نوع مقاله: مقاله پژوهشی

نویسندگان

1 دانشگاه آزاد اسلامی، واحد زنجان، گروه ژنتیک، زنجان، ایران

2 هیئت علمی پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری، گروه زیست فناوری دام

3 هیئت علمی دانشگاه آزاد زنجان

4 هیئت علمی پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری

چکیده

مقدمه: از زمان اولین انجماد شیشه‌ای رویان موش در سال 1985، تلاش‌ها‌ی قابل توجهی برای توسعه و بهبود این تکنیک صورت گرفته است اما همچنان انجماد با اعمال آسیب‌های جدی بیوشیمیایی و کروموزومی بر روی رویان می‌تواند باعث تغییراتی در الگوی بیان ژن‌های دخیل در تکوین و عملکرد، کاهش لانه‌گزینی و نهایتا مرگ رویان گردد. هدف از این مطالعه بررسی تاثیرات انجماد شیشه‌ای بر زنده‌مانی و رشد و بررسی بیان ژن‌های تخصصی پرتوانی موثر در تکوین رویان از جمله ژن‌های Oct4 و Nanog در بلاستوسیست‌های منجمد- ذوب شده‌ی موش بود. روش کار: پس از تحریک تخمک‌گذاری موش‌های ماده و استحصال بلاستوسیست، فرآیند انجماد با حضور دی‌متیل سولفوکسید 15%، اتیلن‌گلیکول 15% و ساکارز 5/0 مولار به عنوان مواد سرما‌محافظ در محیط‌های انجمادی انجام شد و بلاستوسیست‌ها با قرار‌گیری روی Cryotop، به درون ازت مایع منتقل گشتند. فرآیند ذوب نیز با شست‌و‌شوی رویان‌ها در محیط ذوب حاوی ساکارز 1 مولار صورت پذیرفت.
نهایتا میزان زنده‌مانی، خروج بلاستوسیست‌ها از زونا و نیز بیان ژن‌های Oct4 و Nanog به روش real time- PCR در بلاستوسیست‌های منجمد- ذوب شده و شاهد ارزیابی شد. نتایج: نرخ زنده‌مانی و خروج بلاستوسیست‌ها از زونا در تیمار انجماد نسبت به بلاستوسیست‌های منجمد نشده بطور معنی‌داری کاهش یافتند (81/5±43/94% در مقابل 100% برای زنده‌مانی و 76/11±78/57% در مقابل80/5± 88/86% برای خروج بلاستوسیست از زونا). همچنین بیان ژن‌های Nanog و Oct4 افزایش یافت. نتیجه‌گیری: با توجه به یافته‌های این آزمایش می‌توان گفت که انجماد شیشه‌ای بلاستوسیست موش سوری در مرحله‌ی بلاستوسیست می‌تواند باعث تغییر بیان ژن و کیفیت رویان گردد.

کلیدواژه‌ها

عنوان مقاله [English]

The effect of vitrification on pluripotency specific genes, Oct4 and Nanog in mouse blastocysts

نویسندگان [English]

  • parisa fathalizadeh 1
  • Mojtaba Dashtizad 2

1 Department of Genetics, Zanjan Branch, Islamic Azad University, Zanjan, Iran

چکیده [English]

Introduction: From the first vitrification of mouse embryos in 1985, considerable efforts have been made to develop and improve cryopreservation techniques, but still biochemical and fetal chromosomal abnormalities caused by vitrification can cause changes in the pattern of genes expression involved in embryonic development and function, reduced implantation and fetal death. The purpose of this study was to investigate the effects of vitrification on survival and the expression of pluripotency specific genes like Oct4 and Nanog in the vitrified-warmed mouse blastocysts. Methods & Materials: Harvested blastocysts from superovulated female mice were vitrified in the presence of dimethyl sulfoxide 15%, ethylene glycol 15% and sucrose 0.5 M as cryoprotectants and vitrified in liquid nitrogen after loading on Cryotop. Thawing process was performed by immersing the blastocysts in thawing solution prepared using sucrose 1 M. Survival and hatching rates were evaluated and also the Oct4 and Nanog genes expression in vitrified- thawed and fresh blastocysts (control group) were assessed by real time-PCR method. Results: Survival and hatching rates decreased significantly in vitrified blastocysts compared with control group (94.43± 5.81% vs. 100% for survival and 57.78± 11.76% vs. 86.88± 5.80% for hatching). Also increased expression of Nanog and Oct4 genes were observed in vitrified- warmed blastocysts. Conclusion: Considering the results of this study, it can be said that vitrification of mouse embryo at the blastocyst stage can change gene expression and quality of the embryo.

کلیدواژه‌ها [English]

  • "Vitrification"
  • "Mouse blastocyst"
  • "Oct4 and Nanog genes"

بررسی اثر انجماد شیشه­ای بر میزان بیان نشانگرهای اختصاصی پرتوانی، Oct4 و Nanog در بلاستوسیستهای موش سوری 

پریسا فتحعلی­زاده1، مجتبی دشتی­زاد2*، گلناز اسعدی تهرانی1 و مرتضی دلیری جوپاری2 

1 زنجان، دانشگاه آزاد اسلامی، واحد زنجان، گروه ژنتیک 

2 تهران، پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری

تاریخ دریافت: 9/9/93                  تاریخ پذیرش: 26/11/93 

چکیده

از زمان اولین انجماد شیشه­ای رویان موش در سال 1985، تلاشهای قابل توجهی برای توسعه و بهبود این تکنیک صورت گرفته است اما همچنان انجماد با اعمال آسیبهای جدی بیوشیمیایی و کروموزومی بر روی رویان می­تواند باعث تغییراتی در الگوی بیان ژنهای دخیل در تکوین و عملکرد، کاهش لانه­گزینی و نهایتاً مرگ رویان گردد. هدف از این مطالعه بررسی تأثیرات انجماد شیشه­ای بر زنده­مانی و رشد و بررسی بیان ژنهای تخصصی پرتوانی مؤثر در تکوین رویان از جمله ژنهای Oct4 و Nanog در بلاستوسیستهای منجمد- ذوب شده موش بود. پس از تحریک تخمک­گذاری موشهای ماده و استحصال بلاستوسیست، فرآیند انجماد با حضور دی­متیل سولفوکسید 15 درصد، اتیلن­گلیکول 15 درصد و ساکارز 5/0 مولار به عنوان مواد سرما­محافظ در محیطهای انجمادی انجام شد و بلاستوسیستها با قرار­گیری روی Cryotop، به درون ازت مایع منتقل گشتند. فرآیند ذوب نیز با شست­و­شوی رویانها در محیط ذوب حاوی ساکارز 1 مولار صورت پذیرفت. نهایتا میزان زنده­مانی، خروج بلاستوسیستها از زونا و نیز بیان ژنهای Oct4 و Nanog به روش   real time- PCR در بلاستوسیستهای منجمد- ذوب شده و شاهد ارزیابی شد. نرخ زنده­مانی و خروج بلاستوسیستها از زونا در تیمار انجماد نسبت به بلاستوسیستهای منجمد نشده به طور معنی­داری کاهش یافتند (81/5±43/94 درصد در مقابل 100 درصد برای زنده­مانی و 76/11±78/57 درصد در مقابل80/5± 88/86 درصد برای خروج بلاستوسیست از زونا). همچنین بیان ژنهای Nanog و Oct4 افزایش یافت. با توجه به یافته­های این آزمایش می­توان گفت که انجماد شیشه­ای بلاستوسیست موش سوری در مرحله بلاستوسیست می­تواند باعث تغییر بیان ژن و کیفیت رویان گردد.

واژه های کلیدی: انجماد شیشه­ای، بلاستوسیست موش، ژنهای Oct4 و Nanog 

* نویسنده مسئول، 09123211058  ، پست الکترونیکی: dashtizad@nigeb.ac.ir

مقدمه 

 

با موفقیت لقاح آزمایشگاهی (In vitro Fertilization: IVF) وتولد اولین نوزاد زنده پستانداران، در سال 1959 (3)، این روش به عنوان یکی از تکنیکهای کمک باروری معرفی گردید و امروزه در مراکز درمان ناباروری به صورت رایج مورد استفاده قرار می­گیرد. از طرفی در مواردی­ که تعداد رویانهای تشکیل شده بیش از تعداد مورد نیاز جهت انتقال به رحم باشند، ضرورت حفظ و نگهداری آنها به منظور استفاده در دوره­های درمانی بعدی (در صورت شکست) بیش از پیش اهمیت می­یابد. این امر می­تواند از طریق تکنیک انجماد میسر گردد که برای اولین بار در سال 1971 به لانه­گزینی موفق، در رویان پستانداران (بلاستوسیست موش) منجر گردید (36). از آن پس نیز انجماد گامت و رویان در گونه­های مختلف پستانداران درزمینه­هایی نظیر طب تولیدمثل، پرورش حیوانات، حفظ تغییرات ژنتیکی، به تعویق انداختن انتقال رویان در بیمارانی که در معرض خطر بالایی از سندرم تحریک بیش از حد تخمدان هستند، حفظ باروری بیمارانی که در حال آماده شدن برای شیمی درمانی و یا پرتو درمانی هستند و نیز برای داوطلبین اهداء گامت و رویان به کار گرفته شده است (21). در طی فرآیند انجماد به دلیل حضور آب درون سلولی و تشکیل کریستالهای یخ، استفاده از مواد سرما محافظ (Cryoprotective Agents: CPAs) الزامی است. اما از سوی دیگر نشان داده شده است که غلظت بالای این CPAs می­تواند اثر سمی برای سلول به همراه داشته باشد (18). در دهه اخیر پیشرفتهای زیادی در علم زیست شناسی انجماد برای حفظ سلامت گامت و رویان انسانی و حیوانی به روشهای انجماد آهسته و انجماد شیشه­ای صورت پذیرفته است. در روش انجماد آهسته از ﻏﻠﻈتهای ﭘﺎیﻴﻦ CPAs ﺑــﺎ نرخ برودتی به میزان 1/0 تا 3/0 درجه سانتی گراد در دقیقه به منظور جلوگیری ازتشکیل کریستالهای یخ استفاده می­شود. اما غلظت­ پایین CPAs و نرخ برودتی کم از طرفی و افزایش زمانی که رویان در معرض محدوده دمایی خطرناک انجماد و ذوب (15 تا 6- درجه سانتی گراد) قرار می­گیرد از طرفی دیگر، باعث تشکیل ﻛﺮﻳﺴﺘﺎلهای ﻳـﺦ داﺧـﻞ و ﺧـﺎرج ﺳﻠﻮﻟﻲ و در نهایت آسیب به ساختار رویان می­گردد (12 و 23). لذا اﻣــﺮوزه بتدریج این تکنیک جای خود را به انجماد شیشه­ای داده است که اوﻟـﻴﻦ ﺑـﺎر در ﺳـﺎل 1937 ﺗﻮﺳــﻂ Luyet و همکارانش ﻣﻄــﺮح گردید (19). در این تکنیک ﺑــﻪ دلیل ﻏﻠﻈﺖ ﺑﺎﻻی CPAs، امکان غوطه­وری مستقیم رویان به داخل ازت مایع مقدور می­باشد. نتیجه این امر افزایش چشمگیر در نرخ برودتی به میزان 20,000 درجه سانتی گراد در دقیقه و ﺗﺒــﺪﻳﻞ ﻳﻜﺒــﺎره ﻣﺤـﻴﻂ اﻃـﺮاف آن ﺑــﻪ ﻳــﺦ ﻓﺎﻗــﺪ ﻛﺮﻳﺴﺘﺎل است (2). پس از اولین انجماد موفق رویان پستانداران در سال 1985 (28)، این نوع انجماد تاکنون هم درمورد تخمک و هم درمورد رویان با موفقیت صورت گرفته است. اما چالش همیشگی در این زمینه، کسب نرخ بالای بقاء و افزایش احتمال موفقیت درلانه­گزینی پس از ذوب و انتقال است. در این میان، رویانهای منجمد و ذوب شده در مراحل اولیه تسهیم (4-8 سلولی)، دارای نرخ بقای بالایی هستند ولی از طریق ویژگیهای مورفولوژیکی قابل پیش­بینی در ادامه روند تکاملی نیستند و ریسک عدم موفقیت در حاملگی را بالا می­برند. در مقابل، بلاستوسیست بهترین مرحله برای انتقال رویان با پتانسیل تکوینی مناسب است. با این گزینش می­توان تعداد  رویانهای انتقال یافته و ریسک ابتلا به چند قلوزایی را کاهش داد (37). همچنین با توجه به کوچک شدن اندازه بلاستومرها، کاهش میزان آب درون سلولی و افزایش نسبت سطح به حجم در طی فرآیند تسهیم، انتظار می­رود نرخ زنده­مانی رویانهای ذوب شده بلاستوسیست بیشتر از مراحل قبلی باشد.

اما در کنار این مزیتها، نرخ بقای بلاستوسیست پس از ذوب پایین است. از دلایل آن می­توان به حفره مملو از مایع بلاستوسل اشاره کرد که سرعت انتقال مواد ضد یخ و مولکولهای آب را کاهش و در نتیجه پتانسیل تشکیل کریستالهای یخ را افزایش می­دهد. برای رفع این مشکل باید از غلظتهای بالاتر  CPAsاستفاده نمود و یا رویان را مدت زمان بیشتری در معرض این مواد قرار داد، که هر دو خود از عوامل آسیب­زا محسوب می­شوند (1).

روشهای اﻧﺠﻤﺎد، ﻋﻠﻲرﻏﻢ ﻧﻘﺶ ﻏﻴﺮﻗﺎﺑﻞ اﻧﻜـﺎرشان در درﻣﺎن اﻓﺮاد ﻧﺎﺑﺎرور، ﺑﻪ دﻟﻴﻞ اﺛﺮات CPAs و ﺗﻐﻴﻴـﺮات ﺷﺪﻳﺪ ﺑﺮودﺗﻲ و ﺣﺮارﺗﻲ ﻣﻲﺗﻮانند ﺗأﺛﻴﺮهای ﻧـﺎﻣﻄﻠﻮﺑﻲ ﺑـﺮ ﺳﺎﺧﺘﺎر ﺳﻠﻮل داﺷﺘﻪ و منجر به آﺳﻴﺐ ﺳﻠﻮﻟﻲ ﺑﻪ ﻃﺮق ﻣﺨﺘﻠﻒ گردد. به عبارتی انجماد با اعمال آسیبهای جدی بیوشیمیایی و کروموزومی بر روی رویان می­تواند با تغییر در الگوی بیان ژنی، موجب کاهش رشد و قابیت لانه­گزینی و نهایتاً مرگ رویان گردد (7). به نظر می­رسد انجماد با اثر بر بیان ژنهای دخیل در تکوین، توسعه و عملکرد رویان از جمله ژنهای پر­توانی توده داخلی بلاستوسیست می­تواند بر کیفیت رویان اثر­گذار باشد. از مهم ترین ژنهای مؤثر در ایجاد و حفظ ویژگی پرتوانی سلولهای بنیادی و تکامل اولیه رویان قبل ازلانه­گزینی، می­توان به ژنهای تخصصی پرتوانی از جمله Oct4 و Nanog اشاره کرد که در توده سلولی داخلی بلاستوسیست (Inner Cell Mass:) بیان می گردند (22). نقص و یا عدم بیان ژن Oct4 منجر به تولید بلاستوسیستهایی خواهد شد که ICM آنها قدرت تمایز به سایر سلول­ها مانند اپی­بلاست و کیسه زرده را ندارد و در مراحل اولیه تکامل رویانی و پیش از لانه­گزینی از بین خواهند رفت (14). همچنین بلاستوسیست­های موش­ فاقد هر دو الل Nanog،ICM  و تروفواکتودرم (Trophectoderm: TE) نرمال خواهند داشت اما این رویانها بعد از لانه­گزینی به دلیل نقص در اپی­بلاست  از بین می­روند (30).

در این تحقیق کیفیت بلاستوسیستهای ذوب شده از لحاظ مورفولوژیک با سنجش نرخ زنده­مانی، بازگشت رویانها به شکل طبیعی و نرخ خروج از زونا و نیز از طریق روشهای مولکولی با بررسی بیان فاکتورهای Oct4 و Nanog به عنوان نشانگرهای تخصصی پرتوانی، ارزیابی گردید.

مواد و روشها

استحصال بلاستوسیست: در این مطالعه از موشهای ماده نژاد  NMRIبا سن 8-7 هفته استفاده گردید. تمامی مراحل کار با موش طبق دستورالعمل کمیته اخلاق و ایمنی زیستی پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری صورت پذیرفت. تخمک­گذاری موشهای ماده با تزریق IU (International Unit) 8 هورمون PMSG (Pregnant MareSerumGonadotropin) (Folligon®, A007A02, Intervet) در روز اول و 47 ساعت پس از آن IU 8 هورمون  hCG(Human Chorionic Gonadotropin) (Pregnyl®, 111, DarouPakhsh) به صورت داخل صفاقی انجام شد. پس از آن، موشهای ماده با موش نر (10-12 هفته) از همان نژاد درون یک قفس قرار داده شدند و جفت­گیری با تشکیل پلاک واژنی موشهای ماده در صبح روز بعد، تأیید گردید. موشهای باردار سه و نیم روزه، به روش جابه جایی مهره گردن کشته شدند. بعد از جراحی و جداسازی لوله­های رحمی، با فشار تزریق محیط­ کشت M2 (Modified Krebs-Ringer solution with HEPES buffer: M2 medium)(27) به همراه سدیم پیروات (Sodium Pyruvate) (P-4562, Sigma) و آلبومین سرم گاوی (Bovine Serum Albumin: BSA)10106,GibcoBRL) ) به این لوله­ها، بلاستوسیستها از انتهای رحم خارج شده و جمع­آوری گردیدند. تمامی مراحل استحصال بلاستوسیست در دمای 37 درجه سانتی گراد صورت گرفت.

انجماد شیشه­ای: تمام فرآیندهای انجماد و ذوب جنین مطابق روش کار معرفی شده توسط Kuwayama و Vajta با مختصر تغییراتی صورت پذیرفت (14). محلولهای متعادل­سازی، انجماد، ذوب و رقیق­سازی با استفاده از محیط کشت TCM199  (22340-020, Gibco) همراه با 20% سرم جنین گاو (10270, Gibco) به عنوان محیط پایه آماده گشتند. فرآیند انجماد در دمای اتاق (27-22 درجه سانتی گراد) انجام شد. رویانها در محیط متعادل­سازی حاوی 5/7درصد دی­متیل سولفوکساید (D-2650, Sigma)   و 5/7درصد اتیلن­گلیکول (Sigma, 324558) محلول در محیط پایه برای 15 دقیقه قرار داده شدند. پس از آن رویانها به مدت یک دقیقه در قطرات کوچکی از محیط انجماد شامل 15 درصد DMSO، 15 درصد  EGو ساکارز 5/0 مولار (S-9378, Sigma) محلول در محیط پایه شست و شو داده شدند. در نهایت بلاستوسیستها (8-5 عدد) با کمترین حجم ممکن از محیط انجماد روی کرایوتاپ (Kitazato، 81115 -81111) به عنوان حامل انجماد قرار داده شدند.

کرایوتاپ به سرعت درون ظرف حاوی ازت مایع فرو برده شد و پس از گذشت چند ثانیه، سرپوش پلاستیکی روی آن قرار گرفت. در نهایت، کرایوتاپهای حاوی بلاستوسیست، به مخزن اصلی ازت مایع منتقل گشتند. پس از نگهداری رویانها در حدود یک ماه، فرآیند ذوب انجام شد. برای این کار کرایوتاپ به سرعت از ازت مایع خارج و برای مدت یک دقیقه به محلول ذوب شامل محلول یک مولار ساکارز از محیط پایه (37 درجه سانتی گراد) انتقال و سپس برای 3 دقیقه به محیط رقیق­سازی حاوی ساکارز 5/0 مولارشست و شو داده شدند. در پایان پس از شست و شوی بلاستوسیستها در محیط پایه به مدت 10 دقیقه، رویانها در محیط کشت  KSOM(Synthetic oviductal medium, enriched with potassium: KSOM medium)(15) بهمراه سدیم پیروات، آلبومین سرم گاوی، فاکتور ­رشد اپیدرمی (E-4127, Sigma) و جنتامایسین (L0011-010, Bio- West) در انکوباتور 37 درجه سانتی گراد ، 5 درصد CO2 و رطوبت 95 درصد نگه داشته شدند.

استخراج  RNAو ساخت cDNA: استخراج RNA از بلاستوسیستهای تمامی تیمارها­ (شاهد، انجماد و سمیت مواد سرما محافظ) با استفاده از کیت RNaesy Plus Micro Kit® (74034, Qiagen) صورت پذیرفت. برای واکنش رونویسی معکوس،RNA  استخراج شده هر گروه به همراه توالی شش­تایی تصادفی (J208, Bioneer)  به ترکیب واکنش در کیت (K-2101, Bioneer) اضافه شد. محلول واکنش در 15 درجه سانتی گراد برای مدت 3 دقیقه و متعاقبا در 60 درجه سانتی گراد برای یک ساعت انکوبه شد.

طراحی پرایمر: پرایمر­های رفت و برگشت ژنهای Oct4، Nanog و β2m (Beta-2-Microglobulin) با استفاده از برنامه­های Gene Runner و Primer BLAST مطابق جدول 1 طراحی و تأیید گشتند. در طراحی پرایمر سعی بر آن شد که فاکتور­هایی نظیر طول پرایمر، طول قطعه حاصل از تکثیر، درصد بازهای آلی سیتوزین و گوانین و نیز وجود توالیهای تکراری، پالیندرومی وانتهای سنجاق سری مورد توجه قرار گیرد.

 

 

جدول 1- مشخصات پرایمر­های طراحی شده برای ژنهای Oct4، Nanog و β2m

ژن

پرایمر

توالی'3 به '5

طول توالی

(nt)

دمای Tm

(Melting Temperature)

(C°)

طول محصول حاصل از تکثیر(nt)

Oct4 

پرایمر رفت

AGCATTGAGAACCGTGTGAGG

21

8/59

120

پرایمر برگشت

TCGAACCACATCCTTCTCTAGC

22

3/60

Nanog 

پرایمر رفت

GCCTCCAGCAGATGCAAGAA

20

4/59

154

پرایمر برگشت

GGTGCTGAGCCCTTCTGAAT

20

4/59

β2m 

پرایمر رفت

CCTGGTCTTTCTGGTGCTTGT

21

8/59

118

پرایمر برگشت

GCAGTTCAGTATGTTCGGCTTC

22

3/60

 


واکنش زنجیره­ای پلیمراز در زمان واقعی (Real time-PCR): پس از راه­اندازی تکثیر و اطمینان از مواد و شرایط با انجام روش PCR (Polymerase Chain Reaction)، بیان سه ژن Oct4،Nanog  و β2m با استفاده از کیت (25344, Intron) حاوی رنگ  SYBR Green Iاز طریق روش مقایسه­ای CT واکنش real time- PCR در دستگاه ترموسیکلر (Applied Bio Systems StepOne, USA) ارزیابی گردید. تعداد 40 سیکل تکثیر در دمای Annealing 55 درجه سانتی گراد صورت پذیرفت. این واکنش برای هر یک از تیمار­ها با 3 بار تکرار انجام شد.

طراحی آزمایشات: بلاستوسیستهای استحصال شده با کیفیت مناسب از لحاظ ظاهر انتخاب و به طور تصادفی به سه گروه تقسیم شدند. در گروه اول، فرآیند انجماد شیشه­ای و ذوب روی بلاستوسیستها انجام گردید. در گروه دوم، به منظور بررسی میزان سمیت CPAs، بلاستوسیستها در معرض محیطهای انجماد و ذوب بدون غوطه­وری در ازت مایع قرار گرفتند.

سپس بلاستوسیستهای تیمار شده در هر دو گروه از لحاظ نرخ زنده­مانی، خروج بلاستوسیست از زونا و میزان بیان ژنهای اختصاصی پرتوانی، Oct4 و Nanog با یکدیگر و گروه شاهد (گروه سوم) مقایسه گردیدند.

تجزیه و تحلیل داده­ها: با استفاده از تست  One-Way ANOVAو به دنبال آن تست Duncan، آنالیز داده­های سلولی و مولکولی صورت پذیرفت و تفاوتها در 05/0P< معنی­دار در­نظر گرفته شدند. برای این منظور از نرم­افزار آماری SPSS, ver. 16.0  استفاده گردید.

نتایج

بخش سلولی: در مجموع تعداد 740 عدد بلاستوسیست موش مورد بررسی قرار گرفت. در این میان رویانهایی که دارای ICM بزرگ با تعداد سلولهای زیاد و نیز فاقد نشانی از شکل غیر نرمال، آسیب غشایی، آسیب اتصالات سلولی و تکه­تکه شدن یا انحطاط سیتوپلاسم بودند، از لحاظ مورفولوژیکی طبیعی تلقی شدند. نرخ زنده­مانی بلاستوسیستها با بررسی احیای حفره بلاستوسل در 3 ساعت پس از انجام تیمار­ها ارزیابی گردید. برای رسیدن به اطلاعات بیشتری از زنده­مانی بلاستوسیست­های احیاء نشده در این مدت، این رویانها در درون انکوباتور با درجه حرارت 37 درجه سانتی گراد، رطوبت 97 درصد و CO2 به میزان 5 درصد کشت داده شدند و 12 ساعت بعد مجددا مورد ارزیابی قرار گرفتند.

بر اساس نتایج به دست آمده در جدول 2، نرخ زنده­مانی و خروج بلاستوسیستها از زونا پس از انجام انجماد نسبت به گروه­ شاهد به طور معنی­داری کاهش یافتند (81/5±43/94 درصد در مقابل 100 درصد برای نرخ زنده­مانی و 76/11±78/57 درصد در مقابل 80/5± 88/86 درصد برای نرخ خروج بلاستوسیست از زونا). این میزان در تیمار سمیت به ترتیب 69/1±97/94 درصد و  9/11± 35/61 درصد بود که هر دو با کاهش معنی­داری نسبت به گروه شاهد روبرو گردیدند. اما نکته قابل توجه اینکه، با وجود کمتر بودن نرخ زنده­مانی و خروج بلاستوسیستها از زونا در رویانهای منجمد- ذوب شده نسبت به تیمار سمیت، این اختلاف معنی­دار نمی­باشد.

 

 

جدول 2- اثر انجماد شیشه­ای و سمیت مواد سرما­محافظ بر کیفیت بلاستوسیستهای درون­تنی موش

گروه آزمایشی

تعداد بلاستوسیست

نرخ زنده­مانی (%)

میزان خروج بلاستوسیست از زونا (%)

شاهد

220

a 100%

a 80/5 ± 88/86%

انجماد شیشه­ای

198

b 81/5 ± 43/94%

b 76/11 ± 78/57%

سمیت مواد سرمامحافظ

220

b 69/1 ± 97/94%

b 9/11 ± 35/61%

داده­ها از ترکیب نمونه­های 5 تکرار بدست آمدند. a و b در هر ستون نسبت به هم تفاوت معنی­دار دارند (05/0P< در تست ANOVA وDuncan)


بخش مولکولی: مطابق نتایج به دست آمده در نمودار 1، در گروه انجمادی به ترتیب افزایش 703/1 و 538/2 برابری بیان در ژنهای Nanog و Oct4 مشاهده می­گردد و این میزان در تیمار سمیت نیز به ترتیب 241/2 و 317/1 می­باشد.

 

نمودار 1- تغییر بیان ژن Nanog و Oct4 پس از انجماد شیشه­ای و اثر­کرد مواد سرما­محافظ در بلاستوسیست­ موش

 

داده­ها حاصل از 3 تکرار real time- PCR می­باشند.a، b و  cنسبت به هم تفاوت معنی­دار دارند (05/0P< در تست ANOVA و Duncan)


بحث

نتایج اولیه حاصل از انتقال رویان در مراحل مختلف تکامل رویانی، بعد از فرآیند انجماد و ذوب بیانگر نرخ پایین­ترحاملگی در انتقال رویان­ مرحله­ی بلاستوسیست نسبت به مراحل قبلی می­باشد که به نوعی با نتایج به دست آمده در این مطالعه همسو است. در سال 1996،  Vanderzwalmenو همکارانش نرخ موفقیت حاملگی را از انتقال بلاستوسیستهای رشد یافته منجمد و ذوب شده، 8 درصد و در مراحل مرولا و بلاستوسیست اولیه به ترتیب 29 و 25 درصد گزارش نمودند (33). این مقادیر در سال­های بعد بواسطه بهینه شدن تکنیک انجماد، افزایش یافت به گونه­ای که در سال 2002 همین محقق میزان حاملگی ناشی از انتقال رویان ذوب شده بلاستوسیست را 14 درصد گزارش نمود. این در حالی است که همچنان این میزان کمتر از بلاستوسیست اولیه (27 درصد) و مرولا (28 درصد) می­باشد (32). علاوه بر نرخ زنده­مانی، میزان خروج از زونا نیز در بلاستوسیستهای منجمد و ذوب شده کاهش چشمگیری می­یابد که می­تواند منجر به کاهش در میزان حاملگی گردد. نتایج حاصل از این طرح نیز نشان دهنده کاهش معنی­داری در نرخ زنده­مانی (به ترتیب 81/5 ± 43/94 درصد در مقابل 100 درصد) و خروج بلاستوسیست از زونا (به ترتیب 76/11 ± 78/57 درصد در مقابل 80/5 ± 88/86 درصد) در بلاستوسیستهای منجمد و ذوب شده می­باشند. همچنین در آزمایش دیگری که توسط Mukaida در سال 2006 صورت گرفت، نرخ زنده­مانی بلاستوسیست­های رشد یافته (86 درصد) و در حال خروج از زونا (82 درصد) پس از انجماد شیشه­ای به طور معنی­داری کمتر از مراحل قبل (97 درصد) گزارش گردید (24). در طی روند تکامل رویان در این تحقیق پیش از لانه­گزینی هرچه به مراحل انتهایی نزدیک­تر می­شویم، انتظار می­رود با توجه به افزایش در تعداد و نسبت سطح به حجم بلاستومر­ها، انجماد با موفقیت بیشتری صورت پذیرد. این روند تا مرحله 8 سلولی مشاهده می­شود اما در مرولا به علت تغییر در ساختار اتصالی و تراکم بلاستومر­ها، امکان تبادل CPAs با درون سلول کاهش می­یابد. در این حالت میزان آب درون سلولی به میزان بالایی باقی مانده و در نتیجه کاهش نرخ زنده­مانی رویان بعد از ذوب رخ خواهد داد.

در انجماد بلاستوسیست نیز به علت افزایش در تعداد و نسبت سطح به حجم سلولها، انتظار به تبادل آسان­تر CPAs و در نتیجه افزایش شانس زنده­مانی رویانهای ذوب شده می­رود (16)؛ اما بر خلاف انتظار، کاهش معنی­دار کیفیت رویان در این مرحله مشاهده می­گردد. دلیل این امر را می­توان در تغییر ساختار همراه با تشکیل و گسترش حفره بلاستوسل مملو از مایع تا حجم تقریبی دو سوم کل رویان جست­و­جو نمود (32). حضور حفره مملو از مایع می­تواند از یک سو به عنوان یک سد، مانع دسترسی CPAs به سلول­های درونی رویان گردد و از سویی دیگر، احتمال تشکیل کریستال­های یخ را در حین فرآیند انجماد و ذوب افزایش بخشد. برای غلبه بر این مشکل می­بایست غلظت CPAs و یا زمان مجاور­سازی با نمونه را افزایش داد که هر دو روش منجر به بالا رفتن غلظت CPAs از آستانه تحمل سمیت سلول می­گردند و متعاقباً مرگ رویان را به دنبال خواهند داشت.

راهکاری که برای کاهش میزان سمیت CPAs پیشنهاد گردید، ترکیب چند ماده سرما ­محافظ است به طوری که با وجود غلظت بالای مجموع مواد سرما محافظ، غلظت هر کدام به تنهایی زیر آستانه سمیت سلولی باشد (1). به طور مثال در برخی از روش کار­های انجماد شیشه­ای، از ترکیب EG و DMSO استفاده شده است که نتیجه آن، رسیدن به غلظت مناسب از CPAs برای ممانعت از تشکیل کریستالهای یخ و در عین حال، کاهش سمیت هر کدام از مواد سرما محافظ بود که نوع و غلظت CPAs بسته به گونه و مراحل مختلف رویانی می­تواند متفاوت باشد (25). در تحقیق حاضر نیز از ترکیب EG،DMSO  و سوکروز به عنوان CPAs استفاده گردید که در سال 2005 توسط Kuwayama و Vajta معرفی شد. به منظور ارزیابی سمیت ترکیب و غلظت CPAs استفاده شده، مطالعه جداگانه­ای از نرخ زنده­مانی و خروج بلاستوسیست از زونا در تیمار سمیت نسبت به گروه انجماد صورت پذیرفت که تفاوت معنی­داری در نتایج مشاهده نگردید (به ترتیب 69/1 ± 97/94 درصد در مقابل81/5 ± 43/94 درصد و 9/11 ± 35/61 درصد در مقابل 76/11 ± 78/57 درصد). 

برای کسب بهترین نرخ انجماد، علاوه بر نوع و غلظت مناسب CPAs، روش انجماد و حامل مناسب نیز از اهمیت بالایی برخوردار است. مطابق گزارشات موجود، انجماد شیشه­ای به عنوان یک روش کارآمد برای نگهداری رویان شناخته می­شود. برای نمونه، در سال 2005 گزارشی از مقایسه دو تکنیک انجماد آهسته و شیشه­ای توسط Kuwayama منتشر شد. در این تحقیق نرخ زنده­مانی بلاستوسیستهای انسانی منجمد و ذوب شده در دو تکنیک انجماد آهسته و شیشه­ای، به ترتیب 84 و 90 درصد بود که این، کارآیی بهتر انجماد شیشه­ای نسبت به آهسته را نشان می­دهد.

در طراحی و ساخت حاملهای انجماد نیز همواره شرایطی مورد توجه قرار می­گیرد که امکان تماس مستقیم رویان با کمترین حجم محلول انجماد با منبع سرما فراهم گردد. از جمله این حاملها می­توان به Open Pulled Straw، Hemi-straw،Electron Microscopy Grids ، Cryoloop و  Cryotopاشاره نمود (26 و 34). در مقایسه­ای که بین حاملهای مختلف صورت گرفت، نرخ زنده­مانی بالایی از بلاستوسیست در گونه­های مختلف پس از انجماد شیشه­ای با استفاده از Cryotop مشاهده گردید (13). بنابراین به نظر می­رسد که Cryotop ازحاملهای سیستم باز می­تواند یک حامل مناسب برای فرآیند انجماد شیشه­ای بلاستوسیست باشد (11).

یکی از دغدغه­های اصلی انجماد، تولیدرویانهایی باکیفیت خوب و بدون کاهش قابلیت رشد بعد از ذوب است. اما استرس ایجاد شده به واسطه شوک دمایی و تشکیل کریستالهای یخ باعث تغییرات جدی کروموزومی، مورفولوژیکی و بیوشیمیایی در رویان می­گردد. این تغییرات می­توانند باعث ایجاد پلی پلوئیدی، اختلالات اپی­ژنتیکی و نیز تغییر در الگوی بیان ژنی قبل از لانه­گزینی گردند که اکثریت این ژنها در رشد و تکوین جنین نقش دارند (29).

بنابراین علاوه بر بررسیهای سلولی تأثیرات انجماد بلاستوسیست به واسطه تشکیل کریستال یخ و سمیت مواد سرما محافظ مورد استفاده، ارزیابی مولکولی نیز می­تواند به درک بهتر اثرات این تکنیک کمک نماید. با توجه به تغییرات ناگهانی شرایط محیطی و حرارتی در طی انجماد که می­تواند به عنوان یک شوک بر رویان اثر­گذار باشد، کاهش بیان ژنهای فعال و مؤثر در رشد و تکامل در این مرحله انتظار می­رود اما بر خلاف آن، افزایش بیان ژنها در نتایج این تحقیق حاصل شده است.

در تحقیقات مختلف نشان داده شده است که کاهش در تعداد سلولهای  ICMدر رویان گاو (9)، آسیب به DNA در بلاستوسیست موش (17) و قطعه قطعه شدن DNA در هسته بلاستوسیست خوک (6) می­تواند از عوارض انجماد رویان باشد (39). در رابطه با تغییر بیان ژن نیز، Sudano و همکارانش در سال 2012 نشان دادند که انجماد شیشه­ای رویان، بیان ژنهای در­گیر در آپوپتوز، شوک حرارتی، تمایز سلولها و تشکیل جفت را تغییر می­دهد که این امر می­تواند بر قابلیت زنده­مانی پس از انجماد تأثیر­گذار باشد. موافق با نتایج به دست آمده در این تحقیق از جهت افزایش بیان ژن در رویانهای منجمد و ذوب شده،XUE-Ming Zhao  وهمکارانش در 2012 به کاهش سطح متیلاسیون پروموتر ژنهای پرتوانی بلاستوسیست از جمله ژنهای Oct4 (از 85 درصد به 5/62 درصد) و Nanog (از 5/77 درصد به 55 درصد) در بلاستوسیستهای منجمد و ذوب شده موش اشاره نمودند و نتیجه این کاهش متیلاسیون را افزایش معنی­دار بیان ژنهای Oct4 و Nanog بیان کردند (39). در سال 2011، Milroy نیز در تحقیق خود کاهش سطح متیلاسیون پروموتور ژنهای Oct4 و  Sox2(20) موشی را گزارش نمود؛ اما نتایج آزمایشات وی افزایش بیان در ژن Sox2 را نشان نداد. همچنین در این آزمایش بر خلاف نظر XUE-Ming Zhao، تفاوت معنی­داری در متیلاسیون پروموترژن Nanog در زایگوتهای منجمد و ذوب شده موش مشاهده نگردید.

به گفته Gao، الگوی بیانی سه ژن Oct4، Nanog و Sox2 در بلاستوسیست خوک مستقیماً در ارتباط با متیلاسیون نمی­باشد (8) و این احتمال وجود دارد که سطح بیان این ژنها توسط اصلاحات هیستونی تنظیم گردند(5 و 35). تفاوت در نتایج تحقیقات فوق می­تواند به دلیل نوع گونه (خوک در مقابل موش)، اندازه ناحیه پروموتر و تفاوت در مرحله رویانی باشد (39). همچنین تحقیقی به منظور بررسی پروفایل ژنی رویانهای 8 سلولی منجمد شده موش توسط Stergiou در سال 2004 صورت گرفت که در آن، افزایش بیان در گروههای ژنی آپوپتوز، ژنهای مربوط به استرس و متابولیسم مشاهده گردید. به گزارش این محقق، این افزایش بیان می­تواند به منظور سنتز مولکولهای مقاوم به سرما برای جبران کاهش دما در انجماد باشد (31). در سال 1987،Hanyside  کاهش تعداد کل سلولهای بلاستوسیست (115 در مقابل 5/126) و رده ICM و همچنین کاهش در نسبت سلولهای ICM به TE را پس از انجماد 8 سلولی موش مشاهده کرد. ایشان و برخی محققین دیگر دلایل احتمالی این کاهش را آپوپتوز سلولهای  ICM(10)، تسهیم با تأخیر و اختصاصیت نا­بجای سلول­های ICM و  TE(21) دانستند. در جهت رد این نظریه، Ray در سال 1995 بیان کرد که تسهیم با تأخیر نمی­تواند تنها دلیل کاهش تعداد سلولهای ICM و نسبت ICM به TE باشد زیرا در نهایت، تسهیم با اندکی تأخیر رخ داده و تأثیری بر تعداد سلولها نخواهد داشت. اما انجماد می­تواند با تأثیر بر جای گیری نادرست بلاستومر­ها در جایگاه صحیح خود، باعث اختصاصیت نابجای سلولهای ICM و TE و یا تأخیر در آن گردد (4).

در نهایت این گونه می­توان ­نتیجه­گیری کرد که در پی اختصاصیت نا­بجای سلولهای ICM و TE و نیز آپوپتوز سلولهای ICM و به موجب آن تغییر در تعداد بلاستومر­ها، رده­زایی بلاستوسیست به طور صحیح انجام نشده و از این طریق میزان بیان ژنهای بیان شونده در هر رده سلولی دچار تغییر می­گردد. از جهتی دیگر، متیلاسیون پروموتر ژنها و اصلاحات هیستونی نیز می­توانند بیان ژنها را تحت تأثیر قرار دهند. بنابراین مطالعات بیشتری برای بررسی عوامل فوق جهت درک بهتر علل و چگونگی تغییرات بیان ژن پس از فرآیند منجمد و ذوب نیاز است.

تشکر و قدردانی

این تحقیق در قالب طرح پژوهشی به شناسه 444 و با حمایت مالی پژوهشگاه ملی مهندسی ژنتیک و زیست­فناوری صورت پذیرفته است. نگارندگان، مراتب تشکر و قدردانی خود را از همکاری صمیمانه آقایان دکتر مهدی شمس­آرا، دکتر هادی حجاریان، احسان هاشمی و دکتر آیدین رحیم ­طایفه اعلام می­نماید.

1- Ali, J. and J.N. Shelton, Successful vitrification of day-6 sheep embryos. Journal of Reproduction and Fertility, 1993. 99(1): p. 65-70.

2- Arav, A., et al., New trendsin gamete's cryopreservation. Molecular and cellular endocrinology, 2002. 187(1): p. 77-81.

3- Chang, M.C., Fertilization of Rabbit Ova in vitro. Nature, 1959. 184(4684): p. 466-467.

4- Chatzimeletiou, K., et al., Cytoskeletal analysis of human blastocysts by confocal laser scanning microscopy following vitrification. Human Reproduction, 2012. 27(1): p. 106-113.

5- Fauque, P., et al., Assisted reproductive technology affects developmental kinetics, H19 imprinting control region methylation and H19 gene expression in individual mouse embryos. BMC developmental biology, 2007. 7(1): p. 116.

6- Fabian, D., et al., Ultrastructure and cell death of in vivo derived and vitrified porcine blastocysts. Molecular reproduction and development, 2005. 70(2): 155-165.

7- Fathi, R., M.R. Valojerdi, and P.E. Yazdi, Investigating the Effect of Laser Assisted Hatching on the Development and Quality of Vitrified-Warmed 4-Cell Stage Mouse Embryos. Yakhteh Medical Journal, 2008. 10(2): p. 121-128.

8- Gao, Y., et al., Epigenetic regulation of gene expression in porcine epiblast, hypoblast, trophectoderm and epiblast-derived neural progenitor cells. Epigenetics, 2011. 6(9): p. 1149-1161.

9- Gomez, E., et al., Vitrification of bovine blastocysts produced in vitro inflicts selective damage to the inner cell mass. Reproduction in domestic animals, 2009. 44(2): p. 194-199.

10- Handyside, A.H. and S. Hunter, Cell division and death in the mouse blastocyst before implantation. Roux's archives of developmental biology, 1986. 195(8): p. 519-526.

11- Hiroshi, I., H. Shinichi, and Y. Masanori, In vitro and in vivo viability of human blastocysts collapsed by laser pulse or osmotic shock prior to vitrification. Journal of Assisted Reproduction and Genetics, 2011. 28(4): p. 355-361.

12- Kasai, M., Vitrification: Refined Strategy for the Cryopreservation of Mammalian Embryos. Journal of Mammalian Ova Research, 1997. 14(1): p. 17-28.

13- Kuwayama, M., et al., Comparison of open and closed methods for vitrification of human embryosand the elimination of potential contamination. Reproductive BioMedicine Online, 2005. 11(5): p. 608-614.

14- Kuwayama, M., et al., Highly efficient vitrification method for cryopreservation of human oocytes. Reproductive BioMedicine Online, 2005. 11(3): p. 300-308.

15- Lawitts, J.A. and J.D. Biggers, Culture of preimplantation embryos. Methods in enzymology, 1992. 225: p. 153-164.

16- Leibo, S., Cryobiology: preservation of mammalian embryos, in Genetic engineering of animals1986, Springer. p. 251-272.

17- Li, L., et al., Comparison of DNA apoptosis in mouse and human blastocysts after vitrification and slow freezing. Molecular reproduction and development, 2012. 79(3): p. 229-236.

18- Loutradi, K.E., et al., Cryopreservation of human embryos by vitrification or slow freezing: a systematic review and meta-analysis. Fertility and sterility, 2008. 90(1): p. 186-193.

19- Luyet, B.J., The vitrification of organic colloids and of protoplasm. Biodynamica, 1937. 1(29): p. 1-14.

20- Milroy, C., et al., Differential methylation of pluripotency gene promoters in in vitro matured and vitrified, in vivo-matured mouse oocytes. Fertility and sterility, 2011. 95(6): p. 2094-2099.

21- Mi Ra, S., et al., In vitro development and gene expression of frozen-thawed 8-cell stage mouse embryos following slow freezing or vitrification. Clinical and Experimental Reproductive Medicine, 2011. 38(4).

22- Mitsui, K., et al., TheHomeoprotein Nanog Is Required for Maintenance of Pluripotency in Mouse Epiblast and ES Cells. Cell, 2003. 113(5): p. 631-642.

23- Mukaida, T. and C. Oka, Vitrification of oocytes, embryos and blastocysts. Best Practice & Research Clinical Obstetrics & Gynaecology, 2012. 26(6): p. 789-803.

24- Mukaida, T., et al., Artificial shrinkage of blastocoeles using either a micro-needle or a laser pulse prior to the cooling steps of vitrification improves survival rate and pregnancy outcome of vitrified human blastocysts. Human Reproduction, 2006. 21(12): 3246-3252.

25- Mukaida, T., et al., Successful birth after transfer of vitrified human blastocysts with use of a cryoloop containerlesstechnique. Fertility and sterility, 2001. 76(3): p. 618-620.

26- Mukaida, T., et al., Vitrification of human blastocysts using cryoloops: clinical outcome of 223 cycles*. Human Reproduction, 2003. 18(2): p. 384-391.

27- Quinn, P., C. Barros, and D.G. Whittingham, Preservation of hamster oocytes to assay the fertilizing capacity of human spermatozoa. Journal of Reproduction and Fertility, 1982. 66(1): p. 161-168.

28- Rall, W.F. and G.M. Fahy, Ice-free cryopreservation of mouse embryos at -196 (deg)C by vitrification. Nature, 1985. 313(6003): p. 573-575.

29- Saragusty, J. and A. Arav, Current progress in oocyte and embryo cryopreservation by slow freezing and vitrification. Reproduction, 2011. 141(1): p. 1-19.

30- Silva, J., et al., Nanog is the gateway to the pluripotent ground state. Cell, 2009. 138(4): p. 722-737.

31- Stergiou, L. and M. Hengartner, Death and more: DNA damage response pathways in the nematode C. elegans. Cell Death & Differentiation, 2004. 11(1): p. 21-28.

32- Vanderzwalmen, P., et al., Births after vitrification at morula and blastocyst stages: effect of artificial reduction of the blastocoelic cavity before vitrification. Human Reproduction, 2002. 17(3): p. 744-751.

33- Vanderzwalmen, P., et al., Two essential steps for a successful intracytoplasmic sperm injection: injection of immobilized spermatozoa after rupture of the oolema. Human Reproduction, 11(3): 540-547.

34- Vanderzwalmen, P., et al., Vitrification of human blastocysts with the Hemi‐Straw carrier: application of assisted hatching after thawing. Human Reproduction, 2003. 18(7): p. 1504-1511.

35- Wang, Z., L. Xu, and F. He, Embryo vitrification affects the methylation of the H19/Igf2 differentially methylated domain and the expression of H19 and Igf2. Fertility and sterility, 2010. 93(8): p. 2729-2733.

36- Whittingham, D., Survival of mouse embryos after freezing and thawing. 1971.

37- Yamanaka, Y., etal., Cell and molecular regulation of the mouse blastocyst. Developmental Dynamics, 2006. 235(9): p. 2301-2314.

38- Yamanaka, Y., et al., Cell and molecular regulation of the mouse blastocyst. Dev Dyn, 2006. 235(9): p. 2301-14.

39- Zhao, X.M., et al., Effect of vitrification on promoter methylation and the expression of pluripotency and differentiation genes in mouse blastocysts. Molecular reproduction and development, 2012. 79(7): p. 445-450.