نوع مقاله: مقاله پژوهشی

نویسندگان

1 مدیر گروه زیست شناسی سلولی و مولکولی-دانشگاه مازندران

2 دانشگاه مازندران، گروه پژوهشی نانو و بیوتکنولوژی

3 دانشگاه مازندران، گروه شیمی معدنی

چکیده

سیانید ترکیبی خطرناک برای موجودات زنده است. ترکیبات سیانیدی به طور گسترده در صنایع مختلف مورد استفاده قرار گرفته و موجب آلودگی محیط زیست می‌شود. تجزیه زیستی بهترین روش برای از بین بردن سیانید در پساب صنایع و معادن می‌باشد. جداسازی باکتری‌های تجزیه کننده سیانید در شرایط قلیایی از خاک آلوده و مطالعه توانایی آن‌ها در تجزیه سیانید، از اهداف این پژوهش بود. نمونه‌های خاک آلوده به سیانید در محیط کشت معدنی حداقل و حاوی 3/4 میلی مولار پتاسیم سیانید، غنی‌سازی شد. سپس تجزیه سیانید و تولید آمونیاک در محیط رشد به روش پیکریک اسید و نسلر، سنجیده شد. هم‌چنین توانایی باکتری جداشده در استفاده از ترکیبات مختلف سیانیدی بررسی شد. با روش غنی سازی متوالی، جدایه باکتریایی با توانایی تجزیه سیانید در شرایط قلیایی، جداسازی شد و MF3 نامگذاری شد. جدایه MF3 توانست سیانید موجود در محیط رشد را در شرایط قلیایی و پس از 36 ساعت تجزیه کند. نتایج نشان داد که کاهش غلظت سیانید با افزایش غلظت آمونیاک در محیط رشد و نیز رشد MF3، ارتباط مستقیم داشت. هم‌چنین باکتری جداشده، توانایی استفاده از ترکیبات مختلف سیانیدی به عنوان تنها منبع کربن و نیتروژن را نشان داد. بررسی توالی ژن 16S rDNA و رسم درخت فیلوژنی نشان داد که جدایه MF3 دارای 99 درصد هومولوژی با باسیلوس سافِنسیس (Bacillus safensis) بود. نتایج تحقیق حاضر نشان داد که جدایه MF3، گزینه مناسبی برای تجزیه زیستی سیانید در شرایط قلیایی است. این باکتری می‌تواند برای حذف سیانید از پساب صنایع و مکان‌های آلوده، معرفی شود.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Isolation and characterization of cyanide degrading Bacillus sp. MF3 under alkaline condition

نویسندگان [English]

  • Mojtaba Mohseni 1
  • sajad firoozyar 2
  • om leila nazari 3

1 University of Mazandaran

2 University of Mazandaran

چکیده [English]

Cyanide is a hazardous compound for all living things. Cyanide compounds are commonly used in various industries and cause environmental pollution. Biodegradation is the best method for cyanide elimination in mines and industrial wastewater. The aims of this study were isolation cyanide degrading bacteria in alkaline condition from contaminated soil and investigation of their ability for cyanide degradation. Contaminated soil samples were enriched in minimal salts medium supplemented with 4.3 mM potassium cyanide. Then cyanide degradation and ammonium production was determined in growth medium using picric acid and Nessler’s regent methods. In addition the ability of the isolated bacterium to utilize different cyanide compounds was investigated. A bacterium with ability to degrade cyanide in alkaline condition was isolated and named MF3. The isolate MF3 degraded cyanide in growth medium under alkaline condition after 36 hours. The results showed that there was a direct relation between decreasing of cyanide concentration, increasing of ammonia concentration and growth of MF3. In addition, the isolated bacterium was demonstrated the ability to utilize different cyanide compounds as a sole carbon and nitrogen source. The 16S rDNA sequencing and phylogenetic analysis was exhibited that MF3 strain was similar to Bacillus safensis with 99% homology. The results of current study were demonstrated that MF3 is a suitable candidate for degradation of cyanide in alkaline condition. This isolate could introduce for elimination of cyanide from industrial wastewater and contaminated sites.

کلیدواژه‌ها [English]

  • Biodegradation
  • Cyanide
  • Bacillus
  • Wastewater

جداسازی و بررسی ویژگیهای باسیلوس MF3 تجزیه کننده سیانید در شرایط قلیایی

مجتبی محسنی1،2*، سجاد فیروزیار1 و ام‌لیلا نظری3

1 بابلسر، دانشگاه مازندران، گروه زیست شناسی سلولی و مولکولی

2 بابلسر، دانشگاه مازندران، گروه پژوهشی نانو و بیوتکنولوژی

3 بابلسر، دانشگاه مازندران، گروه شیمی معدنی

تاریخ دریافت: 22/8/93                تاریخ پذیرش: 8/12/93 

چکیده 

سیانید ترکیبی خطرناک برای موجودات زنده است. ترکیبات سیانیدی به طور گسترده در صنایع مختلف مورد استفاده قرار گرفته و موجب آلودگی محیط زیست می‌شود. تجزیه زیستی بهترین روش برای از بین بردن سیانید در پساب صنایع و معادن می‌باشد. جداسازی باکتریهای تجزیه کننده سیانید در شرایط قلیایی از خاک آلوده و مطالعه توانایی آنها در تجزیه سیانید، از اهداف این پژوهش بود. نمونه‌های خاک آلوده به سیانید در محیط کشت معدنی حداقل و حاوی 3/4 میلی مولار پتاسیم سیانید، غنی‌سازی شد. سپس تجزیه سیانید و تولید آمونیاک در محیط رشد به روش پیکریک اسید و نسلر، سنجیده شد. همچنین توانایی باکتری جداشده در استفاده از ترکیبات مختلف سیانیدی بررسی شد. با روش غنی سازی متوالی، جدایه باکتریایی با توانایی تجزیه سیانید در شرایط قلیایی، جداسازی شد و MF3 نام گذاری گردید. جدایه MF3  توانست سیانید موجود در محیط رشد را در شرایط قلیایی و پس از 36 ساعت تجزیه کند. نتایج نشان داد که کاهش غلظت سیانید با افزایش غلظت آمونیاک در محیط رشد و نیز رشد MF3، ارتباط مستقیم داشت. همچنین باکتری جداشده، توانایی استفاده از ترکیبات مختلف سیانیدی به عنوان تنها منبع کربن و نیتروژن را نشان داد. بررسی توالی ژن 16S rDNA و رسم درخت فیلوژنی نشان داد که جدایه MF3 دارای 99 درصد هومولوژی با باسیلوس سافِنسیس (Bacillus safensis) بود. نتایج تحقیق حاضر نشان داد که جدایه MF3، گزینه مناسبی برای تجزیه زیستی سیانید در شرایط قلیایی است. این باکتری می‌تواند برای حذف سیانید از پساب صنایع و مکانهای آلوده، معرفی شود.

واژه های کلیدی: تجزیه زیستی، سیانید، باسیلوس، پساب

* نویسنده مسئول، تلفن: 01135302497 پست الکترونیکی: M.Mohseni@umz.ac.ir

مقدمه

 

فعالیت صنعتی انسان باعث آلودگی گسترده محیط زیست به ترکیبات آلی و غیرآلی سیانیدی شده است. (17). سیانید به شدت برای موجودات زنده سمی است و از طریق غیر فعال کردن سیستم تنفسی، سمیت خود را اعمال می‌کند. سیانید با اتصال محکم به سیتوکرم  cاکسیداز که جزئی از سیستم انتقال الکترون است، از انتقال الکترون در زنجیره تنفسی جلوگیری می‌کند (20). در حضور سیانید، تنفس بی‌هوازی رخ می‌دهد که منجر به اسیدوز لاکتیکی می‌شود. دُز کشندگی پتاسیم سیانید و سدیم سیانید 300-200 میلی‌گرم و سیانید هیدروژن 50 میلی‌گرم اعلام شده است (15). ترکیبات سیانید به طور گسترده در صنایع شیمیایی مختلف از جمله استخراج فلزات، آبکاری، تبخیر زغال سنگ و تولید الیاف مصنوعی مورد استفاده قرار می‌گیرد (9). بر اساس مطالعات اخیر آژانس مواد سمی و بیماریهای رجیستری آمریکا، سالانه 843000 تُن هیدروژن سیانید برای صنایع استحصال فلزات از معادن، فولاد و آبکاری فلزات استفاده می‌شود. سالانه 10 میلیون تن نمک جاده‌ای در آمریکا استفاده می‌شود که 700 تُن آن سیانید آهن است (5). این ترکیبات در اثر بارندگی وارد آبهای سطحی می‌شود و به این ترتیب حجم قابل توجهی از پساب حاوی سیانید صنایع مختلف وارد طبیعت شده و با آلوده کردن خاک و آبهای زیرزمینی موجب صدمات جبران ‌ناپذیری به محیط زیست می‌شود. روشهای مختلفی برای حذف سیانید از پساب آلوده مورد استفاده قرار می‌گیرد. از جمله می‌توان به حذف شیمیایی با استفاده از هیدروژن پراکسید (2 و 30)، سولفور دی ‌اکسید (8) و کلریزاسیون قلیایی (30) اشاره کرد. این روشها دارای معایبی از جمله تولید محصولات جانبی نامطلوب و هزینه زیاد است. امروزه استفاده از روشهای زیستی برای حذف آلاینده‌های سیانیدی مورد توجه قرارگرفته است. روشهای زیستی بسیار کارا، مناسب و کم هزینه است (5). سیانید در شرایط خنثی و اسیدی تبدیل به گاز هیدروژن سیانید می‌شود ولی در شرایط قلیایی پایدار است (21). اگر چه میکرو‌ارگانیسمهایی که توانایی سمیت‌زدایی و تجزیه سیانید آزاد و یا کمپلکسهای سیانید- فلز را در شرایط خنثی یا اسیدی دارند، تاکنون شناسایی شدند. اما تحقیقات اندکی برای جداسازی باکتریهای تجزیه کننده سیانید در شرایط قلیایی انجام شده است (11). در این تحقیق جدایه باکتریایی با توانایی مصرف سیانید، از خاک آلوده معدن طلای آق‌دره واقع در آذربایجان غربی، جداسازی شد. به منظور معرفی این باکتری برای استفاده در حذف سیانید در پساب آلوده، توانایی این جدایه در تجزیه سیانید به عنوان تنها منبع کربن و نیتروژن (در شرایط قلیایی) مورد بررسی قرار گرفت.

مواد و روشها 

غنی‌سازی و جداسازی باکتریهای تجزیه‌کننده سیانید: نمونه برداری از خاک آلوده به سیانید کارخانه استحصال طلای معدن آق‌دره تکاب انجام شد. از نظر موقعیت جغرافیایی این کارخانه در طول جغرافیایی 46 درجه و 58 دقیقه و 30 ثانیه، عرض جغرافیایی 36 درجه و 29 دقیقه و 29 ثانیه در منطقه ای به ارتقاع 1926 متر از سطح دریا قرار دارد. نمونه‌های خاک در لوله‌های فالکون استریل جمع آوری و در دمای 4 درجه سانتی‌گراد به آزمایشگاه انتقال داده شد. پنج گرم خاک در 45 میلی‌لیتر محلول نرمال سالین حل شد. برای غنی‌سازی باکتریهای تجزیه‌کننده سیانید، حجم یک میلی لیتر نمونه خاک حل شده به محیط کشت معدنی حداقل (حاوی 6 ‌گرم Na2PO4، 3 ‌گرم KH2PO4، 1 ‌گرمNaCl ، 01/0‌گرمCaCl2 ، 5/0‌گرم MgSO4، 04/0‌ گرم FeSO4, 7H2O و 0015/0 گرم MnSO4 در یک لیتر آب مقطر) و 3/4 میلی‌مولار پتاسیم سیانید به عنوان تنها منبع کربن و انرژی، افزوده شد (13). اسیدیته محیط کشت توسط محلول سدیم هیدروکسید 3 مولار، به 9 تنظیم شد. ارلنها در دمای 30 درجه سانتی‌گراد و 180 دور در دقیقه، به مدت 48 ساعت گرمخانه‌گذاری شدند. پس از سه کشت متوالی در محیط کشت معدنی حداقل، غنی‌سازی میکروارگانیسمهای تجزیه کننده سیانید انجام شد. برای جداسازی باکتریهای تجزیه کننده سیانید، کشت غنی‌شده به محیط کشت معدنی حداقل سفت حاوی 5/1 درصد آگار و 5/0میلی‌مولار پتاسیم سیانید، تلقیح شد. پلیتها در دمای 30 درجه سانتی‌گراد به مدت 48 ساعت گرمخانه‌گذاری شد (13).

سنجش تجزیه زیستی سیانید و رشد باکتری: برای بررسی تجزیه سیانید موجود در محیط کشت معدنی حداقل (حاوی 3/4 میلی‌مولار سیانید) در شرایط قلیایی (9pH=)، از روش رنگ سنجی پیکریک اسید استفاده شد (14). در حضور سیانید آزاد، پیکریک اسید به رنگهای ایزوپروپیک اسید تبدیل می‌شود و شدت رنگ رابطه مستقیم با غلظت سیانید آزاد دارد. حجم 1/0 میلی‌لیتر محیط کشت به محلول 5/0 درصد (w/v) پیکریک اسید و 25/0 مولار سدیم کربنات اضافه شد و به مدت پنج دقیقه در حمام آب گرم 99 درجه سانتی‌گراد گذاشته شد. سپس با افزودن آب دیونیزه به حجم یک میلی‌لیتر رسانده شد و به مدت 30 دقیقه در دمای اتاق، خنک شد. سپس جذب نوری محلول در طول موج 520 نانومتر با دستگاه اسپکتروفتومتر، خوانده شد.

برای اندازه گیری غلظت آمونیاک موجود در محیط رشد از روش نسلر (کیت سنجش آمونیاک، شرکت کاریزآب) استفاده شد. مطابق دستورالعمل شرکت سازنده معرف نسلر 1 و 2 به یک میلی لیتر محیط رشد اضافه شد. پس از 10 دقیقه، تغییر رنگ توسط اسپکتروفتومتر در طول موج 420 نانومتر اندازگیری شد. منحنی استاندارد نیز با آمونیوم کلراید رسم شد (26).

توانایی تجزیه ترکیبات مختلف سیانیدی: توانایی جدایه باکتریایی در استفاده از ترکیبات سیانیددار آلی و غیر آلی به عنوان تنها منبع کربن و نیتروژن، مورد بررسی قرار گرفت. پس از شستشو جدایه با بافر فسفات استریل، حجم 5/0 میلی‌لیتر سوسپانسیون باکتریایی (108 باکتری در میلی‌لیتر) به 50 میلی‌لیتر محیط کشت معدنی حداقل حاوی دو درصد (w/v) ترکیبات مختلف سیانیدی شامل استونیتریل، KSCN، NaCN و K4Fe(CN)6 تلقیح شد و در دمای 30 درجه سانتی‌گراد و 180 دور در دقیقه، به مدت 48 ساعت گرمخانه‌گذاری شد. توانایی استفاده جدایه باکتریایی از ترکیبات مختلف به وسیله سنجش رشد توسط اسپکتروفتومتر در 600 نانومتر اندازه‌گیری شد (1). تمام آزمایشها با سه بار تکرار انجام شد.

توانایی رشد در pH های مختلف: توانایی استفاده از سیانید به عنوان تنها منبع کربن و نیتروژن توسط جدایه MF3 در شرایط اسیدی و قلیایی مورد بررسی قرار گرفت. به این منظور رشد جدایه در محدودهpH  بین 10-5 در محیط کشت معدنی معدنی حداقل حاوی 3/4 میلی‌مولار سیانید بررسی شد. برای تنظیم اسیدیته محیط کشت از محلول دو مولار کلریدریک اسید و یا محلول 2/0 مولار سدیم هیدروکسید استفاده شد. پس از تلقیح باکتری، ارلنها در دمای 30 درجه سانتی‌گراد و 180 دور در دقیقه، به مدت 48-24 ساعت گرمخانه‌گذاری شد (21).

توانایی استفاده از ترکیبات پایدار سیانید در محیط قلیایی: توانایی استفاده از ترکیبات پایدار سیانید (CNSAD) به عنوان تنها منبع کربن و نیتروژن توسط جدایه MF3 در شرایط قلیایی مورد بررسی قرار گرفت. پس از 48 ساعت رشد باکتری در محیط کشت معدنی حداقل حاوی 3/4 میلی‌مولار سیانید، حجم 100 میکرولیتر کشت باکتریایی (108 باکتری در میلی‌لیتر) به 100 میلی لیتر محیط کشت معدنی حداقل حاوی 10 میلی‌مولار K4Fe(CN)6 در  pH حدود 10 تلقیح شد. ارلنها در دمای 30 درجه سانتی‌گراد و 180 دور در دقیقه، گرمخانه گذاری شد. توانایی جدایه باکتریایی در استفاده از ترکیبات پایدار سیانید به عنوان تنها منبع کربن و نیتروژن پس از 36 ساعت گرمخانه‌گذاری، با اندازه‌گیری رشد باکتری توسط اسپکتروفتومتر در 600 نانومتر بررسی شد (21).

استخراج نوکلئیک اسید و واکنش زنجیره‌ای پلیمراز ژن 16S rDNA : برای بررسی مولکولی باکتری‌ جدا شده، DNA ژنومی به کمک روش استاندارد فنل کلروفرم، استخراج شد (25). واکنش زنجیره‌ای پلیمراز ژن 16S rDNA برای باکتری تجزیه کننده سیانید، مطابق برنامه‌ زیر انجام شد (24). همچنین مشخصات الیگونوکلئوتید پرایمرهای استفاده شده برای تکثیر ژن 16S rDNA شامل پرایمرهای عمومی PA و PH در جدول 1 نشان داده شد (24). دمای واسرشت اولیه 95 درجه سانتی‌گراد و به مدت 5 دقیقه بود. سپس 35 چرخه شامل یک دقیقه دمای 95 درجه سانتی‌گراد، یک دقیقه دمای 50 درجه سانتی‌گراد و یک و نیم دقیقه دمای 72 درجه سانتی‌گراد انجام شد. در نهایت برای تکمیل سنتز DNA، دمای واکنش به مدت 5 دقیقه در 72 درجه سانتی‌گراد نگه داشته شد. درستی انجام واکنش زنجیره‌ای پلیمراز ژن‌ 16S rDNA ، با الکتروفورز ژل آگاروز 8/0 درصد رنگ آمیزی شده با اتیدیوم برماید تأیید شد.

تخلیص محصول واکنش زنجیره‌ای پلیمراز به کمک کیت تخلیص GeneJet (Thermo Scientific, Lithuania)، انجام شد. سپس توالی ژن 16S rDNA توسط شرکت GATC Biotech (آلمان) تعیین شد. نتایج توالی نوکلئوتیدها به کمک نرم افزار Chromas Lite (نسخه 01/2) مجدداً بررسی شد. شباهت توالی نوکلئوتیدهای ژن 16S rDNA جدایه MF3 تجزیه کننده سیانید با سایر توالیهای ثبت شده در پایگاههای اطلاعاتی NCBI و EzTaxon تعیین شد (18). تحلیل فیلوژنی باکتری ‌تجزیه کننده سیانید با سویه‌های نزدیک به آن‌ به کمک نرم‌افزار ClustalX (نسخه 2) انجام شد. درخت فیلوژنی توالی ژن 16S rDNA جدایه با توالی حاصل از جستجو در پایگاههای اطلاعاتی  NCBIو EzTaxon به کمک نرم‌افزارMEGA  (نسخه5) و با الگوریتم Maximum likelihood و joining Neighbour رسم گردید. بررسی اعتبار شاخه با الگوریتم bootstrap analysis و با 1000 بار نمونه گیری صورت گرفت.

 

 

جدول 1- مشخصات پرایمرهای عمومی ژن 16S rDNA استفاده شده در واکنش زنجیره‌ای پلیمراز (F، پرایمر رفت؛ R، پرایمر برگشت) (24).

پرایمر

توالی (5′→3′)

درصد GC

دمای اتصال پرایمر (درجه سانتی‌گراد)

محصول PCR (جفت نوکلئوتید)

PA-F

AGAGTTTGATCCTGGCTCAG

50

50

1500

PH-R

AAGGAGGTGATCCAGCCGCA

60

 


شماره دستیابی ژنی توالی 16S rDNA جدایه MF3 در بانک اطلاعاتی: توالی ژن 16S rDNA جدایه MF3 به دست آمده در این پژوهش به بانک ژنی NCBI ارسال شد و به شماره دستیابی ژنی KF679677 ثبت شد.

نتایج

در این تحقیق برای جداسازی باکتریهای تجزیه کننده سیانید، غنی سازی خاک آلوده معدن طلا در محیط کشت معدنی حداقل با شرایط قلیایی (9=pH) انجام شد. تعداد سه جدایه با توانایی استفاده از سیانید به عنوان تنها منبع کربن و نیتروژن، جداسازی و خالص سازی شد. پس از بررسی اولیه جدایه‌ها از نظر توانایی در تجزیه سیانید، جدایه به نام MF3 برای ادامه مطالعه انتخاب شد.

نتایج سنجش تجزیه سیانید نشان داد که جدایه MF3 توانست در شرایط قلیایی، سیانید موجود در محیط کشت (3/4 میلی مولار سیانید) را به عنوان تنها منبع کربن، نیتروژن و انرژی، پس از 36 ساعت به صورت کامل تجزیه کند. نتایج در شکل 1 نشان می‌دهد که بیش از 50 درصد از سیانید موجود در محیط رشد، در 12 ساعت ابتدای رشد باکتری تجزیه شد.

همچنین همزمان با رشد جدایه MF3، آمونیاک به عنوان محصول اصلی تجزیه سیانید در محیط کشت تولید شد. نتایج سنجش تولید آمونیاک نیز نشان داد که بیشترین تولید آمونیاک در 18 ساعت ابتدای رشد باکتری، ایجاد شد (شکل 2). این نتایج نشان داد که افزایش تولید آمونیاک، ارتباط مستقیم با تجزیه سیانید دارد.

توانایی جدایه در استفاده از ترکیبات مختلف سیانیدی به عنوان تنها منبع کربن، نیتروژن و انرژی مورد بررسی قرار گرفت. نتایج نشان داد جدایهMF3  توانایی رشد در محیط کشت معدنی حداقل و حاوی ترکیبات مختلف سیانیدی را دارا است (جدول 2). این نتایج نشان داد که از میان ترکیبات مختلف، بیشترین رشد هنگام استفاده از ترکیب پتاسیم فروسیانید به عنوان تنها منبع کربن و نیتروژن مشاهده شد. نتایج در شکل 3 نشان داد جدایه MF3 توانایی استفاده از ترکیبات پایدار سیانیدی نظیر پتاسیم فروسیانید را در شرایط قلیایی دارا است.

برای بررسی تأثیر اسیدیته محیط رشد بر تجزیه سیانید، رشد جدایه MF3 در محیط کشت معدنی حاوی سیانید و در pH  مختلف بررسی شد. نتایج نشان داد که این جدایه توانایی رشد و استفاده از سیانید در محدوده وسیع pH اسیدی و بازی را  دارا  می‌باشد  (شکل4).  بیشترین  رشد

باکتری در 8=pH مشاهده شد.

جدول 2- توانایی جدایه MF3 در استفاده از ترکیبات مختلف سیانیدی پس از 48 ساعت گرمخانه‌گذاری (مقدار جذب نوری محیط کشت در زمان تلقیح جدایه، بین 005/0-001/0 بود).

رشد جدایه (OD600 nm)

ترکیبات سیانیدی

034/0

Acetonitrile

063/0

KSCN

015/0

NaCN

071/0

K3[Fe(CN)6]

 

 

شکل 1- منحنی رشد ((∎ و تجزیه سیانید  (●)توسط جدایه MF3 در محیط کشت معدنی حداقل حاوی سیانید در دمای 30 درجه سانتی‌گراد و 180 دور در دقیقه. داده‌ها نمایانگر میانگین نتایج سه بار تکرار ± انحراف معیار اند (3=n).

 

 

شکل 2- ارتباط مستقیم تولید آمونیاک(▲)  و تجزیه سیانید (●) توسط جدایه MF3 در محیط کشت معدنی حداقل حاوی سیانید در دمای 30 درجه سانتی‌گراد و180 دور در دقیقه.

 

شکل3- توانایی استفاده از ترکیب پایدار پتاسیم فروسیانید در شرایط قلیایی توسط جدایه MF3 در دمای 30 درجه سانتی‌گراد و 180 دور در دقیقه. داده‌ها نمایانگر میانگین نتایج سه بار تکرار ± انحراف معیار اند (3=n). 

 

شکل4- رشد جدایه MF3 در محدوده pH بین 10- 5 در محیط کشت معدنی حاوی سیانید پس از 24 ساعت گرمخانه گذاری در دمای 30 درجه سانتی‌گراد و180 دور در دقیقه.

 

 

همچنین شناسایی مولکولی جدایه با استفاده از توالی ژن 16S rDNA بررسی شد. به این منظور واکنش زنجیره‌ای پلیمراز ژن 16S rDNA انجام شد. پس از تعیین توالی، هومولوژی ژن 16S rDNA باکتری‌ تجزیه کننده سیانید با سایر توالیهای ثبت شده در بانک اطلاعاتی EzTaxon ، تعیین شد. نتایج BLAST نشان داد که جدایه MF3 دارای 9/99 درصد هومولوژی با باسیلوس سافِنسیس (Bacillus safensis) بود (شکل 5). توالی ‌ژن 16S rDNA باکتریهای مشابه و جدایه MF3 به کمک نرم‌افزار ClustalX، همردیف ‌سازی شد و درخت فیلوژنی آن به روش Neighbor joining و به کمک نرم افزار Mega5 رسم شد. موقعیت فیلوژنی جدایه MF3 با باسیلوس سافِنسیس در شکل 4 نشان داده شد.

بحث

امروزه حذف زیستی سیانید به عنوان یک روش مقرون به صرفه و سازگار با محیط زیست در مقایسه با روشهای متداول شیمیایی، مورد توجه قرار گرفته است. باکتریهایی همانند باسیلوس استئاروترموفیلوس (Bacillus stearothermophilus) (3)، سودوموناس فلورسانس (Pseudomonas fluorescen) (7 و 16)، آگروباکتریوم رادیوباکتر (Agrobacterium radiobacter) (19)، بورخولدریا سپاسیا (Burkholderia cepacia)(1)، کلبسیلا اکسیتوکا (Klebsiella oxytoca)(16)، باسیلوس پومیلوس (Bacillus pumilus)  (23)، سودوموناس دیمینوتا (Pseudomonas diminuta)(19) و قارچهایی مانند تریکودرما (Trichoderma sp.) (10 و 12)، فوزاریوم اکسیسپوریوم (Fusarium oxysporum) (4، 6، 28 و 29) و ریزوپوس اوریزیا (Rhizopus oryzae)(27) با توانایی حذف زیستی سیانید، شناسایی و مورد بررسی قرار گرفته‌اند.

 

 

 

 Staphylococcus pseudintermedius (FJ858975)

 Staphylococcus pseudintermedius (GU057859)

 Staphylococcus pseudintermedius (GU057858)

 Macrococcus caseolyticus (KC212014)

 Macrococcus caseolyticus (KC212014)

 Macrococcus caseolyticus (KC212014)

 MF3 (KF679677)

 Bacillus safensis (LN650578)

 Bacillus amyloliquefaciens (FJ859694)

 Bacillus atrophaeus (AB021181)

 Lysinibacillus sphaericus (EU855791)

 Lysinibacillus sphaericus (EU855791)

 Serratia nematodiphila (EU914257)

100

100

100

100

100

100

85

71

0.05

 

 

 

 

 

 

 

 

 


شکل 5- دندوگرام توالی ژن 16S rDNA باکتری تجزیه کننده سیانید MF3 که به جنس باسیلوس قرابت نشان داد. اعداد ذکر شده در محل انشعاب نشانگر درصد نمونه‌گیری bootstrap از 1000 نمونه است. باکتری Serratia nematodiphila به عنوان out group قرار داده شد.

 

 

در شرایط اسیدی و خنثی، سیانید به صورت گاز هیدروژن سیانید تبخیر می‌شود ولی در شرایط قلیایی بسیار پایدار است (21). لذا جداسازی میکروارگانیسم ها با توانایی حذف سیانید در شرایط قلیایی، می‌تواند برای حذف این آلاینده از محیط زیست، بسیار مؤثر باشد. در مطالعه حاضر جدایه باکتریایی به نام MF3‌ با توانایی تجزیه سیانید در شرایط قلیایی، جداسازی شد. برای سنجش تجزیه سیانید، از روش اندازه‌گیری پیکریک اسید استفاده شد. این روش برای سنجش سیانید آزاد و کمپلکسهای ضعیف سیانید- فلز مورد استفاده قرار می‌گیرد (14). نتایج مطالعه حاضر نشان داد که جدایه MF3 توانست سیانید موجود در محیط کشت (3/4 میلی‌مولار) را کاملاً تجزیه کند و بیشترین تجزیه در 12 ساعت ابتدای رشد باکتری انجام شد. در مطالعه مشابهی که در سال 2013 توسط مانیام و همکارانش انجام شد تجزیه زیستی سیانید توسط باکتری رودوکوکوس (Rhodococcus) بررسی شد. این باکتری تنها با افزودن منبع کربن و نیتروژن اضافی به محیط رشد، قادر به تجزیه 1/0 میلی مولار سیانید بود (22). قارچ فوزاریوم سولانی (Fusarium solani) توانایی حذف 50 میلی‌گرم بر لیتر سیانید در مدت 96 ساعت و در شرایط قلیایی را داشت (4). همچنین سودوموناس فلورسانس قادر به استفاده از یونهای سیانید آهن به عنوان تنها منبع نیتروژن بود و 79 درصد سیانید موجود در محیط رشد را در 5pH=  حذف کند (16). اوزیل و همکاران توانایی حذف سیانید توسط بازدیومیستها را بررسی کردند و موفق به شناسایی جدایه‌هایی شدند که توانایی حذف 72-70 درصد سیانید محیط رشد را در مدت 48 ساعت دارا بودند (26). در سال 2004 جدایه‌ای به نام سودوموناس سودوآلکالیژنز (Pseudomonas pseudoalcaligenes) از پساب صنایع جواهر سازی اسپانیا جداسازی شد. این باکتری توانایی استفاده از سیانید به عنوان تنها منبع نیتروژن را در شرایط قلیایی دارا بود اما این جدایه به استات، به عنوان منبع کربن اضافی نیاز داشت (21). همچنین در سال 1999 اَدجئی و همکاران تجزیه سیانید توسط بورخولدریا سپاسیا را در شرایط قلیایی مورد مطالعه قرار دادند. این باکتری توانایی استفاده از سیانید به عنوان تنها منبع نیتروژن را داشت اما نیازمند به گلوکز به عنوان منبع کربن بود (1). نتایج مطالعه حاضر نشان داد که جدایه MF3 بدون نیاز به منبع کربن و نیتروژن اضافی، توانایی حذف سیانید در شرایط قلیایی را دارا است. با توجه به اینکه کمبود منبع کربن در محیط رشد، یک عامل بازدارنده در حذف زیستی سیانید خاکهای آلوده به شمار می‌آید (5)، نتایج حاضر حاکی از برتری جدایه MF3 نسبت به دیگر جدایه‌های شناسایی شده می‌باشد. همچنین توانایی رشد باکتری جداشده روی طیف مختلفی از ترکیبات سیانیدی به عنوان تنها منبع کربن و نیتروژن بررسی شد. نتایج نشان داد جدایه MF3 توانایی رشد روی ترکیبات مختلف سیانیدی را داراست. مطالعات روی میکروارگانیسمهایی نظیر باسیلوس پلادیوس (Bacillus pallidusبورخولدریا سپاسیا (1) و اسینتوباکتر (Acinetobacter) (13) نشان داد که این باکتریها توانایی استفاده از ترکیبات مختلف سیانیدی (ترکیبات سیانید-فلز و نیتریل) به عنوان تنها منبع کربن و نیتروژن را دارا هستند.

نتایج پژوهش حاضر نیز نشان داد جدایه MF3  توانایی استفاده از ترکیبات پایدار سیانید را در شرایط قلیایی دارا است. ترکیبات سیانید فلز را بر اساس انحلال آنها در pH اسیدی به دو دسته حل شونده با اسید ضعیف CNWAD)) و حل شونده با اسید قوی ((CNSAD تقسیم کرد. ترکیب سیانید با فلزاتی نظیر آهن و کبالت در دسته CNSAD قرار می‌گیرند. این ترکیبات بسیار پایدارند و گروه سیانیدی خود را در pH بسیار اسیدی آزاد می‌کنند. علاوه بر این کمپلکسهای آهن- سیانید در pH قلیایی کمپلکس‌های آبی تشکیل می‌دهند که باعث افزایش تحرک آنها می‌شود. بنابراین حذف ترکیبات پایدار سیانید در شرایط قلیایی از اهمیت زیادی برخوردار است. روشهای فیزیکی و شیمیایی تجزیه سیانید باعث کاهش غلظت سیانید آزاد می‌شود ولی نمی‌تواند به کمپلکسهای پایدار تأثیر بگذارد به همین دلیل برای حذف این ترکیبات از تجزیه زیستی استفاده می‌شود (5). باکتریهایی نظیر سودوموناس فلورسانس (9)، سودوموناس سودوآلکالیژنز و فوزاریوم سولانی (4) شناسایی شده‌اند که توانایی حذف ترکیبات پایدار سیانیدیCNSAD  را دارا هستند ولی نیازمند منبع کربن یا نیتروژن خارجی هستند که باید به محیط رشد افزوده شود. در سال 1991 جدایه‌ای از اسینتوباکتر با توانایی استفاده از ترکیبات پایدار سیانیدی به عنوان تنها منبع کربن و نیتروژن، جداسازی شد ولی این عمل را در شرایط اسیدی انجام می‌داد (13). در این تحقیق برای اولین بار جدایه‌ای شناسایی شد که توانایی حذف CNSAD را در شرایط قلیایی داشت.

نتایج به دست آمده نشان داد جدایه MF3 قلیادوست است و بهترین  pHبرای رشد این جدایه، 8 است. بولخولدریا سپاسیا توانایی حذف سیانید در pH بین 8 تا 10 را دارد و بهترین pH برای حذف سیانید برای این باکتری 10 گزارش شده است (1). رودوکوکوس توانایی حذف سیانید در محدوده pH بین 6 تا 9 را دارا است و بهترین pH برای این باکتری 3/6 گزارش شده است (22). سودوموناس سودوآلکالوژنز توانایی تحمل pH 5/11 را نشان داد ولی حذف سیانید در pH بین 9 تا 10 انجام شد (21).

نتیجه گیری

سیانید ترکیب بسیار سمی است که با فعالیت صنعتی انسان، باعث آلودگی گسترده طبیعت به این آلاینده شده است. با جداسازی و شناسایی باکتریهای تجزیه کننده سیانید از خاک‌های آلوده و ایجاد شرایط بهینه تجزیه زیستی، می‌توان با صرف هزینه کمتر و نیز مشکلات زیست محیطی کمتر، پساب آلوده به این ترکیب سمی را پالایش کرد. نتایج نشان داد که باکتری جدا شده در این تحقیق توانست پس از 36 ساعت گرمخانه‌گذاری، سیانید موجود در محیط رشد را به صورت کامل حذف کند. همچنین این جدایه توانایی استفاده از ترکیبات مختلف سیانیدی به عنوان تنها منبع کربن و نیتروژن را دارا بود. علاوه بر این باکتری قلیایی دوست جداشده، توانایی استفاده از کمپلکسهای پایدار سیانید را در شرایط قلیایی داشت. نتایج این تحقیق نشان می‌دهد باکتری جدا شده از خاک معدن طلا، می‌تواند گزینه مناسبی برای حذف زیستی سیانید در شرایط قلیایی از پساب صنایع و مکانهای آلوده باشد.

1. Adjei, M.D. and Ohta, Y., 1999. Isolation and characterization of a cyanide-utilizing Burkholderia cepacia strain. World Journal of Microbiology and Biotechnology. 15(6): 699-704.

2. Akcil, A. and Mudder, T., 2003. Microbial destruction of cyanide wastes in gold mining. Process Review. Biotechnology Letters. 25(6): 445-450.

3. Atkinson, A., 1975. Bacterial cyanide detoxification. Biotechnology and Bioengineering. 17(3): 457-460.

4. Barclay, M., Tett, V.A. and Knowles, C.J., 1998. Metabolism and enzymology of cyanide/metallocyanide biodegradation by Fusarium solani under neutral and acidic conditions. Enzyme and Microbial Technology. 23(5): 321-330.

5. Baxter, J. and Cummings, S.P., 2006. The current and future applications of microorganism in the bioremediation of cyanide contamination. Antonie van Leeuwenhoek. 90(1): 1-17.

6. Campos, M.G., Pereira, P. and Roseiro, J.C., 2006. Packed-bed reactor for the integrated biodegradation of cyanide and formamide by immobilised Fusarium oxysporum CCMI 876 and Methylobacterium sp. RXM CCMI 908. Enzyme and Microbial Technology. 38(6): 848-854.

7. Dash, R.R., Balomajumder, C. and Kumar, A., 2008. Treatment of metal cyanide bearing wastewater by simultaneous adsorption and biodegradation (SAB). Journal of Hazardous Materials. 152(1): 387-396.

8. Demopoulos, G.P. and Cheng, T.C., 2004. A case study of CIP tails slurry treatment: comparison of cyanide recovery to cyanide destruction. European Journal of Mineral Processing and Environmental Protection. 4(1): 1-9.

9. Dursun, A.Y., Çalik, A. and Aksu, Z., 1999. Degradation of ferrous (II) cyanide complex ions by Pseudomonas fluorescens. Process Biochemistry.34(9): 901-908.

10. Ezzi, M.I. and Lynch, J.M., 2002. Cyanide catabolizing enzymes in Trichoderma spp. Enzyme and Microbial Technology. 31(7): 1042-1047.

11. Ezzi, M.I. and Lynch, J.M., 2005. Biodegradation of cyanide by Trichoderma spp. and Fusarium spp. Enzyme and Microbial Technology. 36(7): 849-854.

12. Ezzi, M.I., Pascual, J.A., Gould, B.J. and Lynch, J.M., 2003. Characterisation of the rhodanese enzyme in Trichoderma spp. Enzyme and Microbial Technology. 32(5): 629-634.

13. Finnegan, I., Toerien, S., Abbot, L., Smit F. and Raubenheimer, H.G., 1991. Identification and characterisation of an Acinetobacter sp. capable of assimilation of a range of cyano-metal complexes, free cyanide ions and simple organic nitriles. Applied Microbiology and Biotechnology. 36(1): 142-144.

14. Fisher, F.B. and Brown, J.S., 1952. Colorimetric determination of cyanide in stack gas and waste water. Analytical Chemistry. 24(9): 1440-1444.

15. Gibbons, T., 2005. International cyanide management code. Developments in Mineral Processing. 15:182-199.

16. Harris, R.E. and Knowles, C.J., 1983. The conversion of cyanide to ammonia by extracts of a strain of Pseudomonas fluorescens that utilizes cyanide as a source of nitrogen for growth. FEMS Microbiology Letters. 20(3): 337-341.

17. Jones, D.A., 1998. Why are so many food plants cyanogenic? Phytochemistry. 47(2): 155-162.

18. Kim, O.S., Cho, Y.J., Lee, K., Yoon, S.H., Kim, M., Na, H., et al., 2012. Introducing EzTaxon: a prokaryotic 16S rRNA gene sequence database with phylotypes that represent uncultured species. International Journal of Systematic and Evolutionary Microbiology. 62: 716-721.

19. Kowalska, M., Bodzek, M. and Bohdziewicz, J., 1998. Biodegradation of phenols and cyanides using membranes with immobilized microorganisms. Process Biochemistry. 33(2): 189-197.

20. Leavesley, H.B., Li, L., Prabhakaran, K., Borowitz, J.L. and Isom, G.E., 2008. Interaction of cyanide and nitric oxide with cytochrome c oxidase: implications for acute cyanide toxicity. Toxicological Sciences.101(1): 101-111.

21. Luque-Almagro, V.M., Huertas, M.J., Martinez-Luque, M., Moreno-Vivian, C., Roldan, M.D., Garcia-Gil, L.J., Castillo, F. and Blasco, R., 2005. Bacterial degradation of cyanide and its metal complexes under alkaline conditions. Applied and Environmental Microbiology. 71(2): 940-947.

22. Maniyam, M.N., Sjahrir, F., Ibrahim, A.L. and Cass, A.E., 2013. Biodegradation of cyanide by Rhodococcus UKMP-5M. Biologia. 68(2):177-185.

23. Meyers, P.R., Rawlings, D.E., Woods, D.R. and Lindsey, G.G., 1993. Isolation and characterization of a cyanide dihydratase from Bacillus pumilus C1. Journal of Bacteriology. 175(19): 6105-6112.

24. Mohseni, M., Abbaszadeh, J. and Nasrollahi-Omran, A., 2014. Radiation resistant of native Deinococcus spp. isolated from the Lout desert of Iran "the hottest place on Earth". International Journal of Environmental Science and Technology. 11(7): 1939-1946.

25. Mohseni, M., Khosravi, F., Mohadjerani, M. and Chaichi, M.J., 2014. Biosorption of lead and copper by heavy metal resistance bacterium using Fourier Transform Infrared Spectrophotometer (FT IR). Medical Laboratory Journal. 8(3): 30-39 [Persian].

26. Özel, Y.K., Gedikli, S., Aytar, P., Ünal, A., Yamaç, M., Çabuk, A. and Kolankaya, N., 2010. New fungal biomasses for cyanide biodegradation. Journal of Bioscience and Bioengineering. 110(4): 431-435.

27. Padmaja, G. and Balagopal, C., 1985. Cyanide degradation by Rhizopus oryzae. Canadian Journal of Microbiology. 31(8): 663-669.

28. Pereira, P.T. and Arrabaça, J.D., 1996. Amaral-Collaco MT. Isolation, selection and characterization of a cyanide-degrading fungus from an industrial effluent. International Biodeterioration and Biodegradation. 37(1): 45-52.

29. Pereira, P., Pires, A.S. and Roseiro, J.C., 1999. The effect of culture aging, cyanide concentration and induction time on formamide hydro-lyase activity of Fusarium oxysporum CCMI 876. Enzyme and Microbial Technology. 25(8): 736-744.

30. Young, C.A. and Jordan, T.S., 1995. Cyanide remediation: current and past technologies. In Conference Proceeding, Proceedings of the 10th Annual Conference on Hazardous Waste Research. Kansas State University: Manhattan, KS. p. 104-129.