نوع مقاله: مقاله پژوهشی

نویسندگان

1 پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری

2 Chemistry Dept., City College of New York, New York, USA

چکیده

کیتینازها یکی از آنزیم‌های صنعتی مهم محسوب می‌شوند که از اهمیت بسزایی در خصوص تجزیه مواد کیتینی، پاکسازی محیط زیست و کنترل قارچ‌های پاتوژن گیاهی و آفات دارند که با شکستن اتصالات گلیکوزیدی -1,4 سبب تجزیه کیتین می‌شوند. این آنزیم‌ها در ساختار خود دارای دمین کاتالیتیکی 8 (β/α) حاوی توالی‌های حفاظت شده‌ای به نام موتیف DXDXE روی رشته 4β هستند که آسپارتات و گلوتامات موجود در این توالی و همچنین آمینواسیدهای موجود در اطراف این توالی نقش اصلی در فرایند هیدرولیز پیوند گلیکوزیدی بازی می‌کنند. بررسی آمینو اسیدهای نزدیک به جایگاه فعال می تواند به درک نقش آنها در فرایند کاتالیز کمک کند. در این پروژه به منظور بررسی نقش گلیسین 191 و سرین 390 موجود در اطراف توالی حفاظت شده در فرایند کاتالیتیکی کیتیناز Serratia marcescens B4A، این دو آمینواسید جهش داده شدند و پس از همسانه‌سازی در حامل بیانی و بررسی بیان آن با SDS-PAGE، اثر این دو جهش بر روی فعالیت آنزیم مورد بررسی قرار گرفت.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Study of active site adjacent residues on Serratia marcescens B4A chitinase catalytic activity

نویسندگان [English]

  • Saeed Aminzadeh 1
  • ali ashghar karkhaneh 1
  • jahan Ali khajeh 2

چکیده [English]

Chitinases are one of the important industrial enzymes which have significant role in different industries such as digestion of chitin and chitoligosaccharides, bioremediation and control of plants pathogenic fungal as well as insects. This enzyme catalyzes the β 1→6 glycoside bond and then hydrolyses chitin polymers. chitinases consists of a (ß/α)8-barrel catalytic domain contain of conserved sequence called DXDXE motif on β4 strand which D, E and residue around of this conserved sequence have essential role in cleavage and hydrolysis of the glycosidic bond. Study of active site adjacent amino acids can help us to understand their function in catalytic properties. In this project are mutated Ser390 and Gly191 for investigating role of this two residue existing in the adjacent of conserved sequence at catalytically process of Serratia marcescens B4A chitinase and after of cloning in expression vector and analysis of expression with SDS-PAGE are investigated effect of two mutations on the enzyme activity.

کلیدواژه‌ها [English]

  • Chitinase
  • Chitin
  • glycosidic bond
  • Serratia Marcescens B4A

بررسی نقش آمینواسیدهای اطراف توالی جایگاه فعال در فعالیت آنزیم کیتیناز باکتری Serratia marcescens B4A 

زینب امروزی توبکانلو1، سعید امین­زاده1*، علی­اصغر کارخانه­ای1 و جهان علی خواجه2

1 تهران، پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری، پژوهشکده زیست فناوری صنعت و محیط زیست، گروه مهندسی زیست فرآیند

2 نیویورک، سیتی کالج، دپارتمان شیمی

تاریخ دریافت: 6/11/92                تاریخ پذیرش: 21/10/93 

چکیده 

کیتینازها یکی از آنزیم­های صنعتی مهم محسوب می­شوند که از اهمیت به سزایی در خصوص تجزیه مواد کیتینی، پاکسازی محیط زیست و کنترل قارچ­های پاتوژن گیاهی و آفات دارند که با شکستن اتصالات گلیکوزیدی b-1,4 سبب تجزیه کیتین می شوند. این آنزیمها در ساختار خود دارای دمین کاتالیتیکی 8 (β/α) حاوی توالیهای حفاظت شده­ای به نام موتیف DXDXE روی رشته 4β هستند که آسپارتات و گلوتامات موجود در این توالی و همچنین آمینواسیدهای موجود در اطراف این توالی نقش اصلی در فرآیند هیدرولیز پیوند گلیکوزیدی بازی می­کنند. بررسی آمینو اسیدهای نزدیک به جایگاه فعال می تواند به درک نقش آنها در فرآیند کاتالیز کمک کند. در این پروژه به منظور بررسی نقش گلیسین 191 و سرین 390 موجود در اطراف توالی حفاظت شده در فرآیند کاتالیتیکی کیتیناز Serratia marcescens B4A، این دو آمینواسید جهش داده شدند و پس از همسانه­سازی در حامل بیانی و بررسی بیان آن با SDS-PAGE، اثر این دو جهش بر روی فعالیت آنزیم مورد بررسی قرار گرفت.

واژه­های کلیدی: کیتیناز، کیتین، اتصالات گلیکوزیدی، Serratia marcescens B4A

* نویسنده مسئول، تلفن: 44787412-021 پست الکترونیکی: aminzade@nigeb.ac.ir

مقدمه

 

کیتین (C8H13O5N)n یک هموپلی­ساکارید حاوی نیتروژن با زنجیره­ی طویل N-استیل گلوکز آمین (یک مشتقی از گلوکز) دارای اتصالات گلیکوزیدی b-1,4 است که توسط پیوند­های هیدروژنی به صورت یک ساختمان کریستالی منظم و نامحلول درآمده است. کیتین از لحاظ تکاملی یک میلیون سال پیش آغاز شده، موقعی که اولین قارچ تک سلولی از ارگانیسمهای دیگر جدا شد (10). کیتین اسکلت خارجی حشرات و پوسته سخت­پوستان را می­سازد. علاوه بر آن در دیواره سلولی قارچها نیز وجود دارد (7). کیتیناز گلیکوزیل­هیدرولازهایی هستند که برای اولین بار در سال 1911 شناسایی شد؛ زمانی که برنارد (Bernard) نشان داد که یک فاکتور حساس به حرارت و ضد قارچ در گیاه ارکیده وجود دارد. با توجه به نحوه شکسته شدن رشته کیتین، آنزیمهای کیتیناز در دو گروه اندوکیتیناز­ها و اگزوکیتیناز­ها قرار می­گیرند. آنزیم کیتیناز اهمیت اقتصادی چشمگیری در خصوص تجزیه مواد کیتینی و پاکسازی محیط زیست و تهیه مواد پیش­ ماده و کنترل قارچهای پاتوژن گیاهی و آفات دارد (7). یکی از ابزارهای قدرتمند در مطالعه عملکرد میکروارگانیسم­ها در حین بیماریزایی تراریختی است و قارچهای رشته­ای از جمله میکروارگانیسم­هایی هستند که به این منظور مورد مطالعه قرار گرفته­اند (1) همچنین می­توان با ساخت سازه­های بیانی گیاهی حاوی ژن کیتیناز و انتقال آن به گیاه، گیاه تراریخته­ای ایجاد کرد که به بیماریهای قارچی مقاوم است (2). بررسی ساختار گلیکوزیل­هیدرولاز­های خانواده 18  (GH18)وجود سه زیرساختار شامل توالی سیگنال (s)، دمین کاتالیتیکی 8 (β/α) گلیکوزیل­هیدرولاز 18 (CAT) به همراه دمین متصل­شونده به کیتین (CH) و دمین مشابه فیبرونکتین نوع III را بطور دقیق مشخص نمود (7). جایگاه اتصال سوبسترا یک شکاف طویلی است که از بالای زنجیر (barrel) عبور کرده و شامل آمینواسیدهای آروماتیکی است که با هر واحد N-استیل گلوکز آمین در زنجیره کیتین به طور هیدروفوبیکی جمع شده است (3). علی رغم تنوع ساختاری در کیتینازها، یک توالی نشانه بسیار حفاظت­شده به نام موتیف DXDXE روی رشته 4β شناسایی شده است که در این موتیف گلوتامات E)) به عنوان دهنده پروتون کاتالیتیک عمل می­کند و آسپارتات دوم) (D2 برای شرکت در پایداری واپیچش ضروری سوبسترا در معرض قرار می­گیرد (19). هیدرولیز پیوند گلیکوزیدی توسط دو باقی مانده آمینواسیدی آنزیمها، یعنی یک اسید عمومی(دهنده پروتون) و یک باز کاتالیز می­شود (8). در کیتینازهای خانواده 18 فرآیند هیدرولیز از طریق مکانیسم نگهداشتن جابه جایی دوتایی (Double- Displacement Retaining Mechanism) انجام می­شود که در آن اکسیژن پیوند گلیکوزیدی b-1,4 ابتدا پروتونه می­شود ( تشکیل یک یون حدواسط به نام یون اکسوکربونیوم می­دهد )، این یون حدواسط به وسیله دومین گروه کربوکسیل پایدار می­شود ( با تعاملات کووالانی یا الکتروستاتیکی). در نهایت با حمله نوکلئوفیلی مولکول آب، محصول واکنش آزاد می­گردد که این حمله برای نگهداشتن کنفورماسیون آنومریک اولیه لازم می­باشد (6 و 16) در پایگاه CAZypedia نتایج استروشیمیایی واکنش کاتالیتیکی و نوع بقایای آمینو اسیدی که به صورت نوکلئوفیل یا دهنده پروتونی عمل می­کنند نشان داده شده است و اطلاعاتی در مورد مکانیسمهای کاتالیزوری و تنوع گلیکوزید­هیدرولازها در اختیار قرار داده است. گروهی از محققین دریافتند که سرین اطراف نواحی حفاظت شده جایگاه کاتالیتیکی برای عمل کاتالیتیکی کیتینازهای خانواده 18 مهمند (17 و 22). علاوه بر آن گروهی دیگر از محققان دریافتند که آمینواسیدهای پرولین، سرین، ترئونین، آلانین و گلیسین به واسطه قرار گرفتن در قطعات ارتباط دهنده (Linker) در فرآیندهای کاتالیتیکی کیتینازها نقش به سزایی ایفاء می­کنند (14). در پژوهش حاضر با روش جهش­زایی هدفمند نقش سرین 390 و گلیسین 191 در فعالیت کاتالیتیکی کیتیناز Serratia marcescens B4A مورد مطالعه قرار گرفت.

مواد و روشها

مواد: پلاسمید pQE60 حاوی ژن کیتیناز به عنوان الگو برای جهش ژن کیتیناز استفاده شد و سویهDH5α   (Invitrogen)از باکتری Escherichia coli به عنوان یک میزبان برای همسان­سازی مولکولی پلاسمیدهای نوترکیب (Fermentas) pTZ57R/T و (Fermentas) pET26b حامل ژن کیتیناز طبیعی و جهش­یافته و سویه BL21 (DE3)  (Invitrogen)از باکتری Escherichia coli برای بیان پروتئین استفاده شد و کیتین پوسته خرچنگ و 3/5 دی نیتروسالیسیکلیک اسید (DNS) از سیگما (St. Louis, MO, USA) خریداری شد و کیتین کلوئیدی از کیتین تجاری طبق روش روبرت و سلیترنیکوف (18) تهیه شد.

مطالعات بیوانفورماتیکی: به منظور انجام مطالعات بیوانفورماتیکی، پیشگویی ساختار پروتئین و طراحی پرایمرهای اختصاصی جهت ایجاد جهش در اطراف نواحی حفاظت شده دمین کاتالیتیکی، ابتدا ژن کیتیناز S. marcescens B4A از مرکز ملی اطلاعات بیوتکنولوژی (NCBI) با شماره دسترسی HM473183 در GeneBank گرفته شد (http://www.ncbi.nlm.nih.gov) و دمین کاتالیتیکی و نواحی حفاظت شده آن مورد بررسی قرار گرفت (http://www.ncbi.nlm.nih.gov/Structure/cdd/cddsrv.cgi?ascbin=8&maxaln=10&seltype=2&uid=119365) (4). مطالعه نرم‌افزاری تأثیر جهشها بر ساختار کلی کیتیناز با مطالعه ساختمان سوم آنها به روش همولوژی بر اساس ساختار باز کیتیناز S. marcescens (PBD ID, 1edq_A)،  انجام شد. به همین منظور ساختمان سوم کیتینازهای نوترکیب طبیعی و جهش‌یافته براساس مدل همولوژی با استفاده از سرورMODELLER v9.10 (http://www.salilab.org/modeller/)  (9) پیشگویی گردید. سپس کیتینازهای جهش‌یافته بر روی کیتیناز طبیعی منطبق شدند. میزانRMSD  (فاصله rmsd) بین اتمهای دو مولکول مربوط به کیتیناز طبیعی و جهش یافته با استفاده از نرم افزارVMD  (12) محاسبه شد.

مطالعات  آزمایشگاهی:  جهش­زایی:  پلاسمید  pQE60

حاوی ژن کیتیناز(کار قبلی) (4) بعنوان الگو برای ساخت کیتیناز جهش­یافته G191V و S390I استفاده شد. جهش­زایی با روش QuikChange Site-Directed Mutagenesis انجام شد. واکنش زنجیره­ای پلیمراز با پرایمرهای جهش­زای F-G191V،R-G191V و F-S390I، R-S390I (جدول 1) به طور جداگانه انجام شد و نتایج آن بر روی ژل آگارز مشاهده شد. سپس محصول آن با 2-1 واحد از DpnI  science)  (Jenaدر دمای 37 درجه سانتی گراد به مدت 30 دقیقه مورد هضم قرار گرفت و برای تأیید درستی ایجاد جهش در ژن کیتیناز، DNA پلاسمید نوترکیب توالی یابی شد.

 

جدول 1.ترادف آغازگرهای به کار گرفته شده در این پژوهش

نام آغازگر 

توالی آغازگر 

Ta 

F-G191V 

5'-CATCTGCTGTACGTCTTTATCCCGATCTG- 3'

58°C

R-G191V 

5'-CAGATCGGGATAAAGACGTACAGCAGATG -3'

58°C

F-S390I 

5' -CACATCTTCCTGATGATCTACGACTTCTACG -3

58°C

R-S390I 

5'-CGTAGAAGTCGTAGATCATCAGGAAGATGTG -3'

58°C

Emr-F 

5'- ATAATCATATGGGGCGCAAATTTAATAAACC -3'

62°C

Emr-R 

5'- ATATACTCGAGATCTTTGAACGCCGGCGC -3'

62°C

 


همسانه سازی (کلونینگ) و بیان: دو پرایمر برای تقویت سازی و اضافه کردن جایگاههای برش در دو طرف ژن طراحی شد. پرایمر رفت با جایگاه NdeI و ATG به عنوان کدون آغاز و پرایمر برگشت با جایگاه XhoI (جدول 1). متعاقباً محصول PCR ( bp1701) درون pTZ57R/T  همسانه­سازی شد و سپس پلاسمید نوترکیب با NdeI  و  XhoIبریده شد و قطعات به دست آمده ( bp1701) درون حامل بیانی pET26b بریده شده با همان آنزیمهای محدودکننده همسانه­سازی شد. یک تک کلنی از پلاسمیدهای نوترکیب حامل کیتیناز جهش­یافته که به درون Escherichia coli سویه BL21 (DE3) انتقال (ترانسفرم) داده شده بود در محیط کشت LB کشت داده شد. سپس بیان آن با اضافه کردن یک میلی مولار ایزوپروپیل-βD-تیوگالاکتوزید (IPTG) القاء شد و با آنالیز SDS-PAGE تأیید شد. محتوای پروتئینی عصاره­ها با روش برادفورد (5) تعیین شد. فعالیت کیتیناز با استفاده از کیتین کلوئیدی به عنوان سوبسترا (محلول w/v 1 درصد کیتین کلوئیدی در بافر فسفات NaH2PO4 mM) 20) با )5/7pH=) با روش روبرت و سلیترنیکوف (18) برای 60 دقیقه در 50 درجه سانتی گراد انجام شد. سپس واکنش به وسیله جوشاندن مخلوط در حضور DNS   (Sigma , St. Louis, MO, USA)برای 10 دقیقه به پایان رسانده شد. هیدرولیز کیتین با روش DNS مطابق با میلر (15) اندازه گیری شد.

مطالعات کینیتیکی: محاسبه Km و Vmax آنزیم با استفاده از غلظتهای مختلف صفر تا mg/ml 50 سوبسترای طبیعی آنزیم (کیتین کلوئیدی) و از رسم و بررسی منحنیهای میکائیلیس منتن و لینوویربرگ صورت گرفت. بدین منظور فعالیت آنزیم در غلظتهای مختلف کیتین کلوئیدی در شرایط معمول با رسم منحنی استاندارد N-استیل، D-گلوکز آمین بر حسب mmol/min اندازه­گیری شد.

بحث و نتایج

مطالعاتی که تاکنون بر روی فعالیت کاتالیتیکی کیتیناز صورت گرفته است بیشتر برای بررسی نقش آمینواسیدهای آسپارتات و گلوتامات موجود در نواحی حفاظت شده دمین کاتالیتیکی (11، 13 و20) و آمینواسیدهای آروماتیک موجود در ناحیه متصل شونده به سوبسترا می­باشد (21 و23) و مطالعات کمی بر روی بررسی نقش آمینواسیدهای مجاور نواحی حفاظت شده دمین کاتالیتیکی انجام گرفته است. در این پروژه هدف بررسی نقش دو آمینواسید گلیسین 191 و سرین 390 مجاور نواحی حفاظت شده دمین کاتالیتیکی در فعالیت کاتالیتیکی کیتیناز Serratia marcescens B4A است.

مطالعات بیوانفورماتیکی: با بررسی نواحی محافظت شده ژن کیتیناز S. marcescens B4A مشاهده شد که گلیسین 191 و سرین 390 در نزدیکی نواحی حفاظت شده دمین کاتالیتیکی قرار گرفته­اند و با توجه به یافته­های گروهی از محققین درباره نقش این دو آمینواسید در فعالیت کاتالیتیکی کیتیناز (14، 17و 22) این دو جایگاه گزینه مناسبی برای بررسی نقش آمینواسیدهای مجاور نواحی حفاظت شده در فعالیت کاتالیتیکی کیتیناز بود. برای مطالعه ساختار سه بعدی کیتیناز طبیعی و جهش‌یافته­ها ابتدا ساختار این آنزیمها با استفاده نرم‌افزار modeler پیشگویی شد سپس کیتینازهای جهش‌یافته بر روی کیتیناز طبیعی منطبق شد. میزان RMSD (فاصله rmsd ) بین اتمهای دو مولکول مربوط به کیتیناز طبیعی و جهش یافته G191V 8/2 آنگستروم و کیتیناز طبیعی و جهش یافته S390I 9/2 آنگستروم محاسبه شده است (شکل 1) که این میزان RMSD نشان می‌دهد که جهش‌ ایجاد شده ساختمان کلی کیتیناز را تغییر چندانی نداده و کیتیناز­ها بر روی هم منطبق هستند.

 

 

شکل 1- نمایش کیتیناز طبیعی و جهش‌یافته­ها با مدل انطباقی با استفاده از نرم‌افزار VMD. الف.نوار آبی رنگ کیتیناز طبیعی و نوارسفید رنگ کیتیناز جهش یافته G191V. ب.نوار آبی رنگ کیتیناز طبیعی و نوار زرد رنگ کیتیناز جهش یافته S390I را نشان می‌دهد.


مطالعات آزمایشگاهی: جهش­زایی: پس ازطراحی پرایمرهای جهش­زا، ژن کیتیناز با روش QuikChange Site-Directed Mutagenesis جهش داده شد و پس از انجام PCR، محصول آن بر روی ژل آگارز الکتروفورز گردید و باندbp 5100 مربوط به پلاسمید مشاهده شد (شکل 2) پس از تعیین توالی ژنهای جهش­یافته، کیفیت توالی از روی ارتفاع امواج ثبتی حاصل بررسی شد. سپس جهت اطمینان از ایجاد جهشهای مورد نظر در جایگاههای انتخاب شده، توالی حاصل با استفاده از نرم افزار BLAST در پایگاه اینترنتی NCBI، مورد بررسی قرار گرفت و همان­طور که انتظار می­رفت، GGC مربوط به اسیدآمینه گلیسین 191 به GTC  مربوط به اسیدآمینه والین و AGC اسیدآمینه سرین390 به ATC مربوط به اسیدامینه ایزولوسین تبدیل شد.

 

شکل 2- الکتروفورز محصولات PCR جهش یافته. ستون 1. کنترل منفی، ستون 2. محصول PCR با پرایمرهای F-G191V و R-G191V، ستون 3. محصول PCR با پرایمرهای F-S390I و R-S390I، ستون M. مارکر 1 Kb

همسانه­سازی و بیان: ژنهای کیتیناز جهش­یافته پس از همسانه­سازی در حامل pTZ57RT به حامل بیانی pET26b انتقال داده شدند سپس وجود قطعه خارجی در پلاسمیدهای نوترکیب با برش آنزیمی با آنزیمهای XhoI و NdeI تأیید شد و خروج قطعه 1701 جفت نوکلئوتیدی از پلاسمید نوترکیب pET26b صحت همسانه­سازی را تأیید کرد (شکل 3). پس از انتقال (ترانسفرم) پلاسمیدهای نوترکیب حامل کیتیناز جهش یافته به درون سویه BL21 (DE3)، بیان آن با اضافه کردن 6/0 مولار IPTG، دمای 25 درجه سانتی گراد پس از 12 ساعت القاء شد و با آنالیز SDS-PAGE تأیید شد و پس از الکتروفورز روی ژل باندKDa  62 مربوط به جهش­یافته ها مشاهده شد (شکل 4). فعالیت کیتیناز با استفاده از کیتین کلوئیدی به عنوان سوبسترا و در حضور DNS   مورد بررسی قرار گرفت و مشاهده شد که کیتینازهای جهش­یافته نسبت به نوع طبیعی فعالیت کمتری از خود نشان می­دهند که این کاهش فعالیت کاتالیتیکی جهش­یافته­ها دلیلی بود بر اینکه گلیسین 191 و سرین 390 در فعالیت کاتالیتیکی کیتیناز نقش به سزایی داشته است (شکل 5).

 

 

شکل 3- الکتروفورز واکنش هضم آنزیمی جهت تأیید همسانه سازی. ستون 1. همسانه نوترکیب حاوی ژن کیتیناز جهش یافته G191V هضم شده، ستون 2. همسانه نوترکیب حاوی ژن کیتیناز جهش یافته S390I هضم شده و مشاهده قطعه­هایی به طول 1701 جفت بازی (طول ژن کیتیناز همسانه شده) و 5000 جفت بازی (طول پلاسمید pET26b)، چاهک M- مارکر 1 Kb

 

شکل 4- بررسی بیان پروتئین کیتیناز با استفاده از ژل .SDS-PAGE ستون1. همسانه نوترکیب قبل از القا. ستون2. همسانه نوترکیب طبیعی. ستون 3. همسانه نوترکیب G191V . ستون 4. همسانه نوترکیب S390I. ستون  .Mمارکر وزن مولکولی پروتئین(پیکان اریب باند 62 kDa مربوط به کیتیناز است).

 

 

شکل 5- سنجش فعالیت کیتینازهای جهش یافته و طبیعی. ویال 1.کیتیناز طبیعی. ویال 2. کیتیناز جهش یافته G191V. ویال 3. کیتیناز جهش یافته S390I. ویال 4. کنترل منفی(باکتری BL21 دارای وکتور بیانی pET26b فاقد ژن کیتیناز. ویال 5. شاهد

مطالعات کینیتیکی: محاسبه Km و Vmax آنزیمها پس از رسم و بررسی منحنیهای میکائیلیس منتن و لینوویربرگ صورت گرفت و مشاهده شد که میزان Km برای کیتیناز طبیعی و جهش­یافته های G191V و S390I به ترتیب برابر با mg/ml  5/4 وmg/ml  4 وmg/ml  76/4 و میزان Vmax به ترتیب برابر باUnit(mmol/min)  23/588 و Unit(mmol/min) 09/238 وUnit(mmol/min)  84/153 می باشد (نمودار 1). Km میزان تمایل آنزیم به سوبسترا را نشان می­دهد نتایج حاصل از اندازه گیری Km نشان می­دهد که این دو آمینواسید بر تمایل اتصال آنزیم به سوبسترا تأثیر چندانی نداشته اند و Vmax نشان دهنده حداکثر سرعت آنزیم هنگامی است که به طور کامل از سوبسترا اشباع شده است.

 

 

 

 

نمودار 1- منحنی Michaelis-Menten. ;Insert منحنی Lineweaver-Burke برای محاسبه پارامتر­های کاتالیتیک. a) کیتیناز طبیعی: Km محاسبه شده mg/ml  5/4و Vmax آنUnit(mmol/min)  23/588 می­باشد. b) کیتیناز جهش­یافته G191V:  Km محاسبه شده mg/ml  4و Vmax آنUnit(mmol/min)  09/238 می­باشد. c) کیتیناز جهش یافته S390I: Km محاسبه شده برای این آنزیمmg/ml  76/4و Vmax آنUnit(mmol/min)  84/153 می­باشد

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 



نتایج حاصل از اندازه گیری Vmax نشان می­دهد که حداکثر سرعت فعالیت کاتالیتیکی جهش یافته­ها نسبت به نوع طبیعی کاهش یافته و این کاهش فعالیت نقش آمینواسیدهای گلیسین و به خصوص سرین مجاور نواحی حفاظت شده دمین کاتالیتیکی را در فعالیت کاتالیتیکی کیتیناز نشان می­دهد. گروهی از محققین در سال 2007 با ایجاد جهش در آمینواسیدهای حفاظت شده در مرکز کاتالیتیکی کیتیناز B S. marcesscens نقش آمینواسیدهای گلوتامات و آسپارتات را مورد بررسی قرار دادند علاوه بر آن با جهش Tyr10 و Ser93 دریافتند که هنگامی که Asp142 به سمت Glu144 هدایت می شود این دو آمینواسید بار روی Asp140 را پایدار می­کند و باعث تغییر شبکه پیوند هیدروژنی اطراف آن می شوند (17). علاوه بر آن گروهی دیگر از محققان دریافتند که در کیتینازها قطعات نامنظم انعطاف­پذیر غنی از آمینواسیدهای پرولین، سرین، ترئونین، آلانین و گلیسین وجود دارند که به نام ارتباط­دهنده (Linker) خوانده می­شوند که دمین غیرکاتالیتیک متصل شونده به سوبسترا را به دمین کاتالیتیکی متصل می­کند و شواهد نشان داده است که این ارتباط دهنده ها قطعات انعطاف پذیر و گسترده ای را ایجاد می کنند که آرایش نسبی و جهت گیری مناسب دمین متصل شونده و کاتالیتیکی را نسبت به هم تعیین می­کنند و در نتیجه سبب افزایش بازدهی کاتالیتیکی کیتینازها می­شوند (14). در این پروژه سرین 390 به دلیل حضور داشتن در قطعه ارتباط­دهنده و همچنین به دلیل نقش آن در پایدار کردن بار روی آسپارتات موجود در توالی حفاظت­شده نسبت به گلیسین 191 نقش بیشتری در فعالیت کاتالیتیکی کیتیناز دارد و کاهش بیشتر فعالیت کیتیناز در نتیجه جهش سرین این موضوع را تأیید می­کند.

تشکر و قدردانی 

بدین وسیله از صندوق حمایت پژوهشگران و فناوران کشور که با طرح شماره 89002350 کمک به اجرای این پروژه نمودند و همچنین پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری که با طرح شماره 453 باعث فراهم ساختن شرایط اجرایی تحقیق شدند؛ سپاسگزاری می گردد.

1- مرادی، س.، سنجریان، ف.، صفایی، ن. 1391. بهینه­سازی تولید پروتوپلاست از قارچ بیماریزای گیاهی Fusarium garminearum به منظور تراریختی آن. مجله زیست­شناسی ایران. 500-493: 4.

2- اصفهانی، ک.، مطلبی، م.، زمانی، م. 1390. طراحی و سازه­های بیانی گیاهی جهت انتقال ژنهای chit 42 وbgn13.1 قارچ تریکودرما به صورت منفرد و توأم. مجله زیست­شناسی ایران. 894-880: 6. 

 

3- Aronson, N. N., Jr, Halloran, B. A., Alexeyev, M. F., Zhou, X. E., Wang, Y., Meehan, E. J., & Chen, L. (2006). Mutation of a conserved tryptophan in the chitin-binding cleft of Serratia marcescens chitinase A enhances transglycosylation. Bioscience, Biotechnology, and Biochemistry, 70(1), 243–251.

4- Babashpour, S., Aminzadeh, S., Farrokhi, N., Karkhane, A., & Haghbeen, K. (2012). Characterization of a Chitinase (Chit62) from Serratia marcescens B4A and Its Efficacy as a Bioshield Against Plant Fungal Pathogens. Biochemical Genetics, 50(9-10), 722–735.

5- Bradford, M. M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry, 72, 248–254.

6- Brameld, K. A., Shrader, W. D., Imperiali, B., & Goddard, W. A., 3rd. (1998). Substrate assistance in the mechanism of family 18 chitinases: theoretical studies of potential intermediates and inhibitors. Journal of Molecular Biology, 280(5), 913–923.

7- Brurberg, M. B., Nes, I. F., & Eijsink, V. G. H. (1996). Comparative studies of chitinases A and B from Serratia marcescens. Microbiology, 142(7), 1581–1589.

8- Davies G, Henrissat B.(1995). Structures and mechanisms of glycosyl hydrolases. Structure, 3(9), 853–859.

9- Eswar, N., Webb, B., Marti-Renom, M. A., Madhusudhan, M. s., Eramian, D., Shen, M., Sali, A. (2002). Comparative Protein Structure Modeling Using Modeller. In Current Protocols in Bioinformatics. John Wiley & Sons, Inc. Retrieved from http://onlinelibrary.wiley.com/doi/10.1002/0471250953.bi0506s15/abstract

10- Gåseidnes, S., Synstad, B., Jia, X., Kjellesvik, H., Vriend, G., & Eijsink, V. G. H. (2003). Stabilization of a chitinase from Serratia marcescens by Gly→Ala and Xxx→Pro mutations. Protein Engineering, 16(11), 841–846.

11- Hashimoto, M., Honda, Y., Nikaidou, N., Fukamizo, T., & Watanabe, T. (2000). Site-directed mutagenesis of Asp280 suggests substrate-assisted catalysis of chitinase A1 from Bacillus circulans WL-12. Journal of Bioscience and Bioengineering, 89(1), 100–102.

12- Humphrey, W., Dalke, A., & Schulten, K. (1996). VMD: Visual molecular dynamics. Journal of Molecular Graphics, 14(1), 33–38.

13- Lin, F. P., Chen, H. C., & Lin, C. S. (1999). Site-directed mutagenesis of Asp313, Glu315, and Asp391 residues in chitinase of Aeromonas caviae. IUBMB Life, 48(2), 199–204.

14- Lobo, M. D. P., Silva, F. D. A., Landim, P. G. C., Cruz, P. R. da, Brito, T. L. de, Medeiros, S. C. de, … Grangeiro, T. B. (2013). Expression and efficient secretion of a functional chitinase from Chromobacterium violaceum in Escherichia coli. BMC Biotechnology, 13(1), 46.

15- Miller, G. L. (1959). Use of Dinitrosalicylic Acid Reagent for Determination of Reducing Sugar. Analytical Chemistry, 31(3), 426–428.

16- Robertus, J. D., & Monzingo, A. F. (1999). The structure and action of chitinases. EXS, 87, 125–135.

17- Synstad, B., Gåseidnes, S., Van Aalten, D. M. F., Vriend, G., Nielsen, J. E., & Eijsink, V. G. H. (2004). Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase. European Journal of Biochemistry / FEBS, 271(2), 253–262.

18- Takiguchi Y (1991) Physical properties of chitinous materials. Advanc Chitin Sci 111:1–7

19- Tsuji, H., Nishimura, S., Inui, T., Kado, Y., Ishikawa, K., Nakamura, T., & Uegaki, K. (2010). Kinetic and crystallographic analyses of the catalytic domain of chitinase from Pyrococcus furiosus- the role of conserved residues in the active site. The FEBS Journal, 277(12), 2683–2695.

20- Tsujibo, H., Orikoshi, H., Imada, C., Okami, Y., Miyamoto, K., & Inamori, Y. (1993). Site-directed mutagenesis of chitinase from Alteromonas sp. strain O-7. Bioscience, Biotechnology, and Biochemistry, 57(8), 1396–1397.

21- Uchiyama, T., Katouno, F., Nikaidou, N., Nonaka, T., Sugiyama, J., & Watanabe, T. (2001). Roles of the exposed aromatic residues in crystalline chitin hydrolysis by chitinase A from Serratia marcescens 2170. The Journal of Biological Chemistry, 276(44), 41343–41349.

22- Van Damme, E. J. M., Culerrier, R., Barre, A., Alvarez, R., Rouge, P., & Peumans, W. J. (2007). A Novel Family of Lectins Evolutionarily Related to Class V Chitinases: An Example of Neofunctionalization in Legumes. Plant Physiology, 144(2), 662–672.

23- Zhang, H., Huang, X., Fukamizo, T., Muthukrishnan, S., & Kramer, K. J. (2002). Site-directed mutagenesis and functional analysis of an active site tryptophan of insect chitinase. Insect Biochemistry and Molecular Biology, 32(11), 1477–1488.