نوع مقاله: مقاله پژوهشی

نویسندگان

1 گروه زیست شناسی دانشکده علوم، دانشگاه ارومیه، ارومیه، ایران

2 Km 17, Tehran-Karaj Highway, Pajoohesh Blv. National Institute of Genetic Engineering and Biotechnology, Tehran, Iran

3 گروه زیست فناوری دامی، پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری، تهران، ایران

چکیده

امروزه جهت افزایش میزان لانه‌گزینی و حاملگی پس از انتقال رویان-های حاصل از لقاح آزمایشگاهی ، از تکنیک‌های مختلف هچینگ کمکی از جمله سوراخ کردن مصنوعی بلاستوسیست استفاده می‌شود. در این مطالعه با سوراخ کردن مصنوعی بلاستوسیست با استفاده از ریز سوزن‌های تزریق کننده، کیفیت بلاستوسیست‌های موش با بررسی نرخ زنده‌مانی، خروج بلاستوسیست از زونا و میزان بیان ژن Wnt3a مورد ارزیابی قرار گرفت. بلاستوسیست‌ها در دو گروه درون‌تنی و برون‌تنی مورد مطالعه قرار گرفتند. در هر گروه تعدادی از بلاستوسیست‌ها‌‌ با استفاده از ریز سوزن‌های تزریق‌کننده به روش مکانیکی سوراخ شدند و تعدادی دیگر بدون هیچ تیماری به عنوان گروه کنترل در نظر گرفته شدند. نرخ زنده‌مانی و قابلیت خروج بلاستوسیست‌ها از زونا و همچنین میزان بیان ژن Wnt3a توسط تکنیک واکنش زنجیره‌ای پلیمراز در زمان واقعی در هر گروه ارزیابی گردید. بر اساس نتایج بدست آمده در بلاستوسیست‌های درون‌تنی و برون‌تنی گروه تیمار در مقایسه با کنترل میزان زنده‌مانی کاهش نیافت در مقابل میزان خروج بلاستوسیست از زونا افزایش معنی‌داری نشان داد. در گروه بلاستوسیست‌های درون‌تنی میزان بیان ژن Wnt3a افزایش معنی‌دار و در گروه بلاستوسیست‌های برون‌تنی کاهش معنی‌دار یافت. سوراخ کردن مصنوعی بلاستوسیست می‌تواند یک روش مطمئن در هچینگ کمکی بکار رود.

کلیدواژه‌ها

عنوان مقاله [English]

Effect of artificial collapse of mouse blastocyst on viability and Wnt3a gene expression

چکیده [English]

In recent years, using the assisted hatching techniques such as puncture of blastocyst, are used in in-vitro fertilization (IVF) for increase the rate of implantation. This study was designed in order to evaluate of AC effect in survival and hatching rate of mouse blastocysts by expression of Wnt3a gene. In vivo and In vitro blastocysts are obtained. Some of them in in-vivo and In vitro groups were collapsed with a micro-needle and non-collapsed blastocysts in each group were used as a control. Evaluated survival and hatching rate and quantitative expression of Wnt3a gene in both groups was investigated by using Real time PCR. Our results revealed that AC of blastocyst in in-vivo and In vitro blastocysts did not improve survival rate although hatching rate had a significant difference in the collapsed blastocysts compared to non-collapsed blastocysts in both groups. The results real time PCR quantitative analysis showed that expression level of Wnt3a gene has increased in in-vivo blastocysts and it has decreased in in-vitro blastocysts comparing to control group in both treatment. AC could be effective way to improve the assisted hatching techniques.

کلیدواژه‌ها [English]

  • “Assisted hatching”
  • “ Artificial collapse”
  • “Blastocyst”
  • “ Wnt3a gene”

بررسی تأثیر سوراخ کردن مصنوعی بلاستوسیست موش بر زنده­مانی و میزان بیان ژن Wnt3a

سمانه قریب1، مجتبی دشتی­زاد2*، فرح فرخی1، مهدی شمس­آرا2

1ارومیه، دانشگاه ارومیه، دانشکده علوم، گروه زیست شناسی

2 تهران، پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری، گروه زیست فناوری دامی 

تاریخ دریافت: 26/11/93              تاریخ پذیرش: 6/2/94 

چکیده

امروزه جهت افزایش میزان لانه­گزینی و حاملگی پس از انتقال رویانهای حاصل از لقاح آزمایشگاهی، از تکنیکهای مختلف هچینگ کمکی از جمله سوراخ کردن مصنوعی بلاستوسیست استفاده می­شود. در این مطالعه با سوراخ کردن مصنوعی بلاستوسیست با استفاده از ریز سوزنهای تزریق کننده، کیفیت بلاستوسیستهای موش با بررسی نرخ زنده­مانی، خروج بلاستوسیست از زونا و میزان بیان ژن Wnt3a مورد ارزیابی قرار گرفت. بلاستوسیستها در دو گروه درون­تنی و برون­تنی مورد مطالعه قرار گرفتند. در هر گروه  تعدادی از بلاستوسیستها با استفاده از ریز سوزنهای تزریق­کننده به روش مکانیکی سوراخ شدند و تعدادی دیگر بدون هیچ تیماری به عنوان گروه کنترل در نظر گرفته شدند. نرخ زنده­مانی و قابلیت خروج بلاستوسیستها از زونا و همچنین میزان بیان ژن Wnt3a توسط تکنیک واکنش زنجیره­ای پلیمراز در زمان واقعی در هر گروه ارزیابی گردید. بر اساس نتایج به دست آمده در بلاستوسیستهای درون­تنی و برون­تنی گروه تیمار در مقایسه با کنترل میزان زنده­مانی کاهش نیافت در مقابل میزان خروج بلاستوسیست از زونا افزایش معنی­داری نشان داد. در گروه بلاستوسیستهای درون­تنی میزان بیان ژن Wnt3a افزایش معنی­دار و در گروه بلاستوسیستهای برون­تنی کاهش معنی­دار یافت.

سوراخ کردن مصنوعی بلاستوسیست می­تواند یک روش مطمئن در هچینگ کمکی به کار رود.

واژه های کلیدی: هچینگ کمکی، سوراخ کردن مصنوعی، بلاستوسیت موش، ژن Wnt3a

* نویسنده مسئول، تلفن: 02144787323، پست الکترونیکی:dashtizad@nigeb.ac.ir

مقدمه

 

پیش شرط یک لانه­گزینی موفق، خروج رویان از زونا پلوسیدا یا همان لایه محاطی شفاف اطراف جنین می­باشد (30). در شرایط طبیعی اطراف تخمک با لایه­ای از مولکولهای قندی پروتئینی پوشیده شده است که پس از ورود اولین اسپرم به تخمک با تغییر در ساختار به گونه­ای عمل می­نماید که مانع ورود اسپرمهای بعدی و پلی­اسپرمی می­گردد (3 و 17). این لایه علاوه بر محافظت تخمک و رویان، مانع از جدا شدن سلولهای رویانی از یکدیگر شده و به عنوان یکی از عوامل مؤثر در هدایت رویان به سمت رحم ایفاء نقش می­نماید (3 و 25). زونا پلوسیدا در روز پنجم پس از لقاح، با رسیدن رویان در مرحله بلاستوسیست به حفره رحمی، به کمک آنزیمهای مترشحه از سلولهای تروفواکتودرمی رویان و دیواره رحم، نازک شده و با بالا رفتن فشار درونی رویان، از ناحیه­ای پاره می­شود تا امکان چسبیدن و نفوذ رویان به دیواره رحمی فراهم گردد. به این فرآیند پاره شدن  و خروج رویان از زوناپلوسیدا، هچینگ گفته می­شود، هر تغییری که بتواند در این خروج اختلال ایجاد نماید نرخ باروری را به طور جدی تحت تأثیر قرار خواهد داد (1 و 22).

در دهه­های اخیر، با توجه به افزایش میزان ناباروری در بین زوجین، نیاز به روشهای کمک باروری بیش از پیش احساس می­شود. از شایع ترین روشهای ART، می­توان به تولید رویان آزمایشگاهی اشاره نمود (11). در مواردی که لقاح و کشت جنین در شرایط برون تنی به وقوع می­پیوندد برخی استرسهای محیطی نظیر دما، pH و  مجاورت با محیطهای کشت می­توانند با تغییر در ساختار زونا موجب افزایش الاستیسیته (23) و کاهش در نرخ خروج و لانه­گزینی رویان و در نهایت باروری گردد    (9و10). کاهش ضخامت و یا ایجاد شکاف در لایه محاطی رویانهای برون­تنی، قبل از انتقال به رحم فرد گیرنده، می­تواند روند خروج رویان از زونا و لانه­گزینی را بهبود بخشد که این امر امروزه در آزمایشگاهها با استفاده از روشهای مکانیکی، شیمیایی (آنزیمی) و یا لیزر تحت عنوان هچینگ کمکی صورت می­پذیرد (2، 6 و 21).

با توجه به تهاجمی بودن این روش تنها موارد ضخامت زونای بالای 17 میکرومتر، رویانهای کمتر از 5 سلول در روز سوم و فراگمنتیشن بالای 20 درصد، کاندیدای مناسبی برای انجام هچینگ کمکی می­باشند. همچنین به بیماران بالای 38 سال و دارای سابقه چندین شکست در انتقال رویان، استفاده از این روش توصیه می­شود (8 و 22).

امروزه پروتکل رایج در بسیاری از آزمایشگاهها انتقال دو تا سه رویان 4 تا 8 سلولی به ازاء هر دوره درمانی می­باشد. دلیل این امر انتقال و برگشت سریع تر رویانهای برون­تنی به شرایط درون­تنی، آسان و ایمن­تر بودن روش هچینگ کمکی در این مرحله با توجه به وجود فاصله کافی بین بلاستومرها و زونا و نیز شانس بقای بالاتر رویانها بعد از انجماد می­باشد (4، 24 و 28). اما مطالعات نشان داده­اند بلاستوسیست به دلیل بالا بودن تعداد سلولها از قدرت ترمیم بیشتری برخوردار است. همچنین با توجه به افزایش در نسبت سطح به حجم سلولها، امکان تبادل مواد سرما محافظ با آب درون سلولی افزایش  می­یابد و پتانسیل رویان برای بقاء و مقاومت در برابر شوکهای دمایی بهبود می­یابد (14 و 15). بنابراین انتقال رویان در مرحله بلاستوسیست علاوه بر بالا بردن شانس حاملگی، خطر ابتلاء به سندرم تحریک بیش از حد تخمدان را نیز کاهش می­دهد (13) و از جمله درمانهای پیشنهاد شده در باب شکست مکرر در لانه­گزینی مطرح می­باشد. اما در بلاستوسیست به واسطه چسبیده بودن سلولهای لایه تروفواکتودرم به لایه زونا، هچینگ کمکی ریسک آسیب به سلولهای رویان را افزایش می­دهد. همچنین حفره بلاستوسل مملو از مایع درون بلاستوسیست با افزایش احتمال تشکیل کریستال یخ حین انجماد، باعث کاهش نرخ زنده­مانی، در رویانهای یخ­گشایی شده می­گردد. علاوه بر این، حضور حفره مملو از مایع می­تواند به عنوان یک سد، مانع از رسیدن مواد سرما محافظ به سلولهای درونی رویان گردد و باعث آسیب سلولهای درونی به واسطه مواجه با شوک سرمایی گردد (20)

تا کنون روشهای مختلفی برای کاهش حجم مایع درون حفره بلاستوسل معرفی شده­اند که از جمله آنها می­توان به ایجاد سوراخ در بلاستوسیست با استفاد از یک سوزن بسیار نازک شیشه­ای اشاره کرد، علاوه بر استفاده از ریز سوزن شیشه­ای، روشهای دیگری همچون استفاده از سوزن با درجه 29، پیپت شیشه­ای (8)، لیزر (19) و غلظت بالای ساکارز (11) نیز برای کاهش مایع حفره بلاستوسل مورد بررسی قرار گرفته است. با ایجاد سوراخ در بلاستوسیست با استفاد از یک سوزن بسیار نازک شیشه­ای می توان ضمن کاهش حجم مایع بلاستوسل، امکان دسترسی سلولهای درونی رویان را به مواد سرما محافظ در غلظتهای معمول تسهیل نمود و هم با تحریک سلولهای تروفواکتودرم باعث فعال شدن مسیر ترشح آنزیم لایزین گردد که خود می­تواند با تسهیل در خروج رویان از زونا به عنوان هچینگ کمکی عمل نماید (4، 10، 12 و 13).

مطالعات قبلی نشان داده­اند که کاهش حجم مایع بلاستوسل قبل از انجماد شیشه­ای می­تواند نرخ زنده مانی رویانهای ذوب شده را بهبود بخشد ولی این مایع در تغذیه، جا به جایی و جهت دهی بلاستومرها در حین تکامل و لایه­زایی، نقش دارد. در طی تکامل رویان، سلولهای ICM در بلاستوسیست توانایی تبدیل به هر سه لایه زاینده جنینی (اکتودرم، مزودرم و آندودرم) را دارا می­باشند. سلولهای ترفواکتودرم نیز که در معرض مستقیم فشار ناشی از پارگی بلاستوسیست می باشند نقش اساسی در لانه­گزینی رویان ایفاء می­نماید. بنابراین هر گونه تغییر در میزان بیان ژنهای تأثیرگذار در تکوین رویان می­تواند در کیفیت بلاستوسیست و در نهایت توان لانه­گزینی رویان تأثیرگذار باشد. از میان این ‍ژنها می­توان به ژنهای خانواده Wnt اشاره کرد که از مراحل اولیه رشد رویان بیان می­شوند و به ICM و سپس به اپی­بلاست و بعد از گاسترولاسیون به رده سلولی زاینده محدود می­گردند و نقش عمده­ای در رشد و تکامل جنین ایفاء می­نمایند. بنابراین، نقص در بیان آنها منجر به تولید بلاستوسیستهایی خواهد شد که ICM آنها قدرت تمایز به سایر سلولها را ندارد و حتی در صورت لانه­گزینی نیز در مراحل اولیه تکامل جنینی از بین می­روند (16).

با توجه به نقش  مایع بلاستوسل آیا خروج مایع و نیز آسیب و استرس اعمال شده به رویان در حین سوراخ کردن مصنوعی می­تواند با تأثیر بر بیان ژنهای دخیل در تکوین بلاستوسیست و پرتوانی توده سلولی داخلی برتوسعه و عملکرد جنین تأثیر گذار باشد؟ جهت پاسخ به این پرسش در این تحقیق کیفیت بلاستوسیستهای درون­تنی و برون­تنی موش را پس از سوراخ کردن مصنوعی از لحاظ مورفولوژیک با سنجش نرخ     زنده­مانی، بازگشت رویانها به شکل طبیعی و خروج از زونا و نیز از طریق روشهای مولکولی با بررسی میزان بیان ژن Wnt3a، ارزیابی گردید.

مواد و روشها

در این تحقیق از موشهای سوری، نژاد NMRI (موشهای ماده با سن 8-7 هفته و موشهای نر با سن 12-10 هفته) استفاده شد. حیوانات در شرایط 12 ساعت روشنایی و 12 ساعت تاریکی و دمای 23-18 درجه سانتی­گراد نگهداری شدند و محدودیتی از نظر دسترسی به آب و غذا نداشتند.

تولید بلاستوسیست برون­تنی:تحریک تخمک­گذاری: جهت تحریک تخمک­گذاری، در روز اول به میزان 8 واحد بین­المللی هورمونﮔﻨﺎدوﺗﺮوﭘﻴﻦ ﺳﺮم ﻣﺎدﻳﺎن آﺑﺴﺘﻦ ((Folligon®, A007A02, Intervet به صورت داخل صفاقی به موشهای ماده تزریق شد. پس از گذشت 48-46 ساعت، تزریق داخل صفاقی هورمون گنادوتروپین جفتی انسان (Pregnyl®, 111, Darou Pakhsh) جهت آزادسازی تخمکها، به میزان  IU8 صورت پذیرفت.

استحصال تخمک: حداقل چهار ساعت قبل از استحصال، جهت جمع­آوری و شست و شوی تخمکها محیط M2 به همراه سدیم پیرووات (P4562,Sigma) و آلبومین سرم گاوی (10106, GibcoBRL) در یک پتری دیش 15×60 میلی­متری (150288, Nunc, Denmark) گذاشته و سطح آنها با روغن معدنی استریل (M-5310, Sigma) پوشانده شد و پتری دیش در انکوباتور (Memmert, Germany) با درجه حرارت 37 درجه سانتی گراد، رطوبت 97 درصد و CO2 به میزان 5 درصد قرار گرفت. حدود 16-14 ساعت بعد از تزریق hCG، موش ماده نیز به روش جابه­جایی  مهره­های گردنی کشته شد و پس از نمایان شدن حفرۀ شکمی، اویداکتها با قیچی از رحم و تخمدانها جدا و به قطرۀ M2 منتقل شدند. در زیر استرئومیکروسکوپ (smz1000, Nikon, Japan) ناحیۀ آمپولای توسط یک سوزن پاره شد و توده­های تخمک-کومولوس آزاد گشتند. این توده­ها بعد از شستشو در قطره­های M2، درون انکوباتور با درجه حرارت 37 درجه سانتی گراد، رطوبت 97 درصد و CO2 به میزان 5 درصد نگهداری گردیدند.

استحصال اسپرم: جهت جداسازی و ظرفیت­پذیری اسپرم، از محیط TCM 199 حاوی 2/2 گرم بر میلی لیتر سدیم بی­کربنات، 25 میلی­مولار بافرهیپس (12340-030, GibcoBRL) به همراه 10 درصد آلبومین سرم گاوی استفاده گردید. حدود 15-13 ساعت بعد از تزریق hCG به موش ماده، موش نر به روش جا­به­جایی مهره­های گردنی کشته و به پشت خوابانده شد و با ایجاد برش در پوست و لایه صفاقی، حفره شکمی نمایان گردید. اسپرمها از دم اپیدیدیم استخراج و به مدت یک ساعت در محیط ظرفیت­پذیری اسپرم در درجه حرارت 37 درجه، رطوبت 97 درصد و CO2 به میزان 5 درصد قرار گرفتند.

لقاح آزمایشگاهی: برای انجام لقاح آزمایشگاهی از محیط HTF به همراه 33/5 میلی­مولار سدیم پیرووات و 30 میلی­گرم بر میلی ­لیتر آلبومین سرم گاوی و گلوتاتیون (071M1804V, Sigma) استفاده شد. در پتری دیش 10×35 میلی متری (153066, Nunc, Denmark) قطره­هایی با حجم تقریبی 50  ماکرولیتر از محیط HTF گذاشته و سطح آنها با روغن معدنی استریل پوشانده شد و حداقل چهار ساعت قبل از شروع لقاح در انکوباتور قرار گرفت.

در هر قطرۀ HTF، ده الی پانزده عدد COCs که از لحاظ ظاهری طبیعی بودند قرار داده شد و 3-4 ماکرولیتر اسپرم با غلظت یک میلیون در حجم یک میلی­لیتر به هر قطره اضافه گردید و به مدت چهار ساعت درون انکوباتور با درجه حرارت 37 درجه سانتی گراد، رطوبت 97 درصد و CO2 به میزان 5 درصد نگهداری گردیدند.

کشت رویان: جهت کشت رویان از محیط  KSOM(J.D, 1993) حاوی سدیم پیرووات، 5 میلی­گرم بر میلی­لیتر آلبومین سرم گاوی، 50 میلی­گرم بر میلی ­لیتر جنتامایسین Bio-West, L0011-010)) و 50 نانو­گرم بر میلی­لیتر فاکتور رشد اپیدرمی (E4127, Sigma) استفاده شد. چهار قطره با حجم تقریبی250 ماکرولیتر از محیط KSOM درون پتری دیش 60×15 میلی­متری گذاشته و سطح آنها با روغن معدنی استریل پوشانده شد. همچنین 400 ماکرولیتر از محیط KSOM در هر چاهک از پلیت چهار حفره­ای (176740, Nunc,Denmark) ریخته و سطح آن با همین حجم از روغن معدنی استریل پوشانده گردید. تخمکهای لقاح یافته پس از شست­وشو به دیش چهار­خانه­ی حاویKSOM  منتقل و به مدت 72 ساعت درون انکوباتور با درجه حرارت 37 درجه ورطوبت 95 درصد و  CO2به میزان 5 درصد قرار گرفتند.

استحصال بلاستوسیست درون­تنی: تزریق هورمونهای PMSG و hCG مشابه گروه قبل صورت گرفت. بلافاصله پس از تزریق هورمون hCG یک موش ماده با یک موش نر جهت جفت­گیری در یک قفس قرار گرفتند، صبح روز بعد، پلاک واژنی بررسی شد و موشهای پلاک مثبت به عنوان روز نیم بارداری به مدت سه روز جهت استحصال بلاستوسیست نگهداری شدند. موشهای سه و نیم روزه به روش جابه­جایی مهره­های گردنی کشته شدند. لوله­های رحمی موشها جدا و با تزریق محیط M2 به لوله­های رحمی، بلاستوسیستها جمع­آوری و در قطره­های مختلف M2 و KSOM شست­وشو داده شدند و به پلیت چهار خانه حاوی KSOM  منتقل شدند و در انکوباتور با دمای 37 درجه، CO2 5 درصد و رطوبت 97 درصد قرار گرفتند.

سوراخ کردن مصنوعی بلاستوسیست: برای سوراخ کردن بلاستوسیستهای درون­تنی و برون­تنی از میکروسکوپ معکوس Nikon eclipe Ti-U, Japan)) که مجهز به یک سیستم میکرومنیپولیتورNarishige, 10291, Japan) ) و صفحه گرم­کنندهNikon TI-SR, Japan) ) می­باشد، استفاده گردید. بلاستوسیستها درون قطره­های M2 با حجم 4 ماکرولیتر قرار گرفتند. سپس بلاستوسیستها در زیر میکروسکوپ و با استفاده از سوزنهای تزریق و نگهدارنده نصب شده بر روی دستگاه، به گونه­ای مهار گردید که سلولهای ICM در راستای حرکت ورود و خروج سوزن به درون رویان نباشند. سوزن تزریق به آرامی از بین سلولهای تروفواکتودرم وارد رویان گردید (تا نزدیکی سوزن نگهدارنده). بعد از چند ثانیه سوزن به آرامی در حالی که رویان همچنان توسط فشار منفی سوزن نگهدارنده ثابت مانده است، بیرون کشیده شد. این مراحل برای تمامی بلاستوسیستها بر روی صفحه گرم در دمای 37 درجه صورت پذیرفت. در این مطالعه تعداد 136 بلاستوسیست درون­تنی و 124 بلاستوسیست برون­تنی توسط سوزن دستگاه ریزدستکاری سوراخ گشتند و مایع بلاستوسل آنها خارج شد و سپس به محیط KSOM انتقال یافتند. حدود 3 و 12 ساعت بعد بلاستوسیستها از نظر کیفیت بررسی گشتند.

استخراج RNA تام از بلاستوسیت: برای استخراج RNA تام از بلاستوسیستها از کیت استخراج RNeasy Plus Micro Kit® (74034, Qiagen) استفاده شد و طبق پروتوکل نوشته شده در کیت، RNA استخراج گردید. میزان غلظت  RNAاستخراج شده با استفاده از دستگاه نانودراپ (Thermo Scientific, America) به روش اسپکتروفتومتری سنجیده شد. نسبت جذب280/A260A معیاری برای بررسی عدم وجود آلودگی پروتئین در نظر گرفته ­شد.

سنتز رشته اول DNA  مکمل: برای سنتز cDNA از کیت AccuPower RocketScript RT PreMix (Bioneer) استفاده گردید. واکنش مطابق با دستورالعمل موجود در کیت با استفاده از پرایمرهای تصادفی تهیه شد و واکنش سنتز cDNA در دستگاه ترموسایکلر  (Peqlab, Germany) در شرایط دمایی 15 درجه سانتی گراد برای 3 دقیقه، 50 درجه برای 60 دقیقه و 95 درجه برای مدت 5 دقیقه انجام گردید.

طراحی پرایمر: توالی پرایمرهای رفت و برگشت ژن  Wnt3و β2M توسط برنامه Oligo5 طراحی شد و اختصاصی بودن آن توسط Primer-BLAST مورد ارزیابی قرار گرفت

 

جدول 1). ژن  β2Mبه عنوان ژن کنترل داخلی (Housekeeping) در نظر گرفته­ شد.

 

جدول 1- توالی پرایمرهای رفت و برگشت ژنهای  Wnt3و β2M

ژن

پرایمر

توالی'3 به '5

طول توالی (bp)

(°C)  دمای اتصال

طول محصول (bp)

Wnt3 

رفت

GCTCTGCCATGAACCGTCACA

21

8/61

121

برگشت

GACCACCAGCAGGTCTTCACT

21

8/61

β2M

رفت

CCTGGTCTTTCTGGTGCTTGT

21

57

118

برگشت

GCAGTTCAGTATGTTCGGCTTC

22

57

 


واکنش زنجیره­ای پلیمراز کیفی: این واکنش در حجم نهایی 15 ماکرولیتر با استفاده از کیت شرکت Ampliqon انجام شد. به منظور تهیه واکنش 5/7 ماکرولیتر از مخلوط اصلی x2 (2x Master Mix)، 4 پیکومول از هر آغازگر و 1 ماکرولیتر cDNA با یکدیگر ترکیب شدند و حجم نهایی با آب تنظیم شد. واکنش PCR کیفی در دستگاه ترموسایکلر (Peqlab, Germany) در 32 چرخه حرارتی شامل مرحله واسرشت در دمای 94 درجه سانتی­گراد به مدت 15 ثانیه، مرحله اتصال در دمای 58 درجه سانتی­گراد به مدت 15 ثانیه، مرحله تکثیر در دمای 72 درجه سانتی­گراد به مدت 5 دقیقه انجام شد. همچنین مرحله واسرشتگی اولیه در دمای 94 درجه سانتی­گراد به مدت 3 دقیقه لحاظ گردید. در پایان محصولات  PCRبا استفاده از ژل آگارز یک درصد الکتروفورز شدند. ژل در ظرف حاوی اتیدیوم بروماید به مدت 10 دقیقه قرار داده شد و پس از شستشو در آب، در دستگاه Transilluminator تحت اثر اشعه UV باندها مشاهده شدند.

واکنش زنجیره­ای پلیمراز در زمان واقعی: بیان دو ژن Wnt3a و β2m با استفاده از کیت (25344, Intron) حاوی رنگ  SYBR Green Iاز طریق روش مقایسه­ای CT واکنش real time- PCR در دستگاه ترموسیکلر (Applied Bio Systems StepOne, USA) ارزیابی گردید. تعداد 40 سیکل تکثیر در دمای Annealing 55 درجه سانتی گراد صورت پذیرفت. این واکنش برای هر یک از تیمار­ها با 3 بار تکرار انجام شد.

طراحی آزمایش: بلاستوسیستها در دو گروه درون­تنی و برون­تنی مورد بررسی قرار گرفتند. در هر گروه رویانها به طور تصادفی به دو بخش تقسیم شدند. گروهی با استفاده از دستگاه ریزدستکاری به روش مکانیکی سوراخ شدند و مابقی بدون هیچ تیماری به عنوان گروه کنترل در نظر گرفته شدند. نرخ زنده­مانی، قابلیت خروج بلاستوسیستها از زونا و میزان بیان ژن Wnt3a در هر گروه ارزیابی گردید.

تجزیه و تحلیل داده­ها: با استفاده از تست  One-Way ANOVAو به دنبال آن تست Duncan، آنالیز داده­های سلولی و مولکولی صورت پذیرفت و تفاوتها در 05/0P< معنی­دار در­نظر گرفته شدند. برای این منظور از نرم­افزار آماری SPSS, ver. 16.0  استفاده گردید.

نتایج

بخش سلولی: براساس نتایج به دست آمده در

 

جدول 2 میزان زنده­مانی بلاستوسیتهای درون­تنی در گروه تیمار در مقایسه با کنترل، تفاوت معنی­داری نداشت (84/1 ± 93/98 در مقابل 100 درصد) اما میزان خروج از زونا افزایش معنی­داری نشان داد (72/1 ± 46/83 در مقابل 01/0 ± 6/70 درصد). در مورد بلاستوسیست­های برون­تنی نیز (جدول 3)، با استفاده از تکنیک سوراخ کردن مصنوعی، در کنار میزان زنده­مانی بالا (91/0± 97%)، افزایش معنی­داری نیز در میزان خروج از زونا بدست آمد (b53/3 ± 8/75 در مقابلa4/10± 4/63).

 

جدول 2- اثر سوراخ نمودن مصنوعی حفره بلاستوسل بر کیفیت بلاستوسیستهای درون­تنی موش

گروه مورد آزمایش

تعداد بلاستوسیست

درصد زنده­مانی

درصد خروج بلاستوسیست از زونا

کنترل

198

 a100%

 a 01/0 ± 6/70%

AC

136

  84/1 ± 93/98

 b72/1 ± 46/83

داده­ها از ترکیب نمونه­های 5 تکرار به دست آمدند. در هر ستون a و b نسبت به هم دارای تفاوت معناداری هستند (05/0 > P در تست ANOVA و Duncan).

 

جدول 3- اثر سوراخ نمودن مصنوعی حفره بلاستوسل بر کیفیت بلاستوسیستهای برون­تنی موش

گروه­های آزمایشی

تعداد بلاستوسیست

میزان زنده­مانی (%)

میزان خروج بلاستوسیست از زونا (%)

کنترل

179

a100%

a            4/10 ± 4/63%

AC

124

a 91/0± 97     

          b53/3 ± 8/75      

داده­ها از ترکیب نمونه­های 5 تکرار به دست آمدند. در هر ستون a و b نسبت به هم دارای تفاوت معناداری هستند (05/0 > P در تست ANOVA و Duncan).

 

 


بخش مولکولی: نتایج حاصل از نمودار 1 نشان می­دهد که میزان بیان ژن Wnt3a در بلاستوسیستهای درون تنی موش حاصل از فرآیند سوراخ کردن مصنوعی نسبت به گروه کنترل افزایش معنی­دار و در بلاستوسیستهای برون­تنی موش کاهش معنی­دار داشته است. همچنین نتایج حاصل نشان می­دهد میزان بیان ژن Wnt3a در بلاستوسیستهای برون­تنی موش حاصل از فرآیند سوراخ کردن مصنوعی نسبت به بلاستوسیستهای درون­تنی موش، کاهش معنی­دار  پیدا کرده است.

 

 

نمودار 1- اثر سوراخ کردن مصنوعی در الف: بلاستوسیستهای درون­تنی موش بر میزان بیان ژن Wnt3a نسبت به گروه کنترل ب: بلاستوسیستهای برون­تنی موش بر میزان بیان ژن  Wnt3a نسبت به گروه کنترل

داده­ها حاصل از 3 تکرار real time- PCR می­باشند.   aو b نسبت به هم تفاوت معنی­دار دارند (05/0P< در تست ANOVA و Duncan).


بحث

طبق نتایج به دست آمده در مطالعه حاضر میزان زنده­مانی بلاستوسیستهای سوراخ شده نسبت به گروه کنترل تفاوت معنی­داری نداشت   (84/1 ± 93/98 در مقابل 100 درصد برای بلاستوسیتهای درون­تنی و91/0± 97 در مقابل 100 درصد برای بلاستوسیتهای برون­تنی). بنابراین می­توان به این نتیجه رسید که عمل مکانیکی سوراخ کردن مصنوعی بلاستوسیست به خودی خود نمی­تواند اثر منفی قابل توجهی روی کیفیت و زنده­مانی بلاستوسیستها بگذارد. بنابراین می­توان از آن به عنوان یک روش مطمئن جهت کمک به خارج کردن جنین از زونا پلوسیدای ضخیم یاد کرد.

میزان تأثیرگذاری و بهبود نرخ خروج از زونا با کمک روش سوراخ کردن مصنوعی حفره بلاستوسیست، ارتباط مستقیمی با توانایی و مهارت کاربر در حین استفاده از این تکنیک نیز دارد. انتخاب سوزن مناسب و ظریف، موقعیت مناسب بلاستوسیست نسبت به سوزن نگهدارنده و تزریق و اعمال فشار کافی می­تواند به عنوان نکات کلیدی بیان گردند. توجه به عدم برخورد سوزن به سلولهای توده داخلی رویان و عبور آن از بین سلولهای تروفواکتودرم نیز می­تواند از تأثیر تهاجمی این روش بکاهد (19). علاوه بر استفاده از ریز سوزن شیشه­ای، روشهای دیگری همچون استفاده از سوزن با درجه 29، پیپت شیشه­ای (8)، لیزر (19) و غلظت بالای ساکارز (11) نیز برای کاهش مایع حفره بلاستوسل مورد بررسی قرار گرفته است. در روش استفاده از غلظتهای بالای ساکارز، نه تنها حجم حفره بلاستوسل کاهش می­یابد بلکه تک­تک سلولهای رویان نیز در معرض کاهش آب درون سلولی قرار می­گیرند که می­تواند اثرات مخرب پنهانی در آینده تکوین رویان داشته باشد. بنابراین مطالعات بیشتری جهت بهینه کردن غلظت ساکارز مورد استفاده، مدت زمان تماس رویان با آن و همچنین اثرات این روش بر روی سلامت رویان مورد نیاز است (27). استفاده از پیپتهای شیشه­ای نیز با توجه به تفاوت در اندازه و قطر بلاستوسیستها و نیاز به تعویض مکرر پیپتهایی با قطر مختلف، تا حدودی زمان­بر است و موجب تأخیر در روند کار می­گردد (5).

در سال 2006 Mukaida و همکارانش دو روش ریز سوزن شیشه­ای و لیزر را برای کاهش مایع حفره بلاستوسل قبل از انجماد شیشه­ای مورد مطالعه قرار دادند. مقایسه این دو روش، هیچ تفاوت معنا داری در میزان زنده­مانی بلاستوسیستها پس از ذوب و نتایج کلینیکی حاصل از انتقال آنها نشان نداد (19). در مطالعه­ای که در سال 2011 توسط Yong و همکارانش انجام شد نیز سوراخ کردن مصنوعی حفره بلاستوسل به صورت مستقل به عنوان تکنیک کمکی خروج از زونا مورد بررسی قرار گرفت. در این مطالعه از روش لیزر و سوزن با درجه 29 استفاده شد. نتایج این محقق افزایش در میزان بارداری پس از استفاده از هر دو روش لیزر و سوزن را نسبت به گروه کنترل نشان داد (10). لازم به ذکر است که استفاده از روش لیزر علی­رغم ایجاد سهولت و تسریع در روند کار، به علت گران بودن تجهیزات، زیاد رایج نمی­باشد.

بنابراین در این میان روش ریز سوزن شیشه­ای که در این مطالعه نیز مورد استفاده قرار گرفته است به نظر مطلوب و کارآمد می­آید. استفاده از تکنیک سوراخ کردن مصنوعی می­تواند نتایج کلینیکی را نیز بهبود بخشد. علاوه بر خروج مایع بلاستوسل توسط این تکنیک و تأثیر مثبت آن در کاهش کریستال یخ درون بلاستوسیست، Zech و همکارانش گزارش کردند که ارتباط مستقیمی بین شکاف در زونا قبل از انجماد با میزان خروج از زونا، لانه­گزینی و حاملگی وجود دارد (29). اگرچه توضیح این ارتباط کمی مشکل است، اما به نظر می­رسد، افزایش در میزان ورود برخی مواد سرما محافظ، یکی از دلایل بهبود نتایج کلینیکی باشد. محلولهایی که برای انجماد رویان استفاده می­شوند، شامل مواد سرما محافظ نفوذ پذیر و نفوذ ناپذیر است. مواد سرما محافظ نفوذ ناپذیر مانند ساکارز، موجب چگال­تر شدن محیط اطراف بلاستوسیست و جلوگیری از تشکیل کریستال یخ در آن ناحیه می­شوند. مواد سرما محافظ نفوذ پذیر نیز به راحتی از زونا عبور و از محیط داخل بلاستوسیست محافظت می­کنند. در این میان به نظر می­رسد، در بلاستوسیستهایی با زونای دست نخورده، انتشار ساکارز به فضای دور زرده­ای کافی نباشد. به این ترتیب سلولهای تروفواکتودرم، کاملاً توسط محیط چگال و حاوی مواد سرما محافظ احاطه نمی­شوند و حالت ایده­آل انجماد فراهم  نمی­گردد. بنابراین احتمالاً شکاف در زونا موجب تسریع در این انتشار و محافظت از سلولهای تروفواکتودرم می­شود. همچنین از آنجایی که در مراحل انتهایی گسترش بلاستوسیست، بعضی از سلولهای تروفواکتودرم کاملاً به زونا نزدیک شده و با آن اتصال برقرار می­کنند، هنگامی که در محلولهای انجمادی قرار می­گیرند، آب گیری به صورت یکنواخت و کامل صورت نمی­پذیرد. در نتیجه شکاف در زونا، از شکل­گیری این اتصال جلوگیری می­کند و موجب می­شود آب گیری به صورت کامل انجام شود(29).

فرضیه دیگری که در مورد اثر سوراخ کردن مصنوعی در بهبود نتایج کلینیکی وجود دارد، نقش پمپ NA+/K+ ATP ase در ایجاد حفره بلاستوسل است. از آنجایی که حدود 60 درصد از کل ATP تولید شده در طول رشد بلاستوسیست را این پمپ ATP ase مورد استفاده قرار می­دهد، بازگشت مجدد بلاستوسیست به حالت اول پس از ذوب، مستلزم مصرف بالای مجدد این مقدار انرژی می­باشد که می­تواند توجیهی برای کندتر بودن روند برگشت و نیز کاهش در میزان خروج از زونا و لانه­گزینی رویان به حساب آید. بنابراین ایجاد حفره در دیواره زونا قبل از انجماد، می­تواند نوعی هچینگ کمکی به حساب آید و ضمن تسریع در بازگشت مجدد رویان به حالت اول، با حفظ انرژی بیشتر، شرایط را برای لانه­گزینی بهبود بخشد (11). افزایش درصد خروج از زونا در گروه سوراخ کردن مصنوعی نسبت به گروه کنترل (72/1 ± 46/83 در مقابل 01/0 ± 6/70 درصد برای بلاستوسیتهای درون­تنی و b53/3 ± 8/75 در مقابلa4/10± 4/63 برای بلاستوسیتهای برون­تنی) را می­توان ناشی از تحریک ترشح آنزیم لایزین در اثر سوراخ کردن مصنوعی بلاستوسیست دانست. در حالت طبیعی هنگام رسیدن بلاستوسیست به رحم، بلاستوسیست می­بایست از زونا خارج شود تا بتواند به دیواره رحم بچسبد. افزایش حجم مایع بلاستوسل و ترشح نوعی پروتئاز شبه تریپسینی به نام لایزین توسط سلولهای TE، سبب خروج بلاستوسیست از زونا می­گردد. حال زمانی­که عمل سوراخ کردن به صورت مصنوعی توسط سوزن انجام می­شود، سوزن پس از سوراخ کردن زونا وارد اتصالات سلولهای تروفواکتودرمی می­شود و فرآیند ترشح آنزیم لایزین را تحریک می­کند، همین امر می­تواند کمکی باشد برای جنین که یا از محل سوراخ شده به صورت اتفاقی و یا از محلی که در حالت طبیعی باید از زونا خارج می­شده این عمل صورت گیرد (10). بر اساس نتایج گزارش شده، نرخ زنده­مانی بلاستوسیستهای برون­تنی موش حاصل از فرآیند سوراخ کردن مصنوعی نسبت بلاستوسیستهای درون­تنی موش حاصل از فرآیند سوراخ کردن مصنوعی کاهش غیر معنی­دار داشته است. که این کاهش جزئی می­تواند ناشی از اعمال فشار ریز سوزنها بر زوناپلوسیدا هنگام سوراخ کردن باشد. همچنین میزان خروج از زونای بلاستوسیستهای برون­تنی موش حاصل از فرآیند سوراخ کردن مصنوعی نسبت به بلاستوسیستهای درون­تنی موش کاهش معنی­دار پیدا کرده است که این کاهش می­تواند به علت شرایط کشت در محیط آزمایشگاه و استرسهای ناشی از آن بر روی جنین باشد. لقاح و کشت در آزمایشگاه با تغییر در الاستیسیته زونا باعث افزایش مقاومت آن و کاهش توانایی خروج بلاستوسیست از زونا می­شود. خروج بلاستوسیست از زونا در آزمایشگاه نیازمند مشارکت فعال تروفواکتودرم­ است. با گسترش بلاستوسیست در محیط آزمایشگاهی زونا نازک می­شود و این به علت فشار ناشی از گسترش بلاستوسیست و لیز شدن زونا توسط لیزین تروفواکتودرمال می­باشد.

فرآیند خروج بلاستوسیست از زونا در محیط آزمایشگاهی با ایجاد سوراخهای متعدد درغشاء زونا انجام می شود. این فرآیند متفاوت با خروج بلاستوسیست از زونا در رحم که زونا کاملاً حل می­شود، می­باشد. خروج بلاستوسیست از زونا در شرایط آزمایشگاهی به علت غیاب آنزیم پرومئاناز لیزین رحمی رخ می­دهد (5 و 26).

بحث مولکولی: استرسهای ایجاد شده توسط تکنیکهای کمک باروری، از جمله انجماد، لقاح آزمایشگاهی و سوراخ کردن مصنوعی می­توانند اثرات نامطلوبی در سطح مورفولوژی، متابولیسم، فراساختار و سطح ژنومی سلولها داشته باشد و با ایجاد تغییر در الگوی بیان ژن باعث اختلال در رشد و نمو، ایجاد ناهنجاری، کاهش قابلیت لانه­گزینی و در نهایت مرگ رویان شود. ارزیابی کیفیت رویانها از نظر مولکولی علاوه بر بررسی سلولی، می­تواند به درک بهتر اثرات این تکنیکها کمک نماید. تنها مطالعه­ای که تأثیر سوراخ کردن مصنوعی حفره بلاستوسل را بر روی بیان ژنهای بلاستوسیست ارزیابی کرده است، در سال 2014 انجام گرفت. در این مطالعه، Min و همکارانش، بیان ژنهای مرتبط با آپوپتوز Bax و Bcl-XL را در دو گروه بلاستوسیستهای منجمد- ذوب شده و بلاستوسیستهایی که قبل از انجماد توسط سوزن درجه 29 سوراخ شده بودند بررسی کردند. نتیجه حاکی از تأثیر مثبت تکنیک سوراخ کردن مصنوعی در کاهش روند آپوپتوز بود. به این صورت که میزان بیان ژن Bax که به نوعی پیش برنده آپوپتوز است، در این گروه نسبت به گروه انجماد کاهش و در مقابل میزان بیان ژن Bcl-XL که از آپوپتوز جلوگیری می­کند افزایش یافته بود (18). از آنجایی که تا کنون مطالعه­ای در مورد اثر این تکنیک بر روی عوامل مولکولی دخیل در تکوین صورت نپذیرفته است، فرایند سوراخ کردن مصنوعی نیز می­تواند، با تأثیر بر بیان ژنهای دخیل در تکوین بلاستوسیست و پر­توانی توده سلولی داخلی بر توسعه و عملکرد جنین تأثیر­گذار باشد. از میان این ژنها می­توان به ژنهای خانواده Wnt اشاره کرد که از مراحل اولیه رشد جنینی بیان می­شود و به ICM و سپس به اپی­بلاست و بعد از گاسترولاسیون به رده سلولی زاینده محدود می­گردد و نقش عمده­ای در رشد و تکامل جنین ایفاء می­نمایند.

بنابراین، نقص در بیان آنها منجر به تولید بلاستوسیستهایی خواهد شد که ICM آنها قدرت تمایز به سایر سلولها را ندارد و حتی در صورت لانه­گزینی نیز در مراحل اولیه تکامل جنینی و از بین می­روند (16). تا کنون گزارشی مبنی بر بررسی مولکولی تأثیر سوراخ کردن مصنوعی بر میزان بیان ژن Wnt3a در بلاستوسیست مشاهده نشده و فقط در زمینه سلولی بررسی شده است.

مایع درون حفره بلاستوسل، با وجود اثرات آن در ایجاد کریستال یخ حین انجماد، برای سلولهای توده داخلی نقش تغذیه­ای دارد و به حرکت و موضع­گیری صحیح بلاستومرها و در نتیجه رده­زایی رویان کمک  می­نماید. ایجاد سوراخ به صورت مصنوعی در بلاستوسیست، موجب کاهش مایع موجود در حفره بلاستوسل می­شود و به انجماد بهتر رویان یاری     می­رساند. اما در مقابل، شوک مکانیکی حاصل از سوراخ کردن بلاستوسیست توسط ریز سوزن و همچنین نقش مهم مایع بلاستوسل در تکوین رویان قرار دارد. سوالی که در اینجا مطرح  می­شود این است که گرفتن آب حفره بلاستوسل در بین روزهای 5/4- 5/3 چه تأثیری بر میزان بیان ژن Wnt3a می­گذارد؟ در این آزمایش پس از بررسی بیان ژن Wnt3a، مشاهده شد که بیان این ژن در بلاستوسیستهای درون­تنی حاصل از فرآیند سوراخ کردن مصنوعی نسبت به گروه کنترل افزایش معنی­دار داشت. علت این افزایش ممکن است پاسخ به از بین رفتن بلاستومرهای آسیب دیده در AC برای ثابت نگه داشتن سطح بیان این ژن باشد که برای اطلاعات بیشتر نیازمند تحقیقات بیشتری در این زمینه می­باشد. میزان بیان ژن Wnt3a در بلاستوسیستهای برون­تنی موش حاصل از فرآیند سوراخ کردن مصنوعی نسبت به بلاستوسیستهای درون­تنی موش، کاهش   معنی­دار پیدا کرده است. مطالعات نشان می­دهند که تفاوت در ظاهر و کیفیت رویانهای درون­تنی نسبت به برون­تنی می­تواند به واسطه بروز مجموعه تغییرات پایه­ای در طول مدت کشت رویان در شرایط آزمایشگاهی باشد. تغییراتی مانند افزایش در تعداد سلولها، مرگ برنامه­ریزی شده سلولی و یا زمان قرارگیری بلاستومرها در لایه­های اختصاصی رویان که می­توانند به واسطه تغییر در نوع اتصالات بین بلاستومرها و تفاوت در الگوی بیان ژنها رخ دهند. تا کنون مطالعات متعددی نشان داده­اند که سطح بیان بسیاری از ژنها، در رویانهای رشد یافته در محیط کشت با رویانهای به دست آمده از محیط داخل بدن متفاوت است (7).

تفاوت اثر کاهش مایع بلاستوسل بر رویانهای برون­تنی می­تواند ناشی از تأخیر در شکل­گیری لایه­های جنینی باشد، در نتیجه کشیدن مایع در این مرحله، تأثیر بیشتری بر بیان ژن Wnt3a گذاشته است. از آنجایی که هیچ نتیجه­ای مبنی بر تأثیر منفی استفاده از این تکنیک نیز وجود ندارد و با توجه به مزایای ذکر شده در مورد میزان خروج از زونا و نتایج بالینی، کاهش مایع بلاستوسل قبل از انجماد شیشه­ای  می­تواند مفید واقع شود. هرچند بهتر است اثر آن در مورد سایر ژنهای دخیل در تکوین نیز مورد مطالعه قرار بگیرد.

تشکر و قدردانی

این تحقیق در قالب طرح پژوهشی به شناسه­ی 444 و با حمایت مالی پژوهشگاه ملی مهندسی ژنتیک و زیست­فناوری صورت پذیرفته است. نگارندگان، مراتب تشکر و قدردانی خود را از همکاری صمیمانه­ی آقایان دکتر مرتضی دلیری، دکتر هادی حجاریان، احسان هاشمی و دکتر آیدین رحیم­طایفه اعلام می­نماید.

1.   Aktan, E., et al., The effect of zona thinning size on implantation and pregnancy rates of ICSI-ET patients with advanced woman age. 2007.

2.   Balaban, B., et al., Laser-assisted hatching increases pregnancy and implantation rates in cryopreserved embryos that were allowed to cleave in vitro after thawing: a prospective randomized study. Human Reproduction, 2006. 21(8): p. 2136-2140.

3.   Bansal, P. and S. Gupta, Binding characteristics of sperm with recombinant human zona pellucida glycoprotein-3 coated beads. Indian Journal of Medical Research, 2009. 130(1): p. 37-43.

4.   Cruz, J.R., et al., Is blastocyst transfer useful as an alternative treatment for patients with multiple in vitro fertilization failures? Fertility and sterility, 1999. 72(2): p. 218-220.

5.   Desai, N., et al., Artificial collapse of blastocysts before vitrification: mechanical vs. laser technique and effect on survival, cell number, and cell death in early and expanded blastocysts. Cell Preservation Technology, 2008. 6(3): p. 181-190.

6.   Ebner, T., M. Moser, and G. Tews, Possible applications of a non-contact 1.48 μm wavelength diode laser in assisted reproduction technologies. Human Reproduction Update, 2005. 11(4): p. 425-435.

7.   Gao, Y., et al., Epigenetic regulation of gene expression in porcine epiblast, hypoblast, trophectoderm and epiblast-derived neural progenitor cells. Epigenetics, 2011. 6(9): p. 1149-1161.

8.   Hiraoka, K., et al., Blastocoele collapse by micropipetting prior to vitrification gives excellent survival and pregnancy outcomes for human day 5 and 6 expanded blastocysts. Human Reproduction, 2004. 19(12): p. 2884-2888.

9.   Hiraoka, K., et al., Impact of the size of zona pellucida thinning area on vitrified-warmed cleavage-stage embryo transfers: a prospective, randomized study. Journal of assisted reproduction and genetics, 2009. 26(9-10): p. 515-521.

10. Hur, Y.S., et al., Effect of artificial shrinkage on clinical outcome in fresh blastocyst transfer cycles. Clinical and experimental reproductive medicine, 2011. 38(2): p. 87-92.

11. Iwayama, H., S. Hochi, and M. Yamashita, In vitro and in vivo viability of human blastocysts collapsed by laser pulse or osmotic shock prior to vitrification. Journal of assisted reproduction and genetics, 2011. 28(4): p. 355-361.

12. Kono, T., O. Suzuki, and Y. Tsunoda, Cryopreservation of rat blastocysts by vitrification. Cryobiology, 1988. 25(2): p. 170-173.

13. Levitas, E., et al., Blastocyst-stage embryo transfer in patients who failed to conceive in three or more day 2–3 embryo transfer cycles: a prospective, randomized study. Fertility and sterility, 2004. 81(3): p. 567-571.

14. Liebermann, J., et al., Recent developments in human oocyte, embryo and blastocyst vitrification: where are we now? Reproductive BioMedicine Online, 2003. 7(6): p. 623-633.

15. Liebermann, J. and M.J. Tucker, Comparison of vitrification and conventional cryopreservation of day 5 and day 6 blastocysts during clinical application. Fertility and sterility, 2006. 86(1): p. 20-26.

16. Marois, E., A. Mahmoud, and S. Eaton, The endocytic pathway and formation of the Wingless morphogen gradient. Development, 2006. 133(2): p. 307-317.

17. Martins, W.P., et al., Assisted hatching of human embryos: a systematic review and meta-analysis of randomized controlled trials. Human Reproduction Update, 2011. 17(4): p. 438-453.

18. Min, S.H., et al., Forced Collapse of the Blastocoel Cavity Improves Developmental Potential in Cryopreserved Bovine Blastocysts by SlowRate Freezing and Vitrification. Reproduction in Domestic Animals, 2014. 49(4): p. 684-692.

19. Mukaida, T., et al., Artificial shrinkage of blastocoeles using either a micro-needle or a laser pulse prior to the cooling steps of vitrification improves survival rate and pregnancy outcome of vitrified human blastocysts. Human Reproduction, 2006. 21(12): p. 3246-3252.

20. Mukaida, T., K. Takahashi, and M. Kasai, Blastocyst cryopreservation: ultrarapid vitrification using cryoloop technique. Reproductive BioMedicine Online, 2003. 6(2): p. 221-225.

21. Petersen, C.G., et al., Implantation failures: success of assisted hatching with quarter-laser zona thinning. Reproductive BioMedicine Online, 2005. 10(2): p. 224-229.

22. Sagoskin, A.W., et al., Laser assisted hatching in good prognosis patients undergoing in vitro fertilization-embryo transfer: a randomized controlled trial. Fertility and sterility, 2007. 87(2): p. 283-287.

23. Santos Filho, E., J. Noble, and D. Wells, A review on automatic analysis of human embryo microscope images. The open biomedical engineering journal, 2010. 4: p. 170.

24. Shapiro, B.S., et al., Dramatic declines in implantation and pregnancy rates in patients who undergo repeated cycles of in vitro fertilization with blastocyst transfer after one or more failed attempts. Fertility and sterility, 2001. 76(3): p. 538-542.

25. Sifer, C., et al., A prospective randomized study to assess the benefit of partial zona pellucida digestion before frozen-thawed embryo transfers. Human Reproduction, 2006. 21(9): p. 2384-2389.

26. Sommerfeld, V. and H. Niemann, Cryopreservation of Bovine< i> in Vitro</i> Produced Embryos Using Ethylene Glycol in Controlled Freezing or Vitrification. Cryobiology, 1999. 38(2): p. 95-105.

27. Soom, A.V., et al., Cell allocation to the inner cell mass and the trophectoderm in bovine embryos cultured in two different media. Molecular reproduction and development, 1996. 45(2): p. 171-182.

28. Vanderzwalmen, P., et al., Aseptic vitrification of blastocysts from infertile patients, egg donors and after IVM. Reproductive BioMedicine Online, 2009. 19(5): p. 700-707.

29. Zech, N., et al., Vitrification of hatching and hatched human blastocysts: effect of an opening in the zona pellucida before vitrification. Reproductive BioMedicine Online, 2005. 11(3): p. 355-361.

30. Zhu, S., et al., Cryopreservation of zona-hatched mouse blastocysts. Journal of reproduction and fertility, 1996. 107(1): p. 37-42.