نوع مقاله: مقاله پژوهشی

نویسندگان

دانشگاه علوم کشاورزی و منابع طبیعی گرگان، دانشکده شیلات و محیط زیست، گروه شیلات

چکیده

در این تحقیق جمعیت ماهی گل چراغ (Garra rufa) در دو استان فارس و کهگیلویه و بویراحمد (رودخانه های شاهپور و بریم) با استفاده از شش جایگاه ریزماهوراه مورد مطالعه قرار گرفت. در این بررسی از 60 نمونه (30 عدد برای هر رودخانه) استفاده شد. میانگین تعداد الل در سطح جمعیت ها 5/13 بود که از میانگین گزارش شده برای ماهیان آب شیرین بالاتر بود. میانگین هتروزیگوسیتی مشاهده شده و مورد انتظار به ترتیب 658/0 و 865/0 بدست آمد. بیشتر مناطق انحراف از تعادل هاردی – واینبرگ را نشان داد. با توجه به میزان جریان ژنی بالا (205/18Nm= ) بین دو منطقه و Fst پایین (036/0Fst = ) به نظر می رسد تمایز پایینی بین جمعیت های این گونه در مناطق مورد بررسی وجود دارد. آنالیز واریانس مولکولی نشان داد که تنوع ژنتیکی پایینی بین جمعیت ها وجود داشته و بخش عمده تنوع مشاهده شده مربوط به درون جمعیت ها می باشد

کلیدواژه‌ها

عنوان مقاله [English]

Genetic comparison of Garra rufa (Heckel, 1843) in Shahpour (Kazeron) and Berim (Gachsaran) rivers by using microsatellite markers

نویسندگان [English]

  • Seyed Ali Akbar Hedayati
  • Ghasem Askari
  • Ali Shabani
  • Zahra Soltanifar

Fishery Dept., Gorgan University of Agricultural Sciences and Natural Resources, Gorgan, I.R. of Iran

چکیده [English]

In this study, Population of Garra rufa was investigated using six microsatellite loci in Fars and Kohgiluyeh and Boyer-Ahmad province (Shahpour and Berim Rivers). In this study fulfilled on 60 Garra individuals (30 individuals for each river). The mean number of allele’s level at the population was 13.5 which are more than the reported values for freshwater fishes. The expected and observed heterozygosity were 0.658 and 0.865, respectively. Most cases deviated significantly from Hardy-Weinberg equilibrium (p≤0.01). It seems that there is a low differentiation between two populations of this species in the studied areas due to high level of gene flow (Nm=18.205) between two regions and low Fst (0.036). Also, analysis of molecular variance showed there is low genetic variation among populations and most of the observed variation is within the populations.
a low differentiation between two populations of this species in the studied areas due to high level of gene flow (Nm=18.205) between two regions and low Fst (0.036). Also, analysis of molecular variance showed there is low genetic variation among populations and most of the observed variation is within the populations.

کلیدواژه‌ها [English]

  • Gol Cheragh
  • Genetic diversity
  • microsatellite
  • Garra rufa

مقایسه ژنتیکی ماهی گل­چراغ Garra rufa (Heckel, 1843) در رودخانه­های شاپور (کازرون) و بریم (گچساران) با استفاده از نشانگرهای ریزماهواره

سید علی اکبر هدایتی، علی شعبانی*، قاسم عسکری و زهرا سلطانی­فر

گرگان، دانشگاه علوم کشاورزی و منابع طبیعی گرگان، دانشکده شیلات و محیط زیست، گروه شیلات

تاریخ دریافت: 31/2/92                تاریخ پذیرش: 23/9/93

چکیده

در این تحقیق جمعیت ماهی گل چراغ (Garra rufa) در دو استان فارس و کهگیلویه و بویراحمد (رودخانه های شاهپور و بریم) با استفاده از شش جایگاه ریزماهوراه مورد مطالعه قرار گرفت. از 60 نمونه (30 عدد برای هر رودخانه) استفاده شد. میانگین تعداد آلل در سطح جمعیتها 5/13 بود که از میانگین گزارش شده برای ماهیان آب شیرین بالاتر بود. میانگین هتروزیگوسیتی مشاهده شده و مورد انتظار به ترتیب 658/0 و 865/0 به دست آمد. بیشتر مناطق انحراف از تعادل هاردی – واینبرگ را نشان داد. با توجه به میزان جریان ژنی بالا (205/18Nm= ) بین دو منطقه و Fst پایین (036/0Fst = ) به نظر می رسد تمایز پایینی بین جمعیتهای این گونه در مناطق مورد بررسی وجود دارد. آنالیز واریانس مولکولی نشان داد که تمایز ژنتیکی پایینی بین دو جمعیت وجود داشته و بخش عمده تنوع مشاهده شده مربوط به درون جمعیتها می باشد.

واژه های کلیدی: گل چراغ، تنوع ژنتیکی، ریزماهواره، Garra rufa

* نویسنده مسئول، تلفن: 09113715796 ، پست الکترونیکی: shabani@gau.ac.ir

مقدمه

 

جنس Garra  از خانواده کپور ماهیان و در بر گیرنده 74 گونه با پراکنش وسیع در آسیا و آفریقا می باشد. یکی از این گونه هاGarrarufa  می باشد که از حوضه دجله، خلیج فارس، دریاچه مهارلو، حوضه رودخانه کر و هرمزگان گزارش گردیده است (1). در فارسی نام متعارف این ماهی سنگ لیس و ماهی سنگی می باشد. به طور معمول در رودخانه های کوهستانی با بستری قلوه سنگی و سایر آبها یافت می شود (1). تنوع ژنتیکی تحت تأثیر عوامل متعددی است و این عوامل در جمعیتهای مختلف متفاوت می باشد. یکی از مهمترین عوامل ایجاد تنوع ژنتیکی در بین جمعیتها جدایی جغرافیایی این جمعیتهای از همدیگر می باشد. پراکنش جغرافیایی متفاوت بر الگوی توزیع جغرافیایی تبارها از طریق تبادل ژنی تأثیر گذاشته که می تواند بر تقسیم شدگی و جدایی جمعیتها، اندازه جمعیت موثر (Ne) و تنوع ژنتیکی تأثیرگذار باشد (2). موانع جغرافیایی مانند کوهستانها و رودخانه ها نیز باعث تقسیم شدن یک جمعیت پیوسته به چندین جمعیت کوچکتر می­گردد (2).

ریزماهواره ها و یا توالیهای تکرار شونده ژنوم، نوع بی نظیری از تکرارهای پشت سرهم توالیهای ژنومی هستند که به فراوانی در طول ژنوم پراکنده شده اند. ریزماهواره ها به علت سطح بالای چند شکلی، میزان بالای جهش، هم بارزی، تعداد زیاد و پراکنش بالای ژنومی یکی از بهترین نشانگرهای ژنتیکی برای مطالعات جمعیتی بوده و امکان استفاده از نشانگرهای ریزماهواره یک گونه برای گونه های نزدیک به آن این نشانگرها را به نشانگر مناسبی برای مطالعات ژنتیک جمعیت تبدیل نموده است (12). نشانگرهای ریزماهواره در سال های اخیر برای مطالعه ساختار ژنتیکی جمعیت ماهیان در ایران مورد استفاده قرار می گیرد. کشیری و همکاران (1391) در بررسی ساختار ژنتیکی ماهی کلمه در استان گلستان از 10 جایگاه ریزماهواره استفاده نمودند(12). قدسی و همکارن (1390) با استفاده از نشانگرهای ریزماهواره به بررسی ساختار ژنتیکی کفال طلایی در سواحل استان گلستان پرداخته و وجود علائمی از تنگنای ژنتیکی را در جمعیتهای مورد بررسی گزارش نمودند(7). قلیچ پور و همکاران (1389) در بررسی ساختار ژنتیکی دو جمعیت کپور معمولی از 8 جایگاه ریز ماهواره استفاده نمودند و تنوع ژنتیکی بالایی را در بین جمعیتها نشان دادند (8).

با وجود پراکنش وسیع این گونه در ایران تاکنون هیچ گونه مطالعات ژنتیکی در ارتباط با ساختار ژنتیکی و تنوع ژنتیکی آن صورت نگرفته است. دو رودخانه مورد بررسی از نظر موقعیت جغرافیایی به گونه ای بوده که از لحاظ حوزه آبی هیچ گونه ارتباط آبی با یکدیگر نداشته، در نتیجه به نظر می رسد که تنها عوامل جدایی جمعیت می تواند بر تنوع ژنتیکی این جمعیتها اثر گذار بوده باشد. هدف از این بررسی تعیین تنوع ژنتیکی جمعیتهای مورد بررسی در مناطق مورد مطالعه تحت تأثیر گذشت زمان می باشد.

مواد و روشها

تعداد 60 قطعه ماهی از دو رودخانه شاهپور [(کازرون )( طول جغرافیایی //33 /33 °51 شرقی و عرض جغرافیایی //91 /45 °29 شمالی)] و رودخانه بریم [(گچساران)(طول جغرافیایی//32 /15 °51 شرقی و عرض جغرافیایی//88 /19 °30 شمالی)]  در پاییز سال 1390 صید گردید (شکل 1). میزان 5 – 3 گرم باله ماهیان صید شده در اتانول 96 درصد فیکس شده و به آزمایشگاه بیوتکنولوژی انتقال داده شد. استخراج DNA به روش فنول- کلروفرم انجام گردید (10). DNA استخراجی تا زمان استفاده در فریزر 20- نگهداری شد. کیفیت و کمیت DNA استخراجی با استفاده از ژل آگارز و روش اسپکتوفتومتری تعیین گردید (19).

 

شکل 1- موقعیت جغرافیایی مناطق نمونه برداری

به منظور بررسی ساختار ژنتیکی و تنوع آن در مناطق مورد بررسی از شش جایگاه ریزماهواره MFW17، GGM-045، GGM002، GGM034، GGM024، GGM027 استفاده شد (4 و 14)(جدول 1). واکنش زنجیره پلی مراز(PCR) برای هر یک از آغازگرها انجام و بهترین دمای الحاق برای هر یک مشخص گردید. تکثیر جایگاههای ژنی با استفاده از واکنش زنجیره ای پلیمراز در حجم 25 میکرولیتری و شرایطی شامل 25 نانوگرم DNA، 5/0 میکرومولار از هر پرایمر، 400 میکرومولار  نوکلئوتیدها، یک واحد بین المللی تگ DNA پلیمراز، بافر 1X PCR، 5/1 میلی مولار کلرید منیزیم و آب مقطر تا رسیدن به حجم انجام شد. سیکل دمایی برای هر جایگاه عبارت بود از 3 دقیقه در 94 درجه سانتی گراد، در ادامه 35 چرخه شامل 94 درجه برای 30 ثانیه، درجه حرارت اتصال 30 ثانیه و 72 درجه برای 1 دقیقه، با یک بسط نهایی 72 درجه برای 3 دقیقه. محصول زنجیره پلی مراز بر روی ژل اکریل آمید 8 درصد (غیر یونیزه شده) جداسازی و به وسیله روش نیترات نقره رنگ آمیزی گردید (3). ژل رنگ آمیزی شده با استفاده از دستگاه مستند ساز ژل مورد عکسبرداری قرار گرفت و به وسیله نرم افزار Gel pro analyzer طول قطعات باندها محاسبه گردید.

 

 

جدول 1- خصوصیات جایگاه ژنی مورد استفاده در این تحقیق

جایگاه ژنی

وزن (جفت باز)

تعداد الل

پرایمر

دمای اتصال

MFW17 

200 – 168

8

F: CTCAACTACAGAGAAATTTCATC

R: GAAATGGTACATGACCTCAAG

46

GGM034 

184 – 132

11

F:CGCGCAAGTTTCTTTCAGTT

R:GCTGTGAGACAAGCCTAAACC

56

GGM 024 

208 – 128

16

F:TCCCTCTTTTTGCTCTCAGG

R:TAGGTGAACAAATGGCATGG

52

GGM002

336 – 200

24

F:CACTTTGTCCTTGCCATTGA

R:CTCAACACCGTGGACTCTCA

55

GGM-045 

200 – 156

11

F:TCTCATGGGTCTCTGGGTTC

R:TGTGCAGAAAGGCTGTTGAG

53

GGM 027 

248 – 180

12

F:TCGGTGCACCCCTAGTAAAC

R:CCAAGTGTGTGTTTGGATGG

54

 

تعداد الل در هر جایگاه ژنی، هتروزیگوسیتی مشاهده شده (Ho)، هتروزیگوسیتی مورد انتظار (He)، تعداد آللهای واقعی (Na)، تعداد الل موثر (Ne)، تعادل هاردی- واینبرگ، مقادیر Fst، تست معنی دار بودن احتمال کسری هتروزیگوسیتی یا زیاد بودن هتروزیگوسیتی و جریان ژنی با استفاده از نرم افزار Genealex ver.6.5 (17 و 18) محاسبه گردید. برای تعیین تفاوت بین دو منطقه در مقادیر هتروزیگوسیتی مشاهده شده (Ho)، مورد انتظار (He) و تنوع آللی از آزمون ویلکاکسون غیر پارامتریک در نرم افزار SPSS ver.16 استفاده شد(24). برای  تعیین میزان تنوع ژنتیکی درون و بین جمعیتی و همچنین میزان تمایز بین جمعیتی بر اساس مدل آللی بی نهایت (Fst) با استفاده از آنالیز واریانس مولکولی (AMOVA) بسته نرم افزار Genealex مورد استفاده قرار گرفت. به منظور تعیین فاصله و شباهت ژنتیکی (16) و رابطه فیلوژنیک جمعیتها از نرم افزار PopGene استفاده شد (23).

نتایج

در این پژوهش از 6 جایگاه ژنی استفاده گردید که همگی پلی مورف بودند. متوسط تعداد آلل مشاهده شده در دو جمعیت رودخانه شاهپور و بریم به ترتیب 14 و 13 به دست آمد. کمترین وبیشترین میزان آلل مشاهده شده به ترتیب 7 و 24 برای جایگاههای MFW17 و GGM002 (رودخانه بریم) مشاهده گردید. متوسط میزان آلل مؤثر نیز برای دو جمعیت شاهپور و بریم به ترتیب 6/9 و 8/8 به دست آمد که کمترین و بیشترین میزان آن به ترتیب برای جایگاههای MFW17 (15/4) و GGM002 (89/18) رودخانه بریم به دست آمد. میزان آلل مشاهده شده (Na)، مورد انتظار (Ne)، هتروزیگوسیتی مشاهده شده  (HO)، هتروزیگوسیتی مورد انتظار (He) و شاخص درون آمیزی (Fis) در جدول 2 آورده شده است.

متوسط شاخص Fst در بین مناطق مورد بررسی 036/0 به دست آمد و در سطح جایگاههای ژنی کمترین و بیشترین میزان آن به ترتیب برای دو جایگاه GGM002 (005/0) و GM027 (049/0) محاسبه گردید. متوسط جریان ژنی (Nm) بین مناطق 205/18 به دست آمد که کمترین و بیشترین میزان آن به ترتیب برای جایگاه های GM027 (841/4) و  GGM002 (821/52) محاسبه گردید (جدول 3).

بر اساس نتایج آنالیز واریانس مولکولی و شاخص Fst در سطح 99 درصد نشان داد که تنوع ژنتیکی بالایی (96 درصد) در درون جمعیتها و تنوع پایینی (4 درصد) در بین جمعیتها وجود دارد (شکل 2). میزان شباهت و فاصله ژنتیکی نیز بر اساس شاخص Nei به ترتیب 642/0 و 443/0 به دست آمد و بر اساس شاخص فاصله ژنتیکی، دندروگرام UPGMA نشان داد که این دو منطقه در دو شاخه مجزا قرار دارند.


 

شکل 2- توزیع تنوع ژنتیکی بر اساس معیار Fst

 

 

MFW17 

GGM034 

GGM 024 

GGM002 

GGM-045 

GGM 027 

 

رودخانه بریم

Na

7

11

15

24

11

8

Ne

159/4

502/7

346/12

892/18

244/5

709/4

Ho

250/0

714/0

857/0

964/0

714/0

429/0

He

760/0

867/0

919/0

947/0

809/0

788/0

FIS

671/0

176/0

067/0

018/0-

117/0

456/0

pHw

***

***

**

ns

ns

***

رودخانه شاهپور

Na

9

10

17

23

11

15

Ne

426/6

502/5

701/11

505/16

840/7

800/9

Ho

393/0

429/0

857/0

000/1

929/0

357/0

He

844/0

818/0

915/0

939/0

872/0

898/0

FIS

535/0

476/0

063/0

064/0-

064/0-

602/0

pHw

***

***

*

ns

***

***

 

جدول2- تنوع ژنتیکی جایگاههای ژنی مورد استفاده در جمعیتهای مورد بررسی

 

 

 

 

 

 

 

 

 

Na

: تعداد آلل، Ne: تعداد آلل موثر، HO: هتروزیگوسیتی مشاهده شده، He: هتروزیگوسیتی مورد انتظار،FIS: ضریب درون آمیزی، pHw: تست احتمال هاردی- واینبرگ (ns: عدم معنی داری، 05/0 ≥ P*، 01/0 ≥ P**، 001/0 ≥ P***).

جدول 3- میزان جریان ژنی (Nm) و تمایز (Fst) در سطح شش جایگاه ژنی مورد استفاده

جایگاه ژنی

MFW17 

GGM034 

GGM 024 

GGM002 

GGM-045 

GGM 027 

میانگین

Nm

986/6

605/6

250/31

821/52

727/6

841/4

205/18

Fst 

035/0

036/0

008/0

005/0

036/0

049/0

028/0

                                                                                                                                                                  


بحث

در این پژوهش تنوع ژنتیکی ماهی گل چراغ
(Garra rufa) در شش جایگاه ریزماهواره در دو رودخانه شاهپور شهرستان کازرون و بریم شهرستان گچساران واقع در دو استان فارس و کهگیلویه و بویراحمد مورد مطالعه قرار گرفت. بر اساس آنالیزهای موجود میانگین تعداد آلل مشاهده شده توسط 60 نمونه مورد استفاده 5/13 به دست آمد. این میزان تعداد آلل می تواند تحت تأثیر تعداد نمونه ها باشد، به همین جهت این امکان وجود دارد که در آزمایشات گوناگون با تعداد نمونه های متفاوت تعداد آلل های واقعی متفاوتی برای یک جایگاه معین به دست آید و وجود حداقل تعداد 30 نمونه می تواند تعداد آلل های واقعی را در بررسی های ریزماهواره نشان دهد (9، 17، 21).

 

 

شکل 3- جایگاه ژنی MFW17- رودخانه بریم

 

متوسط آلل مشاهده شده برای این گونه از میانگین گزارش شده برای ماهیان آب شیرین(5/7) بالاتر می باشد (6). میانگین هتروزیگوسیتی مشاهده شده در نمونه های رودخانه شاهپور بیش از رودخانه بریم بود، اما این میزان تفاوت معنی داری  را نشان نداد (P>0/05). این بالا بودن میانگین هتروزیگوسیتی می تواند تا حدودی بیانگر بالا بودن تنوع در رودخانه شاهپور باشد که خود می تواند به دلیل بهتر بودن شرایط زیست در این منطقه باشد. متوسط هتروزیگوسیتی در جمعیتهای مورد بررسی بیش از مقدار گزارش شده برای ماهیان آب شیرین می باشد. متوسط هتروزیگوسیتی مشاهده شده برای ماهیان آب شیرین 46/0 گزارش گردیده است (6). شاخص Fst بیان کننده توصیف تمایز جمعیت در سطوح مختلف ساختار ژنتیکی می باشد. بر اساس گزارش Wright (1978) هرگاه میزان Fst به دست آمده کمتر از 05/0 باشد، نشان دهنده وجود تمایز کم، بین 15/0 – 05/0 نشان دهنده تمایز متوسط و بالاتر از 15/0 نشان دهنده تمایز بالا در بین جمعیتها می باشد (22). شاخص Fst به دست آمده (036/0) کمتر از 05/0 بوده و بیانگر این مطلب می باشد که تمایز ژنتیکی پایینی بین این دو منطقه وجود دارد. از نظر جغرافیایی دو رودخانه مورد بررسی هیچ گونه ارتباط آبی با یکدیگر نداشته و این نتایج بیان کننده وجود دو جمعیت مجزا و بسته بوده که دارای تبادلات ژنی درونی می باشند.

در بررسی تعادل هاردی – واینبرگ برای هر دو منطقه، بیشتر جایگاهها انحراف از تعادل را نشان دادند (P<0.001). Israel و همکاران (2004) عدم تعادل معنی دار را به دلیل وجود ذخایر متعدد از آن گونه دانستند که بیان کننده وجود یک یا چند جمعیت تخم ریز می باشد (11). Zhao و همکاران (2005) این انحراف را ناشی از وجود آلل های صفر که پهلوگیری در آنها صورت نمی پذیرد دانست (25). Shao و همکاران (2002) انحراف از تعادل را مهاجرت ماهیان مولد و وجود آمیزشهای خویشاوندی در بین گونه ها و جمعیتها عنوان نمود (20). Dahle و همکاران (2006) انحراف از تعادل را ناکافی بودن تعداد نمونه ها و خطای نمونه برداری بیان نمودند (5). در این پژوهش خروج از تعادل را می توان به دلیل استفاده از آغازگرهای غیر اختصاصی، وجود آلل صفر و احتمالاً کم بودن نمونه ها عنوان نمود.

سازگاری و بقای یک گونه زمانی حفظ می گردد که تنوع ژنتیکی موجود از بین نرود (15). با توجه به ارزیابی مقادیر به دست آمده از فراوانی اللی، هتروزیگوسیتی، تعادل هاردی – واینبرگ، شاخص Fst و ترسیم دندروگرام ماهی گل چراغ در مناطق نمونه برداری می توان نتیجه گیری نمود که دو جمعیت مجزا در این مناطق وجود دارد. از این رو برای اجرای برنامه­های حفاظتی این گونه باید به ساختار جمعیت­های محلی توجه گردد. همچنین این مطالعه نشان داد که از نشانگرهای ریزماهواره می توان در مطالعه گونه هایی با خویشاوندی نزدیک استفاده نمود. بر اساس آنالیز های موجود به نظر می رسد، گونه  Garra rufa دارای تنوع ژنتیکی مطلوبی در مناطق مورد بررسی است و با توجه به اهمیت اکولوژیک این گونه در پالایش رودخانه ها و اخیرا استفاده های تجاری، حفظ تنوع ژنتیکی آن  لازم و ضروری به نظر می رسد. 

1-      عبدلی، ا.( 1378) ماهیان آبهای داخلی ایران. انتشارات موزه طبیعت و حیات وحش ایران، تهران.

2-      فریلند، ج.(1389) بوم شناسی مولکولی. ترجمه ملکیان، م.، انتشارات دانشگاه مشهد، مشهد.

 

3-       Bassam, B. J., Caetano-Anolles, G. and Gresshoff, G. M. 1991. Fast and sensitive silver staining of DNA in polyacrylamide gels. Annual Biochemistry 84: 680-683.

4-       Crooijmans, R. P. M. A., Bierbooms, V. A. F., Komen, J., Van der poal, J. J. and Groenen, M. A. M. 1997. Microsatellite markers in common carp (Cyprinus carpio L.). Animal genetics 28:129-134.

5-       Dahle, G.., Jorstad, K. E., Rusaas, H. E. and Ottera, H. 2006. Genetic characteristics of brood stock collected from four Norwegian coastal cod (Gadus morhua) populations. ICES Journal of Marine Science. 63, 209-215.

6-       Dewoody, J. A. and Avise, J. C. 2000. Microsatellite variation in marine, freshwater and anadromous fishes compared with other animals. Fish biology 56: 461-473.

7-       Ghodsi, Z., Shabani, A., Shabanpour, B. 2011. Genetic diversity of Liza aurata (Risso, 1810) inthe coastal regions of Golstan province, using microsatellite marker. Taxonomy and Biosystematics 6: 35 – 47.

8-       Ghelichpour, M., Shabani, A., Shabanpour, B. 2010. Genetic diversity of the two populations of Common carp (Cyprinus carpio) in Gharahsu and Anzali regions using eight microsatellite markers. Taxonomy and Biosystematics. 5: 39-49.

9-       Goldstein, D.B. and Schlotterer, C. 1999. Microsatellites: Evolution and Applications. Oxford University Press, New York, 368 p.

10-   Hillis D.M., Mortiz C., Mable B.K., 1996. Molecular systematic Sinauer Association Inc. Sunderland, MA. 655P.

11-   Israel, J., Cordes, J. F., Blumberg, M. A and May, B. 2004. Geographic pattern of genetic differentiation among collections of green sturgeon, North America Journal of Fisheries Management. 24: 922-931.

12-   Kashiri, H., Shabani, A., Shabanpoor, B. Genetic diversity of caspian roach (Rutilus rutilus caspicus) in gharesou and gomishan regions using microsatellite. Journal Iranian biology.25:139-147.

13-   Li, J., Wang, G. and Bai, Z. 2009. Genetic variability in four wild and two farmed stocks of the Chinese freshwater pearl mussel (Hyriopsis cuminggii) estimated by microsatellite DNA. Aquaculture. 287: 286-291.

14-   Matura, R., Sharma, S., Barat, A., Pande, V and Mahanta, P., 2012. Development and characterization of microsatellite markers in Garra gotyla (Family: Cyprinidae, Pisces). In press.

15-   Meffe, G. K., and Carroll, C. R. 1997. Genetic conservation of diversity within species in principles of conservation biology, eds. G. K. Meffe C. R. Carrol, pp. 161-21. Sunderland, Ma: Sinauer Associates, Inc: Publisher.

16-   Nei, M. 1978. Estimation of average heterozygosity and genetic distance from small number of individuals. Genetics 89: 583-590.

17-   Peakall, R. and Smouse P.E. 2012. GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research-an update. Bioinformatics In press. 

18-   Peakall, R., Smouse, P. E., 2006. Gene Alex 6: Genetic Analysis in Excel. Population genetic software for teaching and research. Molecular Ecology and Systemic. 28: 105-128.

19-   Sambrok J., Fritsch E.F., Maniatis, T. 1989. Electrophoresis of RNA through gels containing formaldehyde: Molecular Cloning, 2nd edn. Cold Spring Harbor, NY: CSH Laboratory Press. 743-745.

20-   Shao, ZJ., Zhao, N., Zhu, B., Zhou, FL., Chang, JG. 2002. Application of microsatellite primers developed from shovelnose sturgeon in Chinese sturgeon. Acta Hydrobiologyca Siniea, 26: 577-584.

21-   Silva, E.P., Russo, C.A.M. 2000. Techniques and statistical data analysis in molecular population genetics. Hydrobiologia, 420: 119–135.

22-   Wright, S. 1978. Evolution and the genetics of populations variability within and among natural populations. University of Chicago Press. 2nd Ed., University of Chicago Press, Chicago.

23-   Yeh, F. C., Yang, R. C. and Boyle, T. 1999).  POPGENE version 1.3.1. Microsoft Window-bases Freeware for population Genetic Analysis. Retrieved from http://www.uallberta.ca/fyeh. On: 11 September 2008.

24-   Zar, J. H. 1999. Biostatistical analysis, 4th Ed, Prentice Hall, Upper Saddle River, New Jersey.

25-   Zhao, N., Ai, W., Shao, Z., Zhu, B., Brosse, S and Chang, j. 2005. Microsattelite assessment of Chinese sturgeon (Asipenser sinenis gray) genetic variability. Ichthyology. 21:7-13.