غلظت دو میکرولیتر بر لیتر سبب افزایش تشکیل بیوفیلم در جدایه UTPF5 شده است.

اثر غلظتهای مختلف نانوذرات نقره در تولید آنزیم لیپاز توسط جدایه باکتری UTPF5- در جدول تجزیه واریانس اثر متقابل باکتری و غلظتهای مختلف نانوذرات نقره، در سطح 01/0 درصد معنی­دار شده است. با افزایش غلظت نانوذرات نقره روند افزایشی در بازدارندگی از تولید آنزیم لیپاز مشاهده شده است که در تمامی موارد اختلاف معنی­داری با شاهد وجود دارد. بیشترین اثر بازدارندگی غلظت هشت میکرولیتر بر لیتر بوده و میزان درصد بازدارندگی در بیشترین حالت در UTPF5، 43/97 درصد بوده است. کمترین اثر منفی نانوذرات در جدایه باکتری در غلظت 5/0 میکرولیتر بر لیتر بوده است.

تأثیر غلظتهای مختلف عصاره باکتری بر تولید لاکاز و وزن خشک توده میسلیوم R. solani AG4- افزودن عصاره باکتری به محیط کشت جدایه قارچی، بر تولید آنزیم لاکاز توسط آنها تأثیر داشت و میزان تولید آنزیم در سه غلظت منتخب عصاره باکتری تفاوت معنی­داری در سطح احتمال 01/0 درصد نشان داد. همچنین در میزان تولید آنزیم توسط جدایه قارچی نیز تفاوت معنی­داری دیده شد. غلظت 15 درصد عصاره باکتری در جدایه AG4 باعث تحریک تولید آنزیم بمیزان قابل قبولی شد. بدین منظور برای آزمایشات تأثیر متقابل اثر عوامل غیر زنده بر تولید آنزیم لاکاز در حضور عصاره باکتری از غلظت 15% و جدایه AG4 استفاده شد.

تأثیر شرایط محیطی در القای لاکاز توسط قارچ در مجاورت با عصاره باکتری یا کشت همزمان با باکتری: اثر pH- در بررسی اثر  pHدر القای آنزیم لاکاز در جدایه AG4 در کشت همزمان با باکتری UTPF5، بیشترین میزان تولید آنزیم لاکاز در 5/7 =pH اتفاق افتاد. نتایج تأثیر pH در کشت قارچ در مجاورت با عصاره آنتاگونیست، افزایش قابل توجهی در القای لاکاز در اکثر موارد نشان داد. فقط در pH، 7 و 5/7 در حضور عصاره باکتری میزان تولید آنزیم کاهش چشمگیری داشته و دارای اختلاف معنی­دار با بقیه موارد بود.

اثر دما: دمای 30 درجه سانتی گراد کمترین تأثیر را در تولید آنزیم لاکاز توسط قارچ در کنار باکتری داشت. وزن خشک قارچ در دمای 15 درجه سانتی گراد و در حضور باکتری بیشترین بود که در مقایسه با شاهد اختلاف معنی­دار نبود. در محیط کشت حاوی عصاره باکتری در دماهای 25 و 30 و 37 درجه سانتی گراد، عصاره میزان فعالیت آنزیم لاکاز را نسبت به شاهد افزایش دادند.

تأثیر عصاره کشت و سوسپانسیون باکتری در تفریخ تخم نماتد: در تیمارهای عصاره باکتری بعد از 24 ساعت هیچ کدام از تخمها تفریخ نشدند. در حالی­که در شاهد بین 20-8 درصد و در سوسپانسیون بین 13-8 درصد تخمها بعد از 24 ساعت تفریخ شدند. بین تیمار سوسپانسیون باکتری و شاهد بعد از 24 ساعت  اختلاف معنی­داری وجود ندارد ولی بعد از 48 ساعت این دو نیز با هم اختلاف معنی­دار داشته و کاهش درصد تفریخ تخم در تیمار عصاره کشت نسبت به شاهد در 24 و 48 ساعت 10 و 35 درصد برآورد شد و سوسپانسیون باکتری نیز بعد از 48 ساعت کاهش 25 درصدی نسبت به شاهد نشان داد.

تأثیر ترکیبات فرار باکتری در تفریخ تخم نماتد: بعد از 72 ساعت تخمهای نماتد که در معرض ترکیبات فرار قرار گرفتند هیچکدام تفریخ نشدند در حالی­که در شاهد 80 درصد تخمها تبدیل به لارو شدند.

تأثیر عصاره کشت و سوسپانسیون باکتری روی مرگ و میر لاروهای سن دوم: از میان غلظتهای مختلف به کار برده شده از عصاره کشت باکتری، درصدهای 50 و 75 و 100 بدون اختلاف معنی­دار با هم بوده ولی عصاره 100 درصد با عصاره 25 درصد دارای اختلاف است و هر چهار غلظت با سوسپانسیون باکتری و شاهد دارای اختلاف معنی­دار هستند. غلظتهای مختلف عصاره کشت باکتری بمقدار 53-34 درصد باعث افزایش مرگ و میر لاروها در شرایط آزمایشگاه نسبت به شاهد شدند. بعد از 48 ساعت تمام لاروهایی که با عصاره کشت تیمار شده بودند مردند. همچنین لاروهایی که با غلظتهای مختلف عصاره تیمار شده بودند بعد از مرگ دچار تغییر شکل شده و بحالت دوکی شکل درآمدند.

تأثیر ترکیبات فرار باکتری در مرگ و میر لارو نماتد: ترکیبات فرار باکتری باعث افزایش 85 درصدی مرگ و میر لارو نماتد نسبت به شاهد شده و اختلاف معنی داری در سطح پنج درصد نشان دادند

بررسی تحرک و جلب لاروهای سن دو با عصاره و سوسپانسیون باکتری: سه غلظت 50، 75 و 100 با هم اختلاف نداشتند و باعث حرکت منفی نماتد بسمت حاشیه پتری شدند. در حالی­که در شاهد و سوسپانسیون حرکت منفی دیده نشد و لاروهای درون پتری بسمت مرکز پتری حرکت کرده و حرکات مارپیچی و بسیار زیادی را در روی محیط کشت بجا گذاشتند. در تیمارهای عصاره باکتری با غلظت 50، 75 و 100، لاروها علاوه بر حرکت منفی بسمت حاشیه پتری، دچار کاهش تحرک شده و حرکات بسیار ریز و کندی در روی محیط کشت از خود باقی گذاشتند. همچنین تعداد زیادی از لاروها در غلظت 100 از عصاره باکتری بعد از اندکی حرکت منفی مرده بودند.

بررسی مقدار نفوذ لارو سن دو نماتد به ریشه­های گیاه گوجه فرنگی: این آزمایش به صورت تیمار بذر با باکتری و استفاده از سوسپانسیون باکتری در خاک انجام گرفت. هر دو این تیمارها به طور معنی­داری با شاهد اختلاف دارند، در حالی­که خود این دو تیمار با هم اختلاف معنی­دار ندارند. سوسپانسیون باکتری و تیمار بذر بترتیب باعث کاهش 62 و 55 درصدی نفوذ لارو به ریشه شدند.

کنترل نماتد M. javanica توسط باکتری P. fluorscens UTPF5 در شرایط گلخانه­ای، شاخصهای رشد: تیمارهای مختلف باکتری اثرات معنی­دار متفاوتی در ویژگیهای رشدی گیاه گوجه­فرنگی، در صورت حضور یا عدم حضور نماتد نشان دادند (جدول 3).

مقدار کلروفیل: در بررسی سنجش کلروفیل، مقدار کلروفیل a، کلروفیل b، کلروفیل کل و کاروتنویید اندازه­گیری شد و نتایج معنی­داری بین تیمارهای مختلف مشاهده شد (شکل 1).

شاخصهای بیماری، شاخص گال: تیمار بذر با باکتری و نماتد به طور معنی­داری از نظر شاخص گال با شاهد و کاربرد سوسپانسیون باکتری روی نشاء بهمراه نماتد اختلاف داشتند. ولی با کاربرد عصاره و سوسپانسیون باکتری در خاک با نماتد اختلاف نداشتند و هر سه این تیمارها کاهش شاخص گال نسبت به شاهد را نشان دادند. کمترین شاخص گال مربوط به ضدعفونی بذر با باکتری، سوسپانسیون و عصاره باکتری در خاک بود.

تعداد گال روی سیستم ریشه­ای: نتایج نشان داد تعداد گال در کل ریشه گیاه گوجه­فرنگی در تیمار بذر با باکتری نسبت به شاهد و دیگر تیمارها اختلاف معنی­دار داشته و کاهش 55 درصدی را باعث می­شود. دیگر تیمارها تفاوت معنی­داری نسبت به شاهد نشان ندادند ولی باعث کاهش مقدار گال روی ریشه شدند. بترتیب در تیمار بذر با باکتری، کاربرد عصاره باکتری، سوسپانسیون باکتری و کاربرد سوسپانسیون روی نشاء بیشترین کاهش در تعداد گال مشاهده شد.

 

 

جدول 3- شاخصهای رشدی گیاه گوجه­فرنگی تحت تأثیر باکتری P. fluorscens UTPF5 در کنترل نماتد  M. javanica

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

شکل 1- سنجش کلروفیل، مقدار کلروفیل a، کلروفیل b، کلروفیل کل و کاروتنویید در تیمارهای مختلف


تعداد تخم روی سیستم ریشه­ای: تیمارهای ضدعفونی بذر و استفاده از عصاره باکتری اختلاف معنی­داری در کاهش تعداد کل تخم نماتد در روی سیستم ریشه­ای نسبت به شاهد داشتند. استفاده از سوسپانسیون باکتری چه در خاک و چه روی نشاء باعث کاهش تعداد تخم نماتد بمقدار قابل توجهی شد ولی با شاهد که نماتد بتنهایی بود اختلاف معنی­داری نشان نداد. ضدعفونی بذر و عصاره بترتیب کاهش 71 و 42 درصدی در تعداد تخم نسبت به شاهد نشان دادند.

واکنش زنجیره­ای پلیمراز (PCR)؛ ردیابی ژن phlD  به وسیله PCR : با استفاده از تکنیک PCR و دو آغازگر  phl2aو phl2b قطعه­ای ازDNA  بطول 745 جفت باز تکثیر شد. جدایه  UTPF5دارای ژن phlD  بود که با سویهCHA0  که واجد این ژن بود مقایسه شد. جهت تخمین اندازه فرآورده­های تکثیرشده در PCR، از نشانگر ژنومی یک کیلو جفت بازی (gene ruler 1kbp DNA ladder) استفاده شد.

ردیابی ژن  phlA  به وسیله PCR: با استفاده از تکنیک PCR و دو آغازگر  phlA-1rو   phlA-1fقطعه­ای از DNA بطول 418 جفت باز تکثیر شد. جدایه UTPF5 دارای ژن phlA  بود که با سویهCHA0  که واجد این ژن بود، مقایسه شد. جهت تخمین اندازه فرآورده­های تکثیر شده در PCR، از نشانگر ژنومی 100 جفت بازی (gene ruler 100bp DNA ladder) استفاده شد.

ردیابی ژن  hcnABتوسط واکنش زنجیره ای پلی مراز(PCR): قطعه DNA با طول تقریبی 570 جفت باز از دسته ژنی مسئول سنتز سیانید هیدردژن (hcnABC) ، با استفاده از تکنیکPCR و توسط دو آغازگر PM2  وPM7-26R  تکثیر شد. این قطعه DNA شامل 136 جفت باز از ژن  hcnA ( که دارای 312 نوکلئوتید می باشد) و 434 جفت باز از ژن hcnB (که دارای 1404 نوکلئوتید است) می باشد (31). نتیجه این آزمایش نشان داد سویه UTPF5، واجد ژن  hcnABهست.

بررسی مولکولی سویه بر اساس 16S rRNA، تکثیر  DNA توسط PCR: نتایج حاصل از تکثیرDNA  ژنومی با استفاده از دو آغازگر PS16Sf و PS16Sr بر روی ژل آگاروز قابل رویت بود که تکثیر بخشی از ژنوم بطول تقریبی 1500 جفت باز را در سویه UTPF5 نشان داد.

تعیین توالی نمونه ها و آنالیز توالی­ها: در این پژوهش 16S rRNA در سویه UTPF5 تعیین توالی شد و با توالی CHA0 در بانک ژن مقایسه شد. طول توالی نوکلئوتیدی در این سویه حدود 1450 نوکلئوتید بود. سویه UTPF5 حدود 98 درصد با سویه CHA0 در توالی 16S rRNA شباهت داشتند.

بحث

اثر نانوذرات نقره بر باکتریها تا حد زیادی به غلظتهای مورد استفاده و نیز جنس دیواره باکتریایی وابسته است. در تحقیق انجام شده توسط (12)، محلول یونهای نقره فعالیت ضدباکتریایی قوی­تری بر روی باکتریهای گرم منفی نسبت به باکتریهای گرم مثبت از خود نشان داده­اند و این گونه بیان کردند که این مسئله ممکن است مربوط به نازک­تر بودن لایه پپتیدوگلیکان باشد. به طوری که در این تحقیق نیز مشاهده شد با بررسی گروههای آماری چهار جدایه و مقایسه روند کاهش جمعیت، کمترین اثر منفی نانوذرات در بین جدایه­ها روی باکتری گرم مثبت باسیلوس و بیشترین آن در مورد سه جدایه گرم منفی دیگر اعمال شده است. نکته جالب توجه این است که جمعیت باکتریها در سه جدایه UTPf5 و UTPf68 و Bacillus subtilis در غلظت 25/0 میکرولیتر بر لیتر در مقایسه با نمونه شاهد افزایش یافته است.

نانوذرات نقره دارای سمیت زیادی در غلظتهای پایین بر روی باکتریهای گرم مثبت و گرم منفی هستند در استفاده از این مواد حساسیت و دقت بیشتری به کار رود که البته با توجه به نتایج حاصل از مرحله گلخانه در کنترل پاتوژن توسط نانوذرات نقره و عدم کنترل این قارچ با وجود استفاده از روشهای مختلف، این احتمال را می­توان در نظر گرفت که همانند قارچ، این ترکیب روی باکتریهای مفید ریزوسفر نیز بی­تأثیر باشد. که البته نتایج حاصل از تحقیقات (26)، نشان داده است که حضور نانوذرات در خاک تأثیر معنی­داری بر CFU میکروارگانیسم­ها و همچنین بر کل فعالیت متابولیکی جمعیت موجود در خاک نداشته است.

به منظور تعیین MIC نانوذرات نقره در  جدایه باکتریایی UTPf5، UTPf68، B. subtilis و Xanthomonas campestris pv malvacearum، در شرایط آزمایشگاهی بیشترین اثر منفی بر میزان جذب باکتریها در غلظت هشت میکرولیتر بر لیتر بوده و کمترین و بیشترین اثر منفی در این غلظت بترتیب مربوط به جدایه­های B. subtilis و UTPf5 بود. در تعیین MBC نانوذرات نقره در این چهار جدایه در شرایط آزمایشگاهی، کمترین غلظت که سبب کاهش در کلنیهای باکتریایی شد سه میکرولیتر بر لیتر بود، که البته میزان تأثیر آن روی جدایه­های مختلف، متفاوت و بیشترین اثر این غلظت در بازدارندگی از تشکیل کلنی در باکتریهای X. campestris، B. subtilis، UTPf5 و UTPf68 بترتیب از راست به چپ با درصدهای 76/83، 05/78، 63/70 و 17/66 بود. غلظت هشت میکرو لیتر بر لیتر بیشترین تأثیر را در جلوگیری از تشکیل بیوفیلم در این چهار جدایه باکتری داشته است اما نمی­توان بیان کرد که افزایش غلظت، سبب ایجاد روند افزایشی یا کاهشی مشخص و منظمی در تشکیل بیوفیلم شده است. در بررسی اثر غلظت نانوذرات نقره در تولید آنزیم لیپاز در جدایه باکتری UTPf5 و UTPf68 در شرایط آزمایشگاه، بیشترین اثر بازدارندگی در هر دو جدایه مربوط به غلظت هشت میکرولیتر بر لیتر و بیشترین میزان درصد بازدارندگی بترتیب در مورد دو جدایه 43/97 و 100 درصد بوده است. غلظتهای مختلف نانوذرات نقره در تولید آنزیم لاکاز در سطح 01/0 درصد معنی­دار شده است که بیشترین بازدارندگی در تولید آنزیم در غلظت یک میکرولیتر بر لیتر اعمال شده است.

نتایج نشان داد که اثر باکتری­کشی نانوذرات نقره هم به غلظت این ذرات و هم به جمعیت اولیه باکتریها وابسته است. تولید انواع اکسیژن فعال و همچنین آسیب به دیواره سلول باکتریایی دو مکانیزم فعالیت ضد­باکتریایی نانوذرات نقره هستند.

یک روش احتمالی برای کاهش تولید لاکاز در R. solani در تقابل با سویه­های آنتاگونیست و در نتیجه احتمال موفقیت بیشتر بیوکنترل در برابر مقاومت قارچ، تغییر شرایط محیطی و استفاده از محدودکننده­های تولید آنزیم است (6). در کشت همزمان قارچ با هرکدام از دو سویه آنتاگونیست در روزهای 6 و 10 و 15 مقدار تولید آنزیم به طور معنی­داری نسبت به شاهد کاهش یافت. در کشت قارچ در مجاورت عصاره سویه­های آنتاگونیست نه تنها تولید آنزیم کاهش پیدا نکرد بلکه میزان تولید آن در روز سوم به طور معنی­داری بیش از شاهد شد. پس حضور سلولهای باکتری در روزهای 6 و 10 و 15 تولید آنزیم را کاهش داده و بنظر می­رسد حضور سلول باکتری در کشتهای قارچ کلا تولید آنزیم را کاهش داده و می­تواند مانعی برای بروز مقاومت در قارچ نسبت به این دو سویه باشد.

در این تحقیق نشان داده شد که تیمار بذر با باکتری سودوموناس فلورسنت سویه UTPF5 باعث تغییر ترشحات ریشه گیاه گوجه­فرنگی و دفع لاروها از این ریشه­ها و جذب بسمت ریشه­های بدون باکتری و شاهد شدند و ریشه­های تیمار شده با باکتری قطورتر شدند. همچنین عصاره کشت باکتری باعث کاهش قدرت حرکت نماتد در محیط و دور شدن آن از محیط غذایی و ریشه می­شود. در مورد تأثیر ریزوباکتریها در الگوی حرکت نماتدها تحقیقات محدودی انجام گرفته است؛ جهت­گیری Caenorhabditis elegans بسمت سویه غیرسمی CHA19 سودوموناس فلورسنت بخوبی جهت­گیری سویه CHA0 بود (18).

سویه UTPF5 تولید سیدروفور و آنتی­بیوتیک کرده و باعث افزایش رشد گیاه گوجه­فرنگی می­شود. خیلی از گونه­های سودوموناس باعث افزایش رشد گیاه شده (PGPR) و تولید سیدروفورهای کلاته­کننده آهن، آنتی­بیوتیکها یا سیانید هیدروژن می­کنند و این ترکیبات در کاهش میکروارگانیسم­های پاتوژن و مضر کاربرد دارند و یک محیط مناسب برای رشد ریشه را فراهم می­کنند (17).

سوسپانسیون و عصاره باکتری از تفریخ تخم نماتد جلوگیری کرده و درصد مرگ و میر لارو سن دوم را نیز افزایش داد. ولی مقدار جلوگیری از تفریخ تخم در عصاره باکتری 35 درصد و افزایش مرگ و میر لارو در آن 53-34 درصد اندازه­گیری شد. تأثیر بی­نظیر عصاره کشت باکتری بر روی لاروها می­تواند بر اثر متابولیت آنتی میکروبی DAPG باشد. متابولیت آنتی میکروبی 2 و 4 دی استیل فلوروگلوسینول و پیولوتئورین به توانایی سودوموناس فلورسنت سویه CHA0 برای کنترل بیماری های گیاهان که توسط پاتوژن های خاکزاد کمک می کند.

بر اساس تحقیقات پیکی­تار (21) نشان داده شد که باکتری P. fluorescens CHA0 فعالیت ضد­حشره­ای داشته و توکسین حشره­کشی به نام fit برای فعالیت حشره­کشی این باکتری یافت شد. در نتیجه وجود این توکسین باعث تغییر شکل لاروهای حشرات و ملانیزه شدن آن­ها شد. که این نتیجه را می­توان با دوکی شدن لاروهای سن دو نماتد M. javanica که در معرض عصارۀ باکتری در این تحقیق قرار گرفتند مقایسه کرد. در این تحقیق لاروها بعد از تیمار با عصاره باکتری تغییر شکل داده و دوکی شکل شدند، که علت این حالت می­تواند توکسین fit باشد. در حالی­که زمانی که سیدروفور خالص به کار رفت لاروها مردند ولی تغییر شکل در آن­ها مشاهده نشد.

بر اساس نتایج گلخانه­ای نیز عصاره کشت باکتری سودوموناس فلورسنت UTPF5 نقش بسیار مهمی در کاهش تعداد گال در سیستم ریشه­ای داشته و مقدار گال را پایین آورده و علاوه بر آن با افزایش وزن تر و خشک و طول ریشه باعث مقاومت گیاه نیز شد. همچنین عصاره کشت باکتری تعداد تخم نماتد M. javanica بر روی کل سیستم ریشه­ای گیاه را بمقدار 42 درصد کاهش داد. همچنین نتایج نشان داد کاربرد باکتری به صورت پوشش دهنده بذر باعث کمترین تعداد گال روی ریشه و کاهش 55 درصدی نسبت به شاهد و کمترین تعداد تخم نماتد بر روی سیستم کل ریشه و کاهش 71 درصدی نسبت به شاهد شد و پایین­ترین مقدار شاخص گال را دربرگرفت. بعد از این دو تیمار، کاربرد سوسپانسیون باکتری به صورت پاشش روی خاک سهم بسزایی در کاهش شاخصهای بیماری داشت. در این تحقیق آزمایش­های گلخانه­ای نشان داد دو تیمار بذر و پاشش سوسپانسیون در خاک بترتیب کاهش 55 و 62 درصدی نفوذ به ریشه گوجه­فرنگی شد. که این نتایج می­تواند بدلیل افزایش رشد گیاه و مقاومت آن، همچنین کاهش جلب نماتدها بسمت ریشه و حتی دور شدن آن­ها بدلیل تغییر عصاره ریشه و کاهش تحرک لاروها ایجاد شده باشد.

سویه UTPF5 باکتری سودوموناس فلورسنت در تیمار پاشش سوسپانسیون روی خاک تأثیر زیادی در شاخصهای رشدی گیاه داشت. در حالی­که تیمارهای بذر و عصاره شاخصهای بیماری را بشدت کاهش دادند. در نتیجه فرموله کردن این باکتری در کنترل نماتد گره ریشه گوجه­فرنگی بسیار مناسب است.

نانوذرات نقره دارای سمیت زیادی در غلظتهای پایین بر روی باکتریهای گرم مثبت و گرم منفی هستند در استفاده از این مواد حساسیت و دقت بیشتری به کار رود که البته با توجه به نتایج حاصل از مرحله گلخانه در کنترل پاتوژن توسط نانوذرات نقره و عدم کنترل این قارچ با وجود استفاده از روشهای مختلف، این احتمال را می­توان در نظر گرفت که همانند قارچ، این ترکیب روی باکتریهای مفید ریزوسفر نیز بی­تأثیر باشد. البته نتایج حاصل از تحقیقات شاه و همکاران (26)، نشان داده است که حضور نانوذرات در خاک تأثیر معنی­داری بر CFU میکروارگانیسم­ها و همچنین بر کل فعالیت متابولیکی جمعیت موجود در خاک نداشته است.

به منظور تعیین MIC نانوذرات نقره در  جدایه باکتریایی UTPf5، UTPf68، B. subtilis و X. campestris pv malvacearum، در شرایط آزمایشگاهی بیشترین اثر منفی بر میزان جذب باکتریها در غلظت هشت میکرولیتر بر لیتر بوده و کمترین و بیشترین اثر منفی در این غلظت بترتیب مربوط به جدایه­های B. subtilis و UTPf5 بود. در تعیین MBC نانوذرات نقره در این چهار جدایه در شرایط آزمایشگاهی، کمترین غلظت که سبب کاهش در کلنیهای باکتریایی شد سه میکرولیتر بر لیتر بود، که البته میزان تأثیر آن روی جدایه­های مختلف، متفاوت و بیشترین اثر این غلظت در بازدارندگی از تشکیل کلنی در باکتریهای X. campestris، B. subtilis، UTPf5 و UTPf68 بترتیب از راست به چپ با درصدهای 76/83، 05/78، 63/70 و 17/66 بود. غلظت هشت میکرو لیتر بر لیتر بیشترین تأثیر را در جلوگیری از تشکیل بیوفیلم در این چهار جدایه باکتری داشته است اما نمی­توان بیان کرد که افزایش غلظت، سبب ایجاد روند افزایشی یا کاهشی مشخص و منظمی در تشکیل بیوفیلم شده است. در بررسی اثر غلظت نانوذرات نقره در تولید آنزیم لیپاز در جدایه باکتری UTPf5 و UTPf68 در شرایط آزمایشگاه، بیشترین اثر بازدارندگی در هر دو جدایه مربوط به غلظت هشت میکرولیتر بر لیتر و بیشترین میزان درصد بازدارندگی بترتیب در مورد دو جدایه 43/97 و 100 درصد بوده است. غلظتهای مختلف نانوذرات نقره در تولید آنزیم لاکاز در سطح 01/0 درصد معنی­دار شده است که بیشترین بازدارندگی در تولید آنزیم در غلظت یک میکرولیتر بر لیتر اعمال شده است.

نتایج نشان داد که اثر باکتری­کشی نانوذرات نقره هم به غلظت این ذرات و هم به جمعیت اولیه باکتریها وابسته است. تولید انواع اکسیژن فعال و همچنین آسیب به دیواره سلول باکتریایی دو مکانیزم فعالیت ضد­باکتریایی نانوذرات نقره هستند.

بطور کلی این سویه P. fluorescens UTPF5 اثرات بیوکنترلی بسیار خوبی نشان داد و ویژگیهای مولکولی آن نیز از طریق ردیابی ژنهای مهم مورد بررسی قرار گرفت.

1-       Alcals L. A. 2007. Characterization and efficacy of bacterial strains for biological control of soil borne diseases caused by Phytophthora  cactorum  and  Meloidogyne  javanica on rosaceous plants. Doctoral thesis. Universitate de Girona, 152.

2-       Arnon, D. 1994. Copper enzymes in isolated chloroplasts: Polyphenoloxidase in Beta vulgaris. Plant Physiology 24: 1-10.

3-       Bagheri, N., Ahmadzadeh, M and Heydari, R. 2014. Effects of Pseudomonas fluorescens strain UTPF5 on the mobility, mortality and hatching of root-knot nematode Meloidogyne javanica. Archives of Phytopathology and Plant Protection. 47(6): 744 – 752.

4-       Bollag, J and Leonowicz, A. 1984. Comparative studies of exteracellular fungal laccase. Applied and Environmental Microbiology, 48: 849-854.

5-       Bora, P. 2003. Production of laccase by phytophatogenic fungus Rhizoctonia solani. 165.

6-       Crow, J.D and Olsson, S. 2001. Induction of laccase activity in Rhizoctonia solani by antagonistic Pseudomonas fluorescens strains and a range of chemical treatments. Applied and Environmental Microbiology, 67: 2088-2094.

7-       Fernando, W. G. D., Ramarathnama, R., Krishnamoorthyb, A. S and Savchuka, S. C. 2005. Identification and use of potential bacterial organic antifungal volatiles in biocontrol. Soil Biology and Biochemistry 37: 955–964.

8-       Frapolli, M., Defago, G and Moenne – Loccoz, M. 2007. Multilocus sequence analysis of biocontrol fluorescent Pseudomonas spp. producing the antifungal compound 2, 4- diacetylphloroglucinol. Environment Microbiology. 9: 1939 – 1955.

9-       Fravel, D.R. 2005. Commercialization and implementation of biocontrol Annual Review of Phytopathology, 43: 337-359.

10-   Hussey, R.S and Jansen, G.J.W. 2002. Root-knot nematodes: Meloidogyne species. 43-70. in: Starr, J.L., Cook, R and Bridge, J. (Eds.). Plant resistance to parasitic nematodes. CAB International, Wallingford.

11-   Hussey, R. S and Barker, K. R. 1973. A comparison of methods of collecting inocula of Meloidogyne spp., including a new technique. Plant Disease Report. 57: 1025-1028.

12-   Jung, W.K., Koo, H.C., Kim, K.W., Shin, S., Kim, S.H and Park, Y.H. 2008. Antibacterial activity and mechanism of action of the silver ion in staphylococcus aureus and Escherichia coli. Applied and Environment Microbiology. 74: 2171-2178.

13-   Liu, H., Pan, X., Zhang, X and J. Wang. 1995. Experiments on Bacillus strain producing antagonistic protein. Chines Journal of Biology. 11:160-164.

14-   Loper, J.E and Lindow, S.E. 1997. Reporter gene systems useful in evaluating in situ gene expression by soil and plant associated bacteria in: Manual of environmental microbiology. Hurst, C.J., Knudsen, G.R., Mc Inervy, M.J., Stetzenbach, L.D and Walter, M.V. (eds). ASM press, Washington DC. 482-492.

15-   Lutz, M.P., Wenger, S., Maurhofer, M., Defago, G and Duffy, B. 2004. Signaling between bacterial and fungal biocontrol agents in a strain mixture. FEMS Microbiology Ecology. 48: 447-455.

16-   Maurhofer, M., Bachler, E., Notz, R., Marthez, V and Keel, C. 2004. Cross talk between 2, 4-diacetylphloroglucinol-producing biocontrol pseudomonads on wheat rhizosphere. Applied Microbiology Ecology. 70: 1990-1998.

17-   Nasima, I. A., Siddiqui, I. A., Shaukat, S. S and Zaki, M. J. 2002. Nematicidal activity of some strains of Pseudomonas spp. Soil Biology and Biochemistry 34: 1051-1058.

18-   Neidig, N., Rüdiger J. P., Scheu, S and Jousset, A. 2011. Secondary metabolites of Pseudomonas fluorescens CHA0 drive complexnon-trophicinteractions with bacterivorous nematodes. Microbecology 61: 853–859.

19-   Notz, R. 2002. Biotic factors affecting 2, 4–diacetylphloroglucinol biosynthesis in the model strain Pseudomonas fluorescens CHA0. Ph.D thesis. Swiss Federal Instiute of Technology, Zurich.

20-   Notz, R., Maurhofer, M., schnider keel, U., Duffy, B., Haas, D and Defago, G. 2001. Biotic factors affecting expression of the 2, 4 diacetylphloroglucinol biosynthesis gene phlA in Pseudomonas flourescens biocontrol strain CHA0 in the rhizosphere. Phytopathology. 91: 873-881.

21-   Péchy-Tarr, M., Bruck, D. J., Maurhofer, M., Fischer, E., Vogne, Ch., Henkels, M. D., Donahue, K. M., Grunder, J., Loper, J. E and Keel, Ch. 2008. Molecular analysis of a novel gene cluster encoding an insect toxin in plant-associated strains of Pseudomonas fluorescens. Environmental Microbiology 10(9): 2368–2386.

22-   Raaijmakers, J. M., Weller, D.M and Thomashow, L. S. 1997. Frequency of antibiotic – producing Pseudomonas sp. In natural environments. Applied Environment Microbiology. 63: 881 – 887.

23-   Rezzonico, F., Moënne-Loccoz, Y and Defago, G. 2003. Effect of stress on the ability of a phlA -based quantitative competitive PCR assay to monitor biocontrol strain Pseudomonas fluorescens CHA0. Applied Environment Microbiology. 69: 686-690.

24-   Riga, E and Webster, J.M. 1992. Use of sex pheromones in the taxonomic differentiation of bursaphelenchus spp. (Nematoda), pathogens of pine trees. Nematologica. 38: 133-145.

25-   Savoie, J.M., Mata, G and Mamoun, M. 2001.variability in brown line formation and extracellular laccase production during interaction between white rot basidiomycetes and Trichoderma harzianum biotype Th2. Mycologia. 93: 243-248.

26-   Shah, V and Belozerova, I. 2008. Influence of metal nanoparticles on the soil microbial community and germination of Lettuce seeds. Water Air Soil Pollut.

27-   Shahrokh, S and Emtiazi, G. 2009. Toxicity and unusual biological behavior of nanosilver on gram positive and negative bacteria assayed by Microtiter-plate. European Journal of biology Science. 1: 28-31.

28-   Siddiqui, I. A and Shaukat, S. S. 2003. Suppression of root-knot disease by Pseudomonas fluorescens CHA0 in tomato: importance of bacterial secondary metabolite, 2, 4-diacetylpholoroglucinol. Soil Biology and Biochemistry 35: 1615–1623.   

29-   Siddiqui, I. A and Shaukat, S. S. 2004. Systemic resistance in tomato induced by biocontrol bacteria against the root-knot nematode Meloidogyne javanica is independent of salicylic acid production. Journal of phytopathology. 152: 48-54.

30-   Siddiqui, I. A., Zaki, A., Qureshi, A and Akhtar, M. S. 2009. Biocontrol of root-knot nematode Meloidogyne incognita by Pseudomonas and Bacillus isolates on Pisum sativum. Archives of Phytopathology and Plantprotection 42(12): 1154 -1164.

31-   Svercel, M., Duffy, B and Defago, G. 2007. PCR amplification of hydrogen cyanide biosynthetic locus hcnAB in Pseudomonas spp. Journal Methods. 70: 209- 213.

32-   Wahleithner, J.A., Xu, F., Brown, K.M., Brown, S.H., Golightly, E.J., Halkier, T., Kauppinen, S., Pederson, A and Schneider, P. 1996. The identification and characterization of for laccase from the plant pathogenic fungus Rhizoctonia solani. Curr Genet. 29: 395-403.

33-   Wang, C., Ramette, A., Pungasamarwong, P., Natsch, A., Moenne Loccoz, Y and De'fago, G. 2001. Cosmopolitan distribution of phlD – containing dicotyledonous crop-associated biocontrol pseudomonads of worldwide origin. FEMS Microbiology Ecology. 37: 105-116.

34-   Zhang, H., Hong, Y.Z., Xiao, Y.Z., Yuan, J., Tu, X.M and Zhang, X.Q. 2006. Efficient production of laccase by trametes sp. AH28-2 in cocultivation with a trichoderma strain, Applied Microbiology Biotechnology. 73: 89-94.