نوع مقاله: مقاله پژوهشی

نویسندگان

1 دانشکده پزشکی مشهد

2 پژوهشگاه ژنتیک

3 دانشگاه لرستان

چکیده

با توجه به افزایش سطح محصولات دست ورزی شده ژنتیکی، شناسایی و تعیین سطح کمی آنها با روش‌های مطمئن و حساس ضروری می‌باشد. در ایران بخش عمده سویای مصرفی، وارداتی و از نوع تراریخت می‌باشد. در این مطالعه از روش‌های مولکولی جهت شناسایی کیفی و کمی بذور سویای تراریخت مقاوم به رانداپ در سطوح مختلف شامل تعیین نوع تراژن بکار رفته، سازه‌های ژنی و رخداد اختصاصی سویای مقاوم به رانداپ استفاده شده است. در ابتدا با استفاده از چندین جفت آغازگر مربوط به عناصر تراژن، آنالیزهای مولکولی غربال‌گری در سطح کیفی انجام گردید. در ادامه، آنالیزهای نیمه کمی برای سری رقت‌های مختلفی از ِDNA بدست آمده از این بذور تراریخت با همان جفت آغازگرها نسبت به قطعه تکثیر یافته با آغازگرهای ژن کنترل اختصاصی سویا (لکتین) نیز انجام شد. بدین ترتیب، میزان حد آستانه مختلفی برای شناسایی این عناصر بدست آمد بطوری که در سنجش مبتنی بر توالی پیش بر 35S نسبت به ژن خانه دار لکتین، میزان 1% و در سنجش مبتنی بر توالی‌های پایان دهنده nos و cp4 epsps نسبت به ژن خانه دار لکتین میزان 5/0% و در نهایت در سنجش مبتنی بر توالی‌های سازه ژنی CTP-35S)) و رخداد اختصاصی سویا pDNA-35S))،میزان 5% را نشان داد. بطور کلی، حساسیت آزمون نیمه کمی برای توالی‌های پایان دهنده nos و cp4 epsps با استفاده از روش زنجیره ای پلی مراز معمولی بیشتر از سایر عناصر بوده است. بنابراین این روش می‌تواند جهت شناسایی و غربال‌گری سریع نمونه‌ها و محموله های حاوی سویای تراریخت مقاوم به رانداپ به کار رود.

کلیدواژه‌ها

عنوان مقاله [English]

Detection of Transgenic Roundup Ready Soybean Seeds by Molecular Methods

چکیده [English]

As genetically modified organisms (GMOs) development is now increasing, detection and determination of their quantitative threshold using reliable and sensitive methods would be necessary. The aim of this study was to introduce reliable methods for qualitative and quantitative detection of Roundup-tolerant soybean particularly at event level via molecular approaches. For primary screening, we used polymerase chain reaction with several element–specific primers for detection of different percent of transgenic and non-transgenic Roundup ready soybean seed samples. Furthermore, semi-quantitative assays were performed using the same primers in combinations with soybean lectin-specific primers. The limit of detection (LOD) obtained for CTP-35S construct and event-specific (pDNA-35S) was 5%. This index for cp4 epsps and nos terminator sequences was 0.5% and for CaMV 35S promoter was 1%. Results showed that the sensitivity of analysis for nos terminator and cp4 epsps sequences was more than other elements and therefore, this method could be applied for rapid screening of Roundup Ready transgenic soybean samples.

کلیدواژه‌ها [English]

  • Genetically modified plants
  • Roundup ready (RR) soybean
  • Limit of detection
  • Event
  • epsps

شناسایی بذور سویای تراریخت مقاوم به رانداپ با استفاده از روشهای مولکولی 

الهام قاضی زاده1، امیر موسوی1*، فرانک هادی2 و هاله هاشمی سهی1

1 تهران، پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری، پژوهشکده بیوتکنولوژی گیاهی 

2 خرم آباد، دانشگاه لرستان، دانشکده علوم، گروه زیست شناسی

تاریخ دریافت: 5/2/92                 تاریخ پذیرش: 14/8/93 

چکیده

با توجه به افزایش سطح محصولات دست ورزی شده ژنتیکی، شناسایی و تعیین سطح کمی آنها با روشهای مطمئن و حساس ضروری می­باشد. در ایران بخش عمده سویای مصرفی، وارداتی و از نوع تراریخت می­باشد. در این مطالعه از روشهای مولکولی جهت شناسایی کیفی و کمی بذور سویای تراریخت مقاوم به رانداپ در سطوح مختلف شامل تعیین نوع تراژن بکار رفته، سازه­های ژنی و رخداد اختصاصی سویای مقاوم به رانداپ استفاده شده است. در ابتدا با استفاده از چندین جفت آغازگر مربوط به عناصر تراژن، آنالیزهای مولکولی غربال­گری در سطح کیفی انجام گردید. در ادامه، آنالیزهای نیمه کمی برای سری رقتهای مختلفی از ِDNA به دست آمده از این بذور تراریخت با همان جفت آغازگرها نسبت به قطعه تکثیر یافته با آغازگرهای ژن کنترل اختصاصی سویا (لکتین) نیز انجام شد. بدین ترتیب، میزان حد آستانه مختلفی برای شناسایی این عناصر به دست آمد به طوری که در سنجش مبتنی بر توالی پیش بر 35S نسبت به ژن خانه دار لکتین، میزان 1 درصد و در سنجش مبتنی بر توالیهای پایان دهنده NOS و cp4 epsps نسبت به ژن خانه دار لکتین میزان 5/0 درصد و در نهایت در سنجش مبتنی بر توالیهای سازه ژنی CTP-35S)) و رخداد اختصاصی سویا pDNA-35S))،میزان 5 درصد را نشان داد. به طور کلی، حساسیت آزمون نیمه کمی برای توالیهای پایان دهنده NOS و cp4 epsps با استفاده از روش زنجیره ای پلی مراز معمولی بیشتر از سایر عناصر بوده است. بنابراین این روش می­تواند جهت شناسایی و غربال­گری سریع نمونه­ها و محموله های حاوی سویای تراریخت مقاوم به رانداپ به کار رود.

واژه­های کلیدی: گیاهان دست ورزی شده ژنتیکی، سویای مقاوم به رانداپ، حد آستانه تشخیص، رخداد،epsps

* نویسنده مسئول، تلفن: 02144787368، پست الکترونیکی:  m-amir@nigeb.ac.ir 

مقدمه

 

امروزه تولید گیاهان تراریخت از عمده ترین کاربردهای زیست فناوری در کشاورزی می­باشد. در حال حاضر، انتقال ژن از طریق مهندسی ژنتیک و تولید گیاهان تراریخت در مواردی همچون مقاومت به آفات، علف­کشها، بیماریها، بهبود کیفیت محصولات و تولید مواد دارویی با سرعت زیادی رو به افزایش است. سطح زیر کشت این قبیل گیاهان در جهان طی سالهای اخیر با روند تصاعدی افزایش یافته، به طوری که کشت گیاهان تراریخت با سطح زیر کشت در حدود 7/1 میلیون هکتار در سال 1996 بلافاصله بعد از تولید آنها آغاز شد و در سال 2012 سطح زیر کشت این گیاهان 170 میلیون هکتار در جهان گزارش گردیده است. 59 درصد این مساحت یعنی حدود 100 میلیون هکتار مربوط به گیاهان دارای صفت مقاومت به علف­کش است. پس از آن صفت مقاومت توأم به علف کش و آفات و صفت مقاومت به آفات به تنهایی در اولویت قرار دارند. (10) البته چیزی کمتر از یک درصد نیز، سایر صفات تراریختی را به خود اختصاص می­دهد. در حال حاضر، بسیاری از بذور گیاهان و مشتقات تراریخت آنها، در بازارهای جهانی وجود دارند. انتظار می رود که زیست فناوری و مهندسی ژنتیک نقش عمده ای را از نظر امنیت غذایی در 30 سال آینده داشته باشد (2) تا به امروز اثر منفی قابل توجهی از مشتقات غذایی تراریخت مورد تأیید قرار گرفته بر روی سلامت انسانی و حیوانات تغذیه کننده از آنها (به جز تاثیر احتمالی آلرژیکی تعداد محدودی از پروتئینهای آفت کش) اعلام نشده است (6 و 7). با این وجود، برای حفظ سلامت جامعه و محیط زیست و همچنین به دلیل اهمیت سلامت روانی مصرف کنندگان و دادن حق انتخاب به آنها برای استفاده از این محصولات، دولتها قوانینی را در جهت نظارت بر روی تولید و جابه جایی بذور ترایخت و استفاده از آنها در فرآورده­ها و مشتقات غذایی وضع کرده اند. به این منظور پروتوکلی تحت عنوان "کارتاهنا" تصویب گردیده است که در آن اثرات احتمالی رها سازی موجودات دست ورزی شده ژنتیکی GMOs)) در جامعه، بر سلامت انسانی و مصرف کنندگان مطرح شده است. لذا، بر طبق این پروتکل و برای کنترل دقیق تر بر نحوه جابجایی محصولات GM در دراز مدت، و به منظور کنترل در تولید و مصرف بذور و مشتقات تراریخت و همچنین برای رعایت حقوق مصرف کنندگان برای اطلاع از تراریختی مواد غذایی موجود در بازار، کمیسیون استاندارد اروپا، تمامی زیرواحدهای اروپایی را وادار به برچسب دار کردن محصولات حاوی مقادیر بالاتر از 9/0 درصد ازDNA  تراژن کرده­اند (11). هر چند برچسب دار کردن محصولات تراژن در این حد توسط بسیاری از کشورها اختیاری بوده است، اما اکثر کشورهای مصرف کننده و تولید کننده محصولات تراریخت آزمایشات جامع و حساسی را در زمینه تشخیص کیفی و کمی درصد عناصر تراژن در تبعیت از این قوانین انجام می­دهند (2 و 8).

عمده ترین صفت تراریخت، مقاومت به علف­کش گلایفوسیت بوده که در این بین سویای مقاوم به رانداپ جایگاه اول را به خود اختصاص داده است. شناسایی دقیق این محصول و مشتقات غذایی حاصل از آن در مبادی ورودی از مهم ترین مراحل کسب مجوزهای واردات آن به شمار می رود. در این بررسی در نظر است روشهای شناسایی کیفی و کمی بذور تراریخت سویا معرفی شده و محدوده حضور آنها در توده­های بذر عادی تعیین شود (3 و 5). به دلیل وجود حساسیت زیاد در آنالیز نتایج، چندین روش استخراج DNA مورد مقایسه قرار گرفته، همچنین به منظور بررسی حضور عناصر تراژن، از آنالیزهای غربال­گری براساس شناسایی توالیهای کنترل کننده بیان ژن و روشهای غربال­گری اختصاصی استفاده به عمل آمده است. این آنالیزها در سه سطح شامل نعیین نوع تراژن به کار رفته، سازه­های ژنی و رخداد اختصاصی سویای مقاوم به رانداپ انجام گردیده است. همچنین برای اولین بار، به منظور شناسایی دقیق و سریع سویای مقاوم به رانداپ، تشخیص کیفی عناصر تراژن به طور همزمان در سطح رخداد، با استفاده از واکنش زنجیره ای پلی­مراز دو و سه گانه انجام گردیده است. در نهایت، به منظور تعیین حد آستانه مجاز در بذور تراریخت، سنجش نیمه کمی برای تمامی عناصر تراژن انجام گردید که می­تواند به عنوان پروتکل مناسب و استانداردی برای کلیه نمونه­ها به کار گرفته شود.

مواد و روشها

مواد گیاهی: بذور گیاه سویا (Glycine max L.) تراریخت مقاوم به رانداپ از یک نمونه محموله بذر وارداتی توسط شرکت ژن آزما پرشیا و نمونه­های تیپ وحشی از مرکز تحقیقات دانه­های روغنی تهیه گردید.

روش استخراج DNA ژنومی: در این مرحله جهت به دست آوردن DNA الگو با کیفیت و کمیت مناسب از بافت بذری سویا، سه روش مختلف مورد ارزیابی و مقایسه قرار گرفت.

1 - روشWizard  بهینه شده: استخراج DNA با استفاده از روش معمول (9) که تأیید شده از طرف سازمان استاندارد جهانی است، انجام گردید، با این تفاوت که در بافر TNE،  BME یک درصد اضافه می­شود و بقیه مراحل کار همانند پروتکل اجرایی می باشد. 2- روش بهینه شدهCTAB : استخراج DNA با استفاده از روش ارائه شده توسط Jankiewicz و همکاران (11) که مورد تأیید سازمان استاندارد جهانی می­باشد، انجام شد، با این تفاوت که در بافرCTAB ،  BME  یک درصد اضافه می­شود و بقیه مراحل کار همانند روش ارائه شده انجام گردید. 3- استخراج با استفاده از کیت DNA ژنومی Bioneer (Daejeon, Korea): استخراج DNA با استفاده از این کیت طبق دستورالعمل ارائه شده انجام گردید. در تمامی این روشها، کیفیت و کمیت DNA استخراج شده به وسیله الکتروفورز بر روی ژل آگارز و اندازه گیری چگالی نوری از طریق روش اسپکتروفتومتری (اندازه گیری شدت جذب در طول موج و به دست آوردن نسبت 280/OD260OD)، مورد ارزیابی قرار گرفت.

 

جدول 1- مشخصات آغازگرهای استفاده شده در سنجش کیفی و نیمه کمی سویای تراریخت

منبع

اندازه محصول تکثیر یافته

توالی (5'à3')

اختصاصیت

نام آغازگر

7

195

GCTCCTACAATGCCATCAGATAGTGGGATTGTGTCGTC

پیش بر 35S

35S1-35S2

7

180

GAATCCTGTTGCCGGTCTTTGTTATCCTAGTTTGCGCGCTA

پایان دهنده NOS

NOS1-NOS3

11

447

GCCCTCTACTCCACCCCCATCCGCCCATCTGCAAAGCCTCTACA

ژن لکتین

GMO1-GMO2

12

507

CCTTCGCAAGACCCTTCCTCTATATGGCTGCCATGGCCTGCATG

35S-cp4 epsps

RR01-RR02

12

185

CCCCAAGTTCTTAAATCTTCAAGTTCGGGGCCGGCTGCTTGCA

CTP-cp4 epsps

RR04-RRO5

در این مقاله، مطالعه شده است

720

TGGCAAAATTCACTGGCA

 cp4 epsps1

Exp CP4 epsps

در این مقاله، مطالعه شده است

506

CATTCGAGCTTCTTCCGA

cp4 epsps2

 

CP4 EXP de

در این مقاله، مطالعه شده است

116

CATGCGTATTCCCATCTCA

رخداد

pDNA-35S

در این مقاله، مطالعه شده است

235

CATTACGGCAATTCGCTTAC

p35S  و توالی سیگنال پپتید ژن اختصاصی epsps

p35S –CTP


شناسایی کیفی مواد تراریخت: الف) واکنش زنجیره ای پلی­مراز با آغازگرهای اختصاصی: برای سنجش کیفی و کمی سویای رانداپ ردی، جفت آغازگرهای ارائه شده در جدول 1 انتخاب و مورد استفاده قرار گرفتند. برای تشخیص صحیح حضور سویای تراریخت، در ابتدا می­بایستی تکثیر ژن خانه دار لکتین (مربوط به سویا) بهینه سازی گردد. واکنش زنجیره ای پلیمراز برای ژن خانه دار لکتین، یکسان بودن تقریبی غلظت DNA در درصدهای مختلف بذور تراریخت و تیپ وحشی را تأیید می نماید. برای این منظور، جفت آغازگرهای GMO1 و GMO2 برای جداسازی بخش خارجی ژن لکتین (قطعه 447 جفت باز) به کار گرفته شد. در مرحله بعد، به منظور انجام روش غربال­گری برای این بذور، از جفت آغازگرهای  35S1و 35S2 (مربوط به پیش بر CaMV 35S) برای تکثیر قطعه 195 جفت بازی و آغازگرهای NOS1 و NOS3 (مربوط به پایان دهنده NOS) برای جدا کردن قطعه حدود 180 جفت بازی استفاده گردید (4 ،10 و 13). پس از آن، برای تشخیص تراریختی بذور سویا در سطح اختصاصی تراژن، از جفت آغازگر  Cp4 epsps(4) و در سطح اختصاصی سازه، از جفت آغازگر RR01 و RRO2 (5 و 13) و همچنین جهت شناسایی نوع رخداد(GTS 40-3-2) ، از جفت آغازگر pDNA-35S)) برای بخشی از ژنوم گیاه سویا و قسمتی از پیش بر 35S استفاده گردید. اجزا واکنش دهنده ای که برای هر واکنش زنجیره ای پلی­مراز به کار رفته است شامل 1X بافر PCR، 5/1 میلی­مولار MgCl2، 2 میلی­مولار dNTP، 5/0 واحد Taq polymerase، 5/0 پیکومول از هر آغازگر به همراه 20 نانوگرم ازDNA  استخراج شده، در حجم نهایی 20 میکرولیتر بوده است. شرایط دمایی مورد استفاده در واکنشهای زنجیره ای پلی­مراز در جدول 2 خلاصه شده است.

 

جدول 2- شرایط واکنش زنجیره ای پلی­مراز در سنجش کیفی و نیمه کمی سویای تراریخت

تعداد چرخه

دمای اتصال (درجه سانتی­گراد)

زمان واکنش

آغازگر

35

54  

 30 ثانیه 

35S1-35S2

35  

 56  

30 ثانیه

NOS1-NOS3

35

58

               30 ثانیه

GMO3-GMO4 

35

60

               1 دقیقه

RR01-RR02

35

60

               1 دقیقه

RR04-RRO5

40

6/58

               30 ثانیه

 cp4 epsps1

40

57

               30 ثانیه

cp4 epsps2 

35

65

               1 دقیقه

pDNA-35S

35

60

30 ثانیه

p35S-CTP

 


ب) واکنش زنجیره ای پلی­مراز داخلی (Nested PCR): برای انجام واکنش زنجیره ای پلی­مراز داخلی، از جفت آغازگر RRO4 و RRO5 استفاده گردید. محصول واکنش RRO1 وRRO2  به نسبت 10 برابر رقیق شده و از آن به عنوان الگو طبق شرایط دمایی و اجزا واکنش ارائه شده در بالا استفاده گردید. با این تفاوت که در مورد اخیر، تعداد چرخه ها، 25 دور می باشد. پس از آن، حدود 5 میکرولیتر از محصول واکنش دوم بر روی  ژل آگارز 2 درصد، الکتروفورز گردید.

ج) واکنش زنجیره ای پلی­مراز چند گانه : در این مرحله واکنشهای تکثیر دو گانه برای جفت آغازگر های GMO1-GMO2 + pDNA-35S با دمای اتصال 62 درجه سانتی گراد، جفت آغازگرهای GMO1-GMO2 + CaMV 35S با دمای بهینه اتصال 56 درجه و جفت آغازگرهای CaMV 35S + pDNA-35S با دمای بهینه اتصال 8/55 درجه انجام گردید و برای واکنش تکثیر سه گانه، از جفت آغازگرهایpDNA-35S  + CaMV 35S + GMO1-GMO2، با دمای اتصال 56 درجه استفاده به عمل آمد. محصولات واکنش برای بررسی بر روی ژل آگارز 2 درصد الکتروفورز شد. در ادامه برای تأیید دقیق تر، محصول PCR حاصل از توالی پیش بر CaMV 35S، با آنزیم محدودالاثر EcoRV مورد برش قرار گرفت. نتیجه واکنش حاصل از برش آنزیمی روی ژل آگارز یک درصد الکتروفورز گردید و حضور قطعه مورد انتظار تأیید شد.

ارزیابی نیمه کمی مواد تراریخت: در این مرحله، یک سری رقت­های مختلف از سویای مقاوم به رانداپ (100 تا 1/0 درصد) از طریق مخلوط کردن نمودن نمونه های تراریخت با سویای تیپ وحشی تهیه شد. این رقت ها به ترتیب شامل 100 درصد پودر سویای تراریخت، مخلوطهای 50 درصد پودر سویای تراریخت و50 درصد پودر سویای تیپ وحشی، 25 درصد پودر سویای تراریخت و 75 درصد پودر سویای تیپ وحشی، 5 درصد پودر سویای تراریخت و 95 درصد پودر سویای تیپ وحشی، 1 درصد پودر سویای تراریخت و 99 درصد پودر سویای تیپ وحشی بودند. پس از استخراج DNA، سنجش کمی نمونه­ها برای توالیهای پیش بر 35S (آغازگرهای 35S1 و 35S2)، توالی پایان دهنده NOS (آغازگرهای NOS1 و NOS3)، ژن cp4 epsps، سازه ژنی  p35S-CTPو توالیهای بخشی از تراژن و ژنوم میزبان (pDNA-35S) نسبت به ژن خانه­دار لکتین انجام گردید. شرایط بگونه ای در نظر گرفته شد که به طور همزمان در یک دستگاه ترموسیکلر و در دو ویال مجزا، واکنشهای زنجیره ای پلی­مراز ژن خانه­دار و عناصر مذکور انجام شد.

 

 

شکل 1- مقایسه الگوی الکتروفورزی DNA ژنومیک استخراج شده با روشهای CTAB و Wizard بهینه شده و کیتBioneer  بر روی ژل آگارز 1 درصد که به ترتیب با حروف a، b و c نشان داده شده اند. چاهکهای 1-5: به ترتیب DNA ژنومی به دست آمده از نمونه­های 1، 5، 25، 50 و 100 درصد تراریخت؛ چاهک 6: سویای تیپ وحشی؛ M: نشانگر وزن مولکولی100 bp ladder  (Fermentas).


نتایج

استخراجDNA  : با توجه به اینکه انجام واکنش زنجیره ای پلی­مراز برای سنجش کیفی و کمی وابسته به کیفیت و کمیتDNA استخراج شده می­باشد، سه روش استخراج DNA شامل CTAB و  Wizardو نیز کیت Bioneer برای رقتهای 1/0-100 درصد سویای تراریخت مورد استفاده قرار گرفت و خلوصDNA  استخراجی با روشهای مختلف با هم مقایسه گردید. نتایج نشان داد که تمامی نمونه­های استخراج شده با روش CTAB دارای غلظت و کیفیت مناسبی می­باشند. در عین حال، کیفیت DNA استخراج شده با استفاده از روش Wizard  بهینه شده بررسی و نسبت جذبی 260/280 برای تمامی نمونه­ها محاسبه شد که بین 7/1 تا 9/1 بود. بنابراین بهتر است برای تکثیر ژنهای اختصاصی سویا با آغازگرهای GMO1-GMO2 و  GMO3-GMO4 ازDNA  به دست آمده با این روش استفاده شود. در مقایسه، نسبت جذبی محاسبه شده برای  DNAاستخراج شده با روشCTAB ، در حدود 9/1 تا 2 بود که برای تکثیر تمامی توالیها در این مطالعه مناسب و قابل استفاده می­باشد. استخراج DNA بر اساس کیت Bioneer نسبت به دو روش قبل خلوص بهتر ولی مقدار کمتری ازDNA  استخراج شده را نشان داد (شکل 1).

تشخیص کیفی : سنجش کیفی برای توالیهای پیش بر  35Sو توالی لکتین (ژن خانه دار سویا)، 1cp4epsps (ژن اختصاصی سویای مقاوم به رانداپ) و سازه ژنی p35S-CTP و پایان دهنده NOS به وسیله واکنش زنجیره ای پلی­مراز انجام و نوار مربوط به تکثیر هر قطعه از توالی هدف جدا گردید (شکل 2). همچنین واکنش زنجیره ای پلی­مراز داخلی با استفاده از آغازگرهای RR04 وRR05 برای تکثیر محصول حاصل از آغازگرهای RR01 وRR02 که مربوط به قسمت پیوندگاه سازه ژنی سویای مقاوم به رانداپ است، انجام گردید. قطعات حاصل به ترتیب دارای اندازه­های 507 و 185 جفت باز بودند که دقت و صحت واکنش زنجیره ای پلی­مراز داخلی برای سازه ژنی سویای مقاوم به رانداپ را نشان می­دادند. همچنین برای آنالیز دقیق تر عناصر تراژن در بذور سویای مقاوم به رانداپ، از واکنش زنجیره ای پلی­مراز دوگانه برای عناصر ژن اختصاصی سویا + پیش بر (CaMV 35S-GMO1/GMO2)، ژن اختصاصی سویا + رخداد اختصاصی سویا (GMO1/GMO2-pDNA-35S)، و پیش بر35S  + رخداد اختصاصی سویا (CaMV 35S-pDNA-35S) استفاده به عمل آمد. همچنین، واکنش زنجیره ای پلی­مراز سه گانه برای ژن اختصاصی سویا + رخداد اختصاصی سویا + پیش بر 35S (GMO1/GMO2 pDNA-35S + CaMV 35S +) برای بذور 1 درصد سویای مقاوم به رانداپ، نیز انجام شد. در کنار واکنشهای PCR، کنترل منفی (آب مقطر) و کنترل مثبت برای لکتین (ناقل پلاسمیدیpGEM TA  حاوی ژن لکتین)، کنتری مثبت برای رخداد pDNA-35S ) ناقل پلاسمیدیpGEM TA  حاوی توالی رخداد) و کنترل مثبت برای CaMV 35S pBI121(Clontech)) برای تأیید صحت نتایج به کار گرفته شد. بدین ترتیب با قطعات منفرد و اختصاصی برای هر سه عنصر در بذور سویای 1 درصد تراریخت، توسط واکنش زنجیره ای پلی مراز چندگانه مشاهده شد (شکل 4).

 

شکل 2- الکتروفورز محصول PCR سویای مقاوم به رانداپ با آغازگرهای اختصاصی مختلف. M: نشانگر وزن مولکولی  bp ladder100 (Fermentas)؛ چاهک 1: محصول تکثیر قطعه 35S، چاهک 2: محصول تکثیر قطعه ژن اختصاصی سویا (لکتین)؛ چاهک 3: محصول تکثیر قطعه تراژن اختصاصی سویای مقاوم به رانداپ ((cp4 epsps؛ چاهک 4: محصول تکثیر قطعه سازه ژنی اختصاصی رانداپ ردی (p35S -CTP)؛ چاهک 5: محصول تکثیر قطعه NOS؛ چاهک 6: محصول تکثیر واکنش زنجیره ای پلی­مراز داخلی با آغازگرهای RR01-RR02 و  .RR04-RR05

 

 

 

شکل 3- تأیید محصول PCR حاصل از توالی پیش بر CaMV 35S به وسیله برش آنزیمی EcoRV. M: نشانگر وزن مولکولی  bp ladder100 (Fermentas)؛ C-: کنترل منفی (الگوی آب)، چاهکهای +: محصولاتPCR  هضم شده، چاهکهای -: محصولاتPCR  هضم نشده.

ارزیابی نیمه کمی: واکنش زنجیره ای پلی­مراز برای تشخیص نیمه کمی DNA بذور با رقت های 100، 50، 25، 5 و 1 درصد انجام گردید. در ابتدا، واکنش زنجیره ای پلی­مراز برای سنجش مبتنی بر توالی پیش بر 35S نسبت به ژن خانه دار لکتین انجام گردید که نتایج، میزان 1 درصد را به عنوان آستانه تشخیص برای این توالی نشان داد. همچنین واکنش زنجیره ای پلی­مراز برای توالیهای پایان دهنده NOS و cp4 epsps نسبت به ژن خانه دار لکتین انجام گردیده که آستانه تشخیص 5/0 درصد برای این عناصر به دست آمد (شکل 5 ب و ج). در نهایت، تشخیص نیمه کمی مبتنی بر توالیهای سازه ژنی CTP-35S)) و رخداد اختصاصی سویا pDNA-35S)) برای نمونه بذر سویای مقاوم به رانداپ انجام گردید که آستانه تشخیص 5 درصد برای این عناصر به دست آمد (شکل 5).


 

شکل 4- الگوی الکتروفورز محصول PCR دوگانه و سه گانه.M : نشانگر وزن مولکولی bp ladder 100 ((Fermentas، چاهک 1: کنترل مثبت 35S (pBI121)؛ چاهک 2: کنترل مثبت رخداد pDNA-35S؛ چاهک 3: کنترل مثبت لکتین؛ چاهک 4: محصول تکثیر توالیهای ژن لکتین + 35S؛ چاهک 5 محصول تکثیر توالیهای 35S +pDNA35S ؛ چاهک 6 محصول تکثیر توالیهای ژن لکتین + pDNA35S؛ چاهک 7: محصول تکثیر توالیهای لکتین + pDNA-35S + 35S؛ C-: کنترل منفی (الگوی آب).

 



  C-     1      2    3     4     5     6     M 

 
 

 

M    C-   1     2     3    4    5   6

 

M   C-  1    2    3    4    5   6

 
                                                                                                            

 

180

 

195

 

447

 
   

                     (الف)                                            (ب)                                           (ج)                    

 

 


 

235

 

116

 

506

 
     

                   (د)                                            (ه)                                            (و)                  

 

شکل5- الکتروفورز محصول تکثیر نیمه کمی توالیهای اختصاصی سویای مقاوم به رانداپ نسبت به ژن خانه دار لکتین. الف، تشخیص نیمه کمی ژن اختصاصی سویا (لکتین)؛ ب، تشخیص نیمه کمی مبتنی بر توالی پیش بر CaM 35S (35S1-35S2)؛ ج، تشخیص نیمه کمی مبتنی بر توالی پایان دهنده NOS (NOS1-NOS3)؛ د، تشخیص نیمه کمی مبتنی بر توالی کاست ژنی CTP-35S))؛ ه، تشخیص نیمه کمی بر اساس توالی cp4 epsps؛ و، تشخیص نیمه کمی بر مبنای توالی اختصاصی رخداد pDNA-35S))؛ M: نشانگر وزن مولکولیladder   bp100 ((Fermentas؛ C-: کنترل منفی (الگوی آب)؛ چاهک 1: 100 درصد سویای تراریخت؛ چاهک 2: 50 درصد سویای تراریخت؛ چاهک 3: 25 درصد سویای تراریخت؛ چاهک 4: 5 درصد سویای تراریخت؛ چاهک5: 1 درصد سویای تراریخت؛ چاهک 6: 5/0 درصد سویای تراریخت.


بحث

با توجه به اینکه چندین روش استخراج DNA برای سویای مقاوم به رانداپ به کار رفته است، نتایج حاکی از این نکته است که به منظور ارزیابی کیفی، استخراج DNA با روش Wizard و جهت ارزیابی نیمه کمی، روشCTAB  مناسب تر می­باشد. نتایج حاصل از واکنش زنجیره ای پلی­مراز، سنجش کیفی بخشهای مختلف کاست ژنی نمونه­های ترایخت را تا حد مطلوبی نشان داده است. در این روشها برای اولین بار شناسایی رخداد خاص سویا با استفاده از روش واکنش زنجیره ای پلی­مراز معمولی پس از طراحی آغازگر مناسب انجام شده است. این روش بهترین و مطمئن ترین روش تشخیص کیفی بذور تراریخت سویای مقاوم به رانداپ در سطح رخداد اختصاصی آن (GTS 40-3-2) می­باشد.

به منظور بهینه سازی مجدد روشهای کیفی و تهیه پروتکل مناسب برای تشخیص کیفی عناصر موجود در کاست ژنی سویای مقاوم به رانداپ، تأیید مجدد محصول تکثیر پیش بر 35S با استفاده از روشهای هضم آنزیمی ( آنزیمEcoRV) (شکل 3) و واکنش زنجیره ای پلی­مراز داخلی برای کاست ژنی سویای مقاوم به رانداپ (RR04-RR05) انجام گردید. در این مطالعه، پس از مخلوط کردن پودر نمونه سویای تیپ وحشی و تراریخت، به گونه ای که میزان درصد وزن بذر ترایخت به تدریج کم شود، تشخیص نیمه کمی نمونه­ها با درصد وزنی تراریخت مشخص برای توالی سازه سویای تراریخت رانداپ ردی نسبت به توالی ژن خانه دار لکتین انجام گردید. پس از بهینه سازی بهترین دمای مناسب برای جفت آغازگرها، واکنش PCR برای توالی هدف و ژن کنترل به طور همزمان، در ویالهای جداگانه در یک دستگاه ترموسیکلر تحت شرایط یکسان آزمایشگاهی انجام گردید. نتایج نشان داد که میزان حد آستانه برای تشخیص نیمه کمی پیش بر 35S تقریباً 1 درصد بوده است و برای پایان دهنده NOS ((NOS1-NOS3 و توالی  cp4 epsps5/0 درصد می­باشد. این در حالی است که آستانه تشخیص نیمه کمی برای سازه ژنی CTP-35S)) و رخداد اختصاصی سویای مقاوم به رانداپ pDNA-35S)) برای بذور سویای مقاوم به رانداپ در حدود 5 درصد می­باشد. واکنش زنجیره ای پلی­مراز سه گانه نیمه کمی برای توالیهای ژن خانه دار اختصاصی سویا، رخداد اختصاصی سویا و پیش بر CaMV 35S با کمک آغازگرهای GMO1/GMO2، pDNA-35S و CaMV 35S برای بذور 1 درصد سویای مقاوم به رانداپ، نیز انجام گردید. قطعات مورد انتظار برای این نمونه­ها به دست آمد که با توجه به میزان 5 درصد بعنوان حد آستانه تشخیص براساس توالی pDNA-35S، روش چند گانه برای شناسایی در سطح رخداد، حساسیت و اختصاصیت مناسبی را نشان داده است. لذا، این روش می­تواند جهت غربال­گری سریع نمونه­های سویای تراریخت مقاوم به رانداپ در تمامی آزمایشگاهها و مراکز استاندارد کشور مورد استفاده قرار گیرد. در واقع برای اولین بار در سطح آزمایشگاهی، تشخیص اختصاصی یک گیاه در سطح رخداد با استفاده از واکنش زنجیره ای پلی مراز معمول، بدون استفاده از روشReal-Time PCR  انجام گرفته است. همچنین از این روش می توان برای غربالگری سایر گیاهان تراریخت در کشور استفاده نمود (1 و 12).

سنجش نیمه کمی نشان داد که پس از بهینه سازی شرایط برای تمامی عناصر تراریخت، نتایج معتبر و مشابهی و حتی در چندین مورد بهتری نسبت به گزارشهای مشابه به دست آمده است. نتایج به دست آمده از این مطالعه، نشان دهنده این مطلب است که حساسیت آزمون برای پایان دهنده NOS و cp4 epsps نیز نسبتاً بالا بوده است. این در حالی است که اگرچه حساسیت نتایج بر مبنای توالی رخداد (pDNA-35S) و سازه ژنی (CTP-35S) نسبت به سایر عناصر کمتر بوده، ولی اختصاصیت آنها میزان بالاتری را نشان داده است.

1. Barzegar A., Rahimian H., Hashemi Sohi H. 2011. Agrobacterium–mediated transformation of Minou (Citrus sp.) and Darabi (Citrus grandis) and regeneration of transgenic explants expressing β–glucoronidase (uid A) gene. Iranian Journal of Biology 24(3): 342-354

2. Bradford K.J. 2007. Seed biotechnology: translating promise into practice. Pages 130-138. In: S.W. Adkins, S. Ashmore, and S.C. Navie (eds.). Seeds: Biology, Development and Ecology CAB International, Wallingford, UK.

3. Brini F., Hanin M., Mezghani I., Berkowitz G.A., Masmoudi K. 2007. Overexpression of  wheat Na+/H+ antiporter TNHX1 and H+- pyrophosphatase TvP1 improve salt- anddrought-stress tolerance in Arabidopsis thaliana plants. Journal of Experimental Botany. 58:301-308.

4. Chen J., Hua G., Jurat-Fuentes J L., Abdullah, MA., Adang MJ. 2007. Synergism of Bacillusthuringiensis toxins by a fragment of a toxin-binding cadherin. Proceedings of the National Academy of Sciences, 104: 13901–13906

5. Carpenter J., Gianessi L. 1999. Herbicide tolerant soybeans:  why growers are adopting Roundup Ready varieties. AgBioForum - Journal of Agrobiotechnology Management & Economics. 2:65-72.

6. Cattaneo M.G., Yafuso C., Schmidt C., Huang C.Y., Rahman M., Olson C., Ellers-Kirk C., Orr B.J., Marsh S.E., Antilla L., Dutilleul P., Carriere Y. 2006. Farm-scale evaluation of the impacts of transgenic cotton on biodiversity, pesticide use, and yield, Proceedings of the National Academy of Sciences of the United States of America. 103: 7571-7576 .

7. Daniell H., wiebe P.O., Millan. A.F. 2001. Antibiotic-free chloroplast genetic engineering- an environmentally friendly approach. Trends in Plant Science, Jun;6(6):237-9

8. Gurel F., Arican E., Gozukirmizi N., Ari S.  2011. Recent molecular tools for detecting transgenic events in genetically modified (GM) crop products. Scientific Research and Essays. 6: 5091-5099

9. Hemmer W. 1997. Foods derived from genetically modified organisms and detection methods. BATS-Report 02/1997, Agency for Biosafety Research and Assessment of Technology Impacts of the Swiss Priority Program Biotechnology of the Swiss National Science Foundation, Basel, Switzerland, fromhttp://www.bats.ch/bat /publikationen/1997-2_gmo/gmo

10. James C. 2013. Global Status of Commercialized Biotech/GM Crops: 2012. ISAAA Brief No. 44. ISAAA: Ithaca, NY.

11. Jankiewicz A., Broll, H., Zagon J. 1999. The official method for the detection of genetically modified soybeans (German Food Act LMBG § 35): a semi-quantitative study of sensitivity limits with glyphosate-tolerant soybeans (Roundup Ready) and insect-resistant Bt maize (Maximizer). European Food Research and Technology 209(2): 77-82.

12. Roohi L., Zamani M.R., Motallebi M. 2013.Transgenic canola plants harboring beta 1,3 glucanase (bgnI) gene from Trichoderma virens inhibit mycelial growth of Sclerotinia sclerotiorum. Iranian Journal of Biology 26(1): 28-40

13. Yamaguchi H., Sasaki K., Umetsu H., Kamada H. 2003. Two detection methods of genetically modified maize and state of it import into Japan. Food Control 14(3): 201-206