نوع مقاله: مقاله پژوهشی

نویسندگان

دانشگاه آزاد اسلامی واحد نیشابور

چکیده

اگروباکتریوم رایزوژنز سبب ایجاد بیماری ریشه مویین در گیاهان می‌شود. ریشه‌های مویین تولید شده توسط آلودگی با این باکتری، با نرخ بالای رشد و ثبات ژنتیکی مشخص می‌شوند. ایجاد ریشه مویین ممکن است سبب تغییراتی در تولید ترکیبات ثانویه گیاه شود. ترکیبات فنلی (فلاونوئیدها، تانن ها و آنتوسیانین ها) از جمله متابولیت‌های هستند که جزء آنتی اکسیدان های طبیعی به شمار آمده و در گیاه تربچه به مقدار فراوان حضور دارند. در این مطالعه جهت ایجاد ریشه‌های مویین، تراریختی ریزنمونه های برگی گیاه تربچه با استفاده از دو سویه اگروباکتریوم رایزوژنز (A4 و GUS+) انجام شد. ریشه‌های مویین ایجاد شده با استفاده از آزمون PCR مورد تایید قرار گرفتند. همچنین میزان ترکیبات فنلی در ریشه‌های مویین مورد سنجش قرار گرفت. صحت تکثیر قطعات 780 جفت بازی برای ژن rolB و 320 جفت بازی برای ژن GUS در ریشه‌ها بیانگر تراریخت بودن آن‌ها بود. نتایج مقایسه میانگین‌ها نشان داد که میزان ترکیبات فنلی در ریشه‌های مویین به طور معنی داری نسبت به ریشه‌های عادی افزایش یافت. به نظر می‌رسد افزایش ترکیبات فنلی در ریشه‌های مویین نتیجه ورود T-DNA اگروباکتریوم رایزوژنز و برانگیختن پاسخ دفاعی گیاه باشد.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Production of phenolic compounds in hairy roots culture of Radish (Raphanus sativus L.)

نویسندگان [English]

  • saeed Beizaee
  • akbar safipour
  • fatemeh nematpour

چکیده [English]

Phenolic compounds contents in hairy roots of Radish (Raphanus sativus L.)
Abstract
Agrobacterium rhizogenes causes hairy root disease in plants. The hairy roots produced by A. rhizogenes infection are characterized by high growth rate and genetic stability. Hairy root induction cause changes in plant Secondary metabolites production. Phenolic compounds (Flavonoids, Tannins and Anthocyanins) are important antioxidants in radish. In this work, for induction of hairy roots, leaf explants transformed with two Arhizogenes strains (A4 and GUS+). Generated Hairy roots confirmed with PCR. Also, Phenolic compounds content in hairy roots was measured. Amplification of 780bp fragment for rolB and 320bp for GUS in transgenic roots confirmed the production of hairy roots. Difference of Phenolic compounds between transgenic and non-transgenic roots was significant. Our results indicate that the insertion of A. rhizogenes T-DNA in to the plant genome stimulate plant defense responses and increase the production of Phenolic compounds.
Keywords: Agrobacterium rhizogenes, transgenic, hairy root, Raphanus sativus

کلیدواژه‌ها [English]

  • Agrobacterium rhizogenes
  • transgenic
  • hairy root
  • Raphanus sativus

تولید ترکیبات فنلی درکشت ریشه‌های مویین گیاه تربچه (Raphanus sativus L.) 

سعید بیضائی، اکبر صفیپور افشار* و فاطمه سعیدنعمتپور

نیشابور، دانشگاه آزاد اسلامی، واحد نیشابور، گروه زیست شناسی

تاریخ دریافت: 20/2/93                تاریخ پذیرش: 26/12/93

چکیده

اگروباکتریوم رایزوژنز سبب ایجاد بیماری ریشه مویین در گیاهان می‌شود. ریشه‌های مویین تولید شده توسط آلودگی با این باکتری، با نرخ بالای رشد و ثبات ژنتیکی مشخص می‌شوند. ایجاد ریشه مویین ممکن است سبب تغییراتی در تولید ترکیبات ثانویه گیاه شود. ترکیبات فنلی (فلاونوئیدها، تاننها و آنتوسیانینها) از جمله متابولیتهای هستند که جزء آنتی اکسیدانهای طبیعی بشمار آمده و در گیاه تربچه به مقدار فراوان حضور دارند. در این مطالعه جهت ایجاد ریشه‌های مویین، تراریختی ریزنمونه های برگی گیاه تربچه با استفاده از دو سویه اگروباکتریوم رایزوژنز (15834(GUS), A4) انجام شد. ریشه‌های مویین ایجاد شده با استفاده از آزمون PCR مورد تأیید قرار گرفتند. همچنین میزان ترکیبات فنلی در ریشه‌های مویین مورد سنجش قرار گرفت. صحت تکثیر قطعات 780 جفت بازی برای ژن rolB و 320 جفت بازی برای ژن GUS در ریشه‌ها بیانگر تراریخت بودن آنها بود. نتایج مقایسه میانگینها نشان داد که میزان ترکیبات فنلی در ریشه‌های مویین به طور معنی داری نسبت به ریشه‌های عادی افزایش می یابد. به نظر می‌رسد افزایش ترکیبات فنلی در ریشه‌های مویین نتیجه ورود T-DNA اگروباکتریوم رایزوژنز و برانگیختن پاسخ دفاعی گیاه باشد.

واژه های کلیدی: اگروباکتریوم رایزوژنز، تراریخت، ریشه مویین، تربچه

* نویسنده مسئول، تلفن: 09151186887، پست الکترونیکی: asafshar4@gmail.com

مقدمه

 

گیاهان منابع بسیار مهم و ارزشمندی جهت بررسی و کشف ترکیبات جدید با اهمیت دارویی می­باشند. متابولیتهای ثانویه همانند داروها، افزودنیهای غذایی، رنگ دهنده­ها، طعم دهنده­ها، آفت کشها و... از نظر اقتصادی با اهمیت هستند. بزرگ‌ترین چالش موجود در زمینه تولید ترکیبات ثانویه این است که متابولیتهای ثانویه در مرحله خاصی تولید می­شوند و بعضی از ترکیبات هم چنانچه سلول تمایز نیابد سنتز نمی­شوند. بنابراین در برخی موارد کشت سلولهای گیاهی تمایز نیافته توان بیوسنتزی فرآورده­های ثانویه را از دست می­دهند. با توجه به نتایج به دست آمده از کشت بافتهای تمایز یافته بیشتر پژوهشها بر کشت ریشه­های مویین تأکید دارند (10). زیرا علاوه بر تولید بهینه متابولیتهای ثانویه می‌توان از کشت ریشه­های مویین در راستای حفظ ژرم پلاسم بهره جست و در این راستا می­توان با استفاده از عوامل محرک آنزیمهای کلیدی باعث افزایش بیوسنتز متابولیتهای ثانویه مورد نظر شد. از طرف دیگر حدود 60 درصد از گیاهان دارویی که در طب سنتی مورد استفاده قرار می­گرفتند، جهت فرآوری از ریشه­های آنها استفاده می­شود. پیشرفتهای اخیر در بیولوژی مولکولی، آنزیم شناسی و کشت بافت نشان می‌دهد که این روشها سیستمهای با ارزشی برای تولید ترکیبات ثانویه می‌باشند (11). اساس ایجاد ریشه­های مویین تلفیح گیاه با باکتری اگروباکتریوم رایزوژنز می‌باشد، این روش در دهه گذشته به عنوان یکی از روشهای تولید انبوه ترکیبات ثانویه معرفی و مورد توجه قرار گرفته است (25). فنوتیپ ریشه­های مویین با رشد سریع، انشعابات جانبی فراوان و ثبات ژنتیکی در محیط­های کشت فاقد هورمون مشخص می‌شود. تولید انبوه ترکیبات ثانویه همراه با رشد سریع در محیطهای کشت فاقد فیتوهورمونها و ثبات ژنتیکی سبب شده است تا ریشه­های مویین منابع با ارزشی برای مطالعه و تولید ترکیبات ثانویه شناخته شود (11 و 25).

ریشه مویین نوعی بیماری گیاهی است که مشخصه آن ایجاد یک توده درهم تنیده از ریشه­های مو مانند است. تعداد زیاد ریشه­های کوچک مو مانند ایجاد شده در نواحی آلوده شده گیاه توسط اگروباکتریوم رایزوژنز سبب استفاده از این اصطلاح گردید(7 و 14). ریشه مویین نوعی بیماری گیاهی است که توسط یک باکتری گرم منفی خاک زی به نام اگروباکتریوم رایزوژنز ایجاد می‌شود. زمانی که باکتری وارد گیاه می‌شود، تعدادی از ژنها از پلاسمید باکتری به گیاه منتقل شده و وارد ژنوم هسته‌ای گیاه میزبان می‌شود. حاصل این انتقال تولید ریشه مویین در نزدیکی جایگاه ورود باکتری است (26). سیستم ریشه­های مویین یک سیستم پایدار است که در محیط فاقد هورمون دارای قدرت تولید بالاست. سرعت رشد بالا، کاهش زمان کشت به نصف، نگهداری آسان و قابلیت سنتز ترکیبات شیمیایی، می‌تواند ریشه­های مویین را به یک منبع مناسب و ادامه داری جهت تولید متابولیتهای ثانویه تبدیل کند. ریشه­های مویین منبع در دسترسی جهت مواد دارویی، آرایشی و خوراکی هستند (18).

ترکیبات فنلی شامل گروه کثیری از متابولیتهای ثانوی است که بسیاری از ترکیبات حلقوی مثل ترکیبات فنلی، فلاونها، فلاونوئیدها، تاننها، لیگنینها و حتی اسیدهای آمینه حلقوی مانند تریپتوفان، تیروزین و پرولین را شامل می‌شوند. به طور کلی فنلها مجموعه‌ای از پلیمرهای محلول(تاننها) و منومرها (اسیدهای فنلی و فلاونوئیدها) هستند. واژه اسید فنلی معمولاً به مولکول‌های ساده مشتق از بنزوئیک یا سینامیک اسیدها اشاره می‌نماید. ترکیبات فنلی نسبت به ترپنوئید ها حلالیت بیشتری در آب دارند. بیوسنتز این ترکیبات از مسیر فنیل پروپانوئید و از فنیل آلانین صورت می‌گیرد. این همان مسیر بیوسنتز کومارینها، اسیدهای فنلی و لیگنینها می‌باشد. در صد عظیمی از ترکیبات فنلی منشأ فنیل آلانین دارند و برخی منشا تیروزین دارند. کلیدی‌ترین آنزیم این مسیر فنیل آلانین آمونیالیاز است (12).

تربچه (Raphanus Sativus L.) گیاهی یک ساله، به ارتفاع 40 سانتیمتر تا یک متر و دارای برگهایی با پهنک منقسم به قطعات نامنظم است. سطح برگ آن بر حسب نژادهای مختلف ممکن است کاملاً بی کرک و یا پوشیده از کرکهای خشن باشد. ریشه دارای گلوکوزیدی است که بر اثر تجزیه تحت اثر آنزیم مخصوص به اسانس و Raphanol تبدیل می‌گردد. دارای 86-93 درصد آب، مقدار کمی مواد قندی، مواد چرب، مواد ازته، اسید فسفریک و به مقدار جزیی از مواد نشاسته‌ای و ویتامینهای B و C است. برگ و ریشه تربچه برای درمان سرطان، عوامل ضد میکروبی و ضد ویروسی در سراسر جهان مورد استفاده قرار می‌گیرد. از این گونه به طور وسیعی برای درمان بیماریهای کبدی و تنفسی استفاده می‌شود. همچنین فعالیت آنتی بیوتیکی و آنتی میکروبیال عصاره ریشه این گیاه نیز گزارش شده است (7). با توجه به اینکه تاکنون در خصوص ترکیبات فنلی ریشه‌های مویین گیاه تربچه مطالعه‌ای صورت نگرفته است، در این تحقیق القاء ریشه‌های مویین در گیاه تربچه توسط اگروباکتریوم رایزوژنز و تأثیر T-DNA اگروباکتریوم رایزوژنز بر میزان تولید ترکیبات فنلی مورد مطالعه قرار گرفت.

مواد و روشها

بذور تربچه (شرکت Vita Sementi® Italian Seeds) با استفاده از محلول شوینده حاوی آب مقطر استریل به اضافه سدیم هیپوکلریت 5 درصد به مدت 10 دقیقه با تکان دادن و سپس توسط الکل 70 درصد به مدت 30 ثانیه استریل شدند. سپس 3 مرتبه شستشوی آنها با آب مقطر استریل انجام گرفت. بذور در محیط جوانه زنی حاوی محیط کشت MS با غلظت 50 درصد و فاقد هورمونهای گیاهی، کشت شدند بذور کشت شده، در قفسه نوری، با زمان نوردهی h 16 روشنایی و h 8 تاریکی در درجه حرارت 25 درجه سانتی گراد نگهداری شدند. پس از رشد بذور، از برگ گیاهان جهت تراریختی استفاده شد. برای تکثیر سویه‌های باکتریایی A4 و 15834(GUS) مقاوم به آنتی بیوتیک کانامایسین، از محیط LB استفاده گردید.

محیطهای هم کشتی و القاء ریشه مویین: طرز تهیه این محیطهای کشت در جدول 1 مشخص شده است.

جدول 1- اجزاء تشکیل دهنده محیطهای هم کشتی و القاء ریشه

ترکیبات 

محیط القاء ریشه‌های مویین

محیط هم کشتی

نمک‌های MS

1X 

1X

آگار (گرم در لیتر)

7

7

ساکارز

3%

3%

سفوتاکسیم (میلی‌گرم در لیتر)

200

-

pH

7/5 

5/5

تراریختی گیاه: از اگروباکتریوم های A4 و 15834(GUS) کشت شبانه در محیط LB مایع در دمای 28 درجه سانتی گراد بر روی شیکر rpm 180 تهیه شد. سپس محیط LB با سانتریفیوژ در rpm 3000 و دمای محیط به مدت 15 دقیقه حذف گردید. رسوب سلولهای باکتری در محیط مخصوص آلوده سازی اگروباکتریوم که شامل نمکهای MS و استوسرینگون به همراه با 5 درصد گلوکز (pH 5.2) بود، به صورت سوسپانسیون درآمد (به نسبت 2 : 1). این سوسپانسیون به مدت 3 ساعت تکان داده شد و جهت تراریختی استفاده گردید.

برای انجام تراریختی قطعات برگی به مدت 3 دقیقه در سوسپانسیون سلولی باکتری غوطه‌ور شدند. سپس رطوبت اضافی قطعات برگی توسط کاغذ صافی استریل گرفته شده و در نهایت به محیط هم کشتی برده شدند. مرحله هم کشتی به مدت 2 روز در دمای 25 درجه سانتی گراد سپری شد. پس از این مرحله، ریزنمونه ها به طور مستقیم یا پس از شستشو با آنتی بیوتیک سفوتاکسیم با غلظت mg/L 500 به محیط القاء ریشه منتقل شدند و هر دو هفته یک‌بار به محیط جدید مشابه واکشت شدند تا ریشه‌های مویین تمایز یابند.

استخراج DNA و آنالیز PCR: استخراج DNA به روش (Murray and Thampson, 1980) انجام گــردید (16). پس از استخراج DNA، کمیت و کیفیت آن با روش اسپکتروفتومتری (T80 PG Instruments, UK) و الکتروفورز  (Mini-Protean Bio-Rad, USA)مورد بررسی قرار گرفت. طراحی آغازگر با در نظر گرفتن نکات استاندارد در طراحی آغازگر از جمله طول آغازگر، دمای اتصال،G+C%، ایجاد دایمر، تولید لوپ یا حلقه در درون هر یک از آغازگرها و DG مناسب بررسی گردید. سنتز آغازگر توسط شرکت تکاپو زیست ایران انجام شد. خصوصیات آغازگرهای مورد استفاده جهت تکثیر ژنهای rolB و GUS در جدول 2 نشان داده شده است.

برای تأیید انتقال ژن و تراریختی، محصولات PCR به روی ژل آگارز بارگذاری و الکتروفورز انجام گردید و  تمامی ژلهای آگارز با استفاده از دستگاه (Uvitech Gel documentation) عکس برداری شدند. جدول 3 شرایط دمایی و زمانی PCR را نشان می‌دهد.

سنجش ترکیبات فنلی: جهت اندازه گیری ترکیبات فنلی تام از معرف Folin-Ciocalteau استفاده شد. 5/0 میلی لیتر از این معرف به 5/0 میلی لیتر عصاره استخراج شده گیاهی و استانداردهای گالیگ اسید اضافه و سپس به مخلوط حاصل 4 میلی لیتر سدیم کربنات 1 مولار اضافه شد. پس از 15 دقیقه نگهداری در دمای محیط، جذب نمونه‌ها در طول موج750 نانومتر به کمک اسپکتروفتومتر خوانده شد (19). نتایج به دست آمده به صورت میلی گرم معادل گالیگ اسید بر گرم وزن خشک گزارش شد.

 

جدول 2- خصوصیات آغازگرهای مورد استفاده جهت تکثیر ژنهای rolB و GUS

طول قطعة حاصل

طول نوکلئوتید

دمای Annealing 

توالی 5'-3'

نام آغازگر

780 bp 

28

54 °C

ATGGATCCCAAATTGCTATTCCCCACGA

rolB Forward primer

30

54 °C

TTAGGCTTCTTTCATTCGGTTTACTGCAGC

rolB Reverse primer

320 bp 

21

62 °C

GGTGGGAAAGCGCGTTACAAG

GUS Forward primer

20

62 °C

TGGATTCCGGCATAGTTAAA

GUS Reverse primer

 

جدول 3- شرایط دمایی و زمانی PCR

فاز 

دما 

زمان 

تعداد دورها 

Denaturation 

94 درجه سانتی‌گراد

5 دقیقه

1

Denaturation 

94 درجه سانتی‌گراد

30 ثانیه

30

Annealing 

54-62 درجه سانتی‌گراد

1 دقیقه

Extension 

72 درجه سانتی‌گراد

1 دقیقه

Final Extension 

72 درجه سانتی‌گراد

10 دقیقه

1

 

 

اندازه گیری وزن‌تر ریشه‌ها: به منظور تعیین وزن‌تر ریشه‌ها، نمونه‌ها با ترازو با دقت 001/0 گرم (SartoriusTE14S) وزن شدند و وزن بر اساس گرم بر ریز‌ نمونه گزارش گردید.

آنالیز آماری داده‏ها: در این تحقیق میزان ترکیبات فنلی و بیومس ریشه‌های مویین (تراریخت) و ریشه‌های طبیعی (گروه کنترل) که هر گروه شامل 10 تکرار بود، مقایسه شد. بدین منظور از نرم‏افزار آماری SPSS و آزمون Mann-Whitney استفاده ‌شد.

نتایج

ریشه‌های مویین: در ریزنمونه های شستشو داده شده با آنتی بیوتیک سفوتاکسیم با غلظت mg/L 500 و انتقال یافته به  محیط فاقد هورمون بعد از دو هفته ریشه‌های مویین ظاهر شدند (شکل1).

الکتروفورز محصول PCR بر روی ژل آگارز: صحت انتقال ژن توسط بارگذاری محصولات PCR به روی ژل آگارز و الکتروفورز مورد تأیید قرار گرفت. طول قطعه تکثیر شده برای ژن rolB، 780 جفت باز و برای GUS،320 جفت باز بود. از مارکر اندازهFermentas GeneRuler1kb DNA Ladder استفاده گردید (شکل 2).

 

شکل 1- ریزنمونه های تراریخت شده توسط اگروباکتریوم: A: ریزنمونه شاهد. B و C ریشه‌های مویین تولید شده

ترکیبات فنلی: نتیجه آزمون Mann-Whitney حاکی از آن است که تفاوت معنی‌داری بین مقدار ترکیبات فنلی ریشه های طبیعی (گروه کنترل) و ریشه‌های مویین (گروه تراریخت) وجود دارد و میزان ترکیبات فنلی در ریشه‌های مویین بیشتر است (شکل 3).

وزن‌تر: نتیجه آزمون Mann-Whitney حاکی از آن است که تفاوت معنی‌داری بین وزن تر ریشه های طبیعی (گروه کنترل) و ریشه‌های مویین (گروه تراریخت) وجود دارد و وزن تر ریشه‌های مویین بیشتر از ریشه‌های عادی می‌باشد (شکل 4).

بحث

تأیید مولکولی: باکتری اگروباکتریوم رایزوژنز با انتقال قطعه T-DNA حاوی ژن ریشه زایی به سلولهای گیاهی آنها را تراریخت می‌نماید (3 ، 5 و 6).

 

 

 









 

B

 


A

 


 

 

 

 

 

 

 


شکل 2 – نتایج PCR ژنومی ژنهای rolB و GUS در ریشه‌های مویین

rolB  -A: 1. کنترل منفی (نمونه فاقد DNA) 2. کنترل مثبت (نمونه با DNA پلاسمیدی) 3، 4، 6 و 7. ریشه های تراریخت 5. (GeneRuler 1 kb)Ladder

GUS  -B: 1و2. ریشه های تراریخت 3. کنترل مثبت (نمونه با DNA پلاسمیدی)  4.  (GeneRuler 1 kb)Ladder 5. کنترل منفی (نمونه فاقد DNA)

 

در مطالعه حاضر تراریختی ریزنمونه برگی گیاه چه تربچه و ایجاد ریشه‌های مویین با اگروباکتریوم رایزوژنز سویه‌ها با انتقال ژنهای rol صورت گرفت. اگرچه رشد سریع با تولید انشعابات فراوان در محیط کشت فاقد هورمون، معرف ریشه‌های مویین مورد مطالعه بود(3 و 25)، با این حال بررسی ماهیت تراریخته آنها توسط تکنیک PCR انجام شد و تکثیر قطعه 780 جفت بازی مربوط به ژن rolB بیانگر تراریخت بودن گیاهان مورد نظر بود. در مطالعه انجام شده توسط رهنما و همکاران در سال 2008 جهت اثبات انتقال ژن توسط اگروباکتریوم در گیاه PCR خارمریم انجام شد، طول قطعه حاصل از PCR برای A4، 780 جفت باز و برای GUS، 320 جفت باز بود (23). همچنین Santos و همکاران (2005) کشت ریشه‌های تراریخت گیاه انجدان رومی به وسیله تلقیح با سویه‌های A4 و 15834(GUS) را انجام دادند (23). در این مطالعه، PCR با پرایمر‌های ژن rolB ادغام قطعه T-DNA پلاسمید Ri به ژنوم ریشه‌های مویین که بعد از تراریختی با این سویه‌های اگروباکتریوم ایجاد شدند را تأیید کرد. همچنین تراریختی گیاه توسط ژن بتاگلوکورونیداز (GUS) و تأیید آن توسط پرایمر مربوط به این ژن بیانگر صحت انجام انتقال ژن می‌باشد.

 

شکل 3 ـ مقایسه مقدار ترکیبات فنلی ریشه های طبیعی (گروه کنترل) و ریشه‌های مویین (گروه تراریخت)

حروف متفاوت بیانگر اختلاف معنی دار در سطح 5% می‌باشد.

 

شکل 4 - مقایسه وزن تر ریشه های طبیعی (گروه کنترل) و ریشه‌های مویین (گروه تراریخت)

حروف متفاوت بیانگر اختلاف معنی دار در سطح 5% می‌باشد.

مورفولوژی ریشه‌های تراریخت: ریشه‌های مویین ایجاد شده در مطالعه حاضر در مقایسه با ریشه‌های شاهد انشعابات بیشتری ایجاد کرده و کوتاه‌تر بودند که دلیل آن احتمالاً بیوسنتز بیشتر اکسین در ریشه‌های تراریخت است. در تایید این فرض، گزارش شده که افزایش غلظت اکسین در ریشه‌ها باعث ایجاد ریشه‌های فرعی بیشتر و کوتاه شدن طول ریشه‌ها می‌شود (3). در برخی مطالعات نشان داده شده که ورود ژنهای خارجی به ویژه ژن مولد اکسین توسط اگروباکتریوم رایزوژنز به گیاه باعث بر هم زدن تعادل هورمونهای گیاهی شده که خود باعث القاء ریشه در گیاهان تراریخت، کاهش غالبیت انتهایی، افزایش شاخه دهی و ایجاد برگهای چروکیده می‌گردد (13). مکانیسم مشخص و قطعی که ژنهای rolB سبب ایجاد ریشه‌های مویین می‌شود هنوز ناشناخته باقی مانده است. ولی این‌گونه به نظر می‌رسد که ژن rolB سبب افزایش حساسیت به اکسین در سلولهای تراریخت شده می‌شود که این عامل می‌تواند سبب ایجاد ریشه‌های مویین گردد (3). احتمال دیگر، پلاسمید Ri در اگروباکتریوم رایزوژنز حامل دو ژن aux1 و aux2 می‌باشد که هر دو مسئول بیوسنتز اکسین در گیاهان تراریخت می‌باشند (8). همان طور که مطالعات قبلی نشان می‌دهد بیان اکسین باعث القاء ریشه در گیاهان تراریخت می‌گردد. در مطالعه حاضر این‌گونه می‌توان ایجاد ریشه‌های مویین را توجیه کرد که بیان ژن rolB با همکاری ژنهای aux1 و aux2 موجود در بازوی راست T-DNA اگروباکتریوم رایزوژنز سبب این امر می‌گردد.

ترکیبات فنلی: در سالهای اخیر کشت ریشه‌های مویین به منظور تولید متابولیتهای با ارزش در تعدادی از گونه‌های گیاهان دارویی در مقیاس تجاری صورت گرفته است (26). میزان تولید ترکیبات ثانویه در ریشه‌های مویین بالاتر از ریشه‌های طبیعی یا سایر بافتها می‌باشد. بنابراین ریشه‌های مویین یک ابزار قدرتمند جهت انجام تحقیقات به منظور بالا بردن میزان تولید متابولیتهای ثانویه و حتی آنزیمهای آنتی اکسیدانی محسوب می‌شوند (2و4). در این تحقیق تراریختی گیاه تربچه توسط اگروباکتریوم رایزوژنز و تأثیر T-DNA اگروباکتریوم رایزوژنز بر میزان تولید ترکیبات فنلی مورد مطالعه قرار گرفت. مطالعه بر روی ترکیبات فنلی نشان داد که میزان این ترکیبات در لاینهای تراریخت شده نسبت به لاینهای کنترل افزایش می‌یابد، افزایش سطح این ترکیبات در مطالعه انجام شده با داده‌های گزارش شده مطابقت دارد  (1، 9، 20، 21 و 25). مطالعات نشان داده است که تراریختی توسط اگروباکتریوم سبب افزایش آنزیمهای آنتی اکسیدانی و فعال شدن سیستمهای دفاعی می‌شود. افزایش فعالیت آنزیمهای آنتی اکسیدانی ممکن است به دلیل تحریک برخی از ژنهای مربوط به دفاع در برابر عوامل خارجی همانند ویروسها یا ویروئیدها باشد (28). علاوه بر این، مطالعه دیگر نشان می‌دهد که افزایش ترکیبات ثانویه در لاینهای تراریخت شده در ارتباط با مسیر سیگنالینگ H2O2 که به دلیل تحریک برخی از ژن‌های مربوط به دفاع در برابر عوامل خارجی ایجاد می‌شوند، می‌باشد. البته قابل ذکر است که T-DNA اگروباکتریوم رایزوژنز علاوه بر فعال کردن آنزیم‌های آنتی اکسیدانی مکانیسمهای دیگری برای کاهش سطح H2O2 دارد که هنوز مورد بررسی قرار نگرفته است (17). سایر مطالعات صورت گرفته نشان می‌دهد در اثر انتقال ژن و ایجاد ریشه‌های مویین میزان رادیکالهای آزاد افزایش می‌یابد و ترکیبات فنلی به دلیل خواص آنتی اکسیدانی از جمله ترکیبات مهم گیاهان محسوب می‌شوند که نقش مهمی در حذف رادیکالهای آزاد و جلوگیری از تبدیل هیدرو پراکسیدها به رادیکالهای آزاد را دارند نیز افزایش می‌یابد (12). تحقیقات صورت گرفته بین اثر آنتی اکسیدانی و مقدار ترکیبات فنلی، رابطه مستقیم را نشان داده است(19). مکانیسمی که T-DNA اگروباکتریوم رایزوژنز سبب افزایش فعالیت آنزیم‌ها یا کاهش سطوح H2O2 در گیاهان می‌شود هنوز مشخص نشده است اما احتمالا ژنهای rol بر آن تأثیر دارد (25 و 27).

هر چند در مورد نقش ژن‌های rol  بر روی رشد و مورفولوژی ریشه‌های مویین و گیاهان باز زایی شده از آنها اطلاعات تقریبا کاملی موجود می‌باشد ولی تاکنون مطالعات کمی به روی تأثیر مستقیم این ژنها در تولید متابولیتهای ثانویه انجام شده است. به تازگی مشخص شده است که ژنهای rol نقش فعال کنندگی در تولید متابولیتهای ثانویه در خانواده‌های مختلف از جمله سولاناسه داشته به نحوی که در بعضی موارد، تأثیر فعال کنندگی یک تک ژن rol برای غلبه بر کمبود تولید متابولیتهای ثانویه در سلولهای گیاهی کشت شده کافی بوده است (29). طبق گزارشهای اخیر بیان ژن rolC با تولید آلکالوئیدهای تروپانی همبستگی دارد (15 و 24).

  1. شبانی، ل و احسان پور، ع، ا (1388). القاء آنزیمهای آنتی اکسیدان، ترکیبات فنولیک و فلاونوئید در کشت در شیشه شیرین بیان (Glycyrrhiza glabra L.) با استفاده از متیل جاسمونات و سالیسیلیک اسید. مجله زیست شناسی ایران. جلد 22. شماره 4. صفحه 703-691.
  2. مرادی، ا، شریفی، م و موسوی، الف (1390). بررسی بیان ژن H6H  و ایزوفرمهای PMT تحت تاثیر غلظتهای مختلف اسید سالیسیلیک در ریشه مویی و اندامهای مختلف شابیزک (Atropa balladonna L.) مجله زیست شناسی ایران. جلد 24. شماره 3. صفحه 372-366.
  3. Bulgakov V, Gorpenchenko T, Veremeichik G, Shkryl Y, Tchernoded G, Bulgakov D, Aminin D and Zhuravlev N, The rolB gene suppresses reactive oxygen species in transformed plant cells through the sustained activation of antioxidant defense. Plant Physiol. 2012. 158(3): 1371-1381.
  4. Bulgakov V, Aminin D, Shkryl Y, Gorpenchenko T, Veremeichik G, Dmitrenok P and Zhuravlev Y, Suppression of reactive oxygen species and enhanced stress tolerance in Rubia cordifolia cells expressing the rolC oncogene. Mol Plant Microbe Interact. 2008. 21(12): 1561-1570.
  5. Chilton M, Petit A, Tepfer D, Casse-Delbart F and Tempé J, Agrobacterium rhizogenes inserts T-DNA into the genomes of the host plant root cells. Nature. 1982. 295: 432 - 434.
  6. Gururaj H, Kumar V, Prasad, Ravishankar and Sharma, Agrobacterium rhizogenes mediated genetic transformation resulting in hairy root formation is enhanced by ultrasonication and acetosyringone treatment. Electronic J. of Biotech. 2006. 349-357.
  7. Gutierrez R and Perez R, Raphanus sativus (Radish): their chemistry and biology. Scientific World Journal, 2004. 4: 811-837.
  8. Hashem E A, Estimation of the endogenous auxins and cytokinins in hairy roots incited on Solanum dulcamara plants by Ri plasmid of Agrobacterium rhizogenes. Australian Journal of Basic and Applied Sciences, 2009. 3: 142-147.

 

 

10. Hook I, Secondary metabolites in hairy root cultures of Leontopodium alpinum Cass, Plant Cell, Tissue and Organ Culture. 1994. 38(2-3): 321-326.

11. Hu and Du M, Hairy root and its application in plant genetic engineering. J. of Integrative Plant Biol, 2006. 48: 121-127.

12. Hussain M, Ansari F, Rahman M, Current approaches toward production of secondary plant metabolites. J Pharm Bioallied Sci, 2012 4(1): 10-20.

13. Jimoh A. A, Adedapo AA and A. J. , Polyphenolic Contents and Biological Activities of Rumex ecklonianus, Pharm. Biol. 2008. 46: 333–340

14. Mercuri A., Bruna S., De Benedetti L., Burchi G., Modification of plant architecture in Limonium ssp. induced by rol genes. Plant Cell Tiss and Org. Culture. 2001. 65: 247-253.

15. Mishra B. and Ranjan R, Growth of hairy-root cultures in various bioreactors for the production of secondary metabolites. Biotechnol Appl Biochem. 2008. 49(Pt 1): 1-10.

16. Moyano P, Fornalé S, Cusidó RM and Bonfill M, Piñol MT, Effect of Agrobacterium rhizogenes T-DNA on alkaloid production in Solanaceae plants, Phytochemistry. 1999. 52: 1287 - 1292.

17. Murray MG and Thompson WF. Rapid isolation of high molecular weight plant DNA Nucleic Acids Res. 1980. 8(19): 4321–4325.

18. Nikravesh R, Khavari-Nejad A, Rahimian H and Fahimi H, Study of antioxidant enzymes activity and isozymes pattern in hairy roots and regenerated plants in Nicotiana tabacum, Acta Physiologiae Plantarum. 2012. 34(2): 419-427.

19. Ono N and Tian L, The multiplicity of hairy root cultures: prolific possibilities. Plant Sci. 2011. 180(3): 439-446.

20. Ozgen M, Scheerens J. C, Reese R. N. and Miller R. A, Total phenolic, anthocyanin contents and antioxidant capacity of selected elderberry (Sambucus canadensis L.) accessions, Pharmacogn Mag. 2010. 6(23): 198-203.

21. Perry D. S, Shin E. D, Getzoff D and Tainer J. A, The structural biochemistry of the superoxide dismutases, Biochim Biophys Acta. 2010. 1804(2): 245-262

22. Pistelli L, Giovannini A, Ruffoni B, Bertoli A and Pistelli L , Hairy root cultures for secondary metabolites production, Adv Exp Med Biol. 2010. 698: 167-184.

23. Rahnama H, Hasanloo T, Shams MR. and Sepehrifar R. Silymarin production in hairy root culture of Silybum marianum L. Gaertn. Iranian J. Biotechnol. 2008. 6: 113-118.

24. Santos PAG, Figueiredo AC, Oliveira MM, Barroso JG, Pedro LG, Deans AG, Scheffer AJC. Growth and essential oil composition of hairy root cultures of Levisticum officinale W.D.J. Koch (lovage). Plant Sci. 2005. 168: 1089-1096.

25. Sevon, N. and K. M. Oksman-Caldentey, Agrobacterium rhizogenes-mediated transformation: root cultures as a source of alkaloids. Planta Med. 2002. 859-868: (10)68

26. Srivastava S and Srivastava k, Hairy root culture for mass-production of high-value secondary metabolites, Crit Rev Biotechnol. 2007. 27(1): 29-43.

27. Veena V and Taylor C, Agrobacterium rhizogenes: recent developments and promising applications. In Vitro Cellular & Developmental Biology - Plant. 2007. 43(5): 383-403.

28. Victor and. Zhuravlev, Inhibitory effect of the Agrobacterium rhizogenes rolC gene on rabdosiin and rosmarinic acid production in Eritrichium sericeum and Lithospermum erythrorhizon transformed cell cultures, Planta Med. 2005. 221: 471–478.

29. Yang C. M, Zeng L, Zhang L, Liu X, Lan and Liao Z, Improvement of tropane alkaloids production in hairy root cultures of Atropa belladonna by over expressing pmt and h6h genes, Plant Omics J. 2011. 4: 29-33.

30. Zhong j, Biochemical Engineering of the Production of Plant-Specific Secondary Metabolites by Cell Suspension Cultures. Plant Cells, Springer Berlin Heidelberg. 2001. 72: 1-26.