نوع مقاله: مقاله پژوهشی

نویسندگان

1 دانشجوی دکتری بیوشیمی دانشکده علوم زیستی دانشگاه تربیت مدرس

2 عضو هیئت علمی و مدیر گروه بیوشیمی دانشکده علوم زیستی دانشگاه تربیت مدرس

3 مدیر گروه گیاه پزشکی-دانشکده کشاورزی-دانشگاه گیلان

4 دانشجوی دکتری دانشکده گیاه پزشکی دانشگاه گیلان

چکیده

غیرحساس شدن آنزیم استیل کولین استراز به ترکیبات فسفره آلی در کنه دو لکه ای T. urticae، نقش اساسی در مقاومت به این ترکیبات دارد. در این مطالعه، ویژگی¬های بیوشیمیایی و سم شناسی این آنزیم در کنه¬های مقاوم و حساس به کلرپایریفوس مورد بررسی قرار گرفت. کنه های مورد مطالعه از اصفهان (ISR)، یزد (Yz) و رشت (GUS2) جمع¬آوری و براساس ژن کد¬¬کننده آنزیم سیتوکروم اکسیداز Ι (COI) میتوکندریایی شناسایی شدند. آزمونهای زیست سنجی نشان داده بود که نسبت مقاومت به کلرپایریفوس در جمعیت های ISR وYz در مقایسه با جمعیت GUS2 به ترتیب 9/176 و 78/9 می¬باشد. تعیین فعالیت ویژه AChE با استفاده از سوبستراهای مخثلف نشان داد که جمعیت مقاوم دارای بیشترین و جمعیت حساس دارای کمترین فعالیت ویژه آنزیمی است، همچنین تغییر در تحرک الکتروفورزی استیل کولین استراز ISR و شدت بیشتر باند مربوطه در حضور کلرپایریفوس اکسان در این جمعیت، وجود تغییر در این آنزیم را تأیید کرد. در ادامه، اثر بازدارندگی 11 آفت کش فسفره آلی و کاربامات به منظور تأیید نقش این آنزیم در مقاومت مورد بررسی قرار گرفت. نتایج حاکی از این بود که IC50 مهارکننده ها در AChE جمعیت مقاوم و نیمه مقاوم به ترتیب از جمعیت حساس بالاتر می باشد. در نتیجه نتایج نشان می¬دهد که تغییراتی در مکان هدف این آنزیم و یا در اطراف آن ایجاد شده که موجب تحرک الکتروفورزی متفاوت، تمایل کمتر آنزیم به سوبسترا و به تبع آن حساسیت کمتر به آفت کش های فوق که به صورت رقابتی با سوبسترا عمل می کنند، شده است.

کلیدواژه‌ها

عنوان مقاله [English]

Toxicological and biochemical characterizations of acetylcholinesterases in chlorpyrifos-susceptible and resistant populations of two spotted spider mite, Tetranychus urticae Koch

چکیده [English]

The enzyme acetylcholinesterase insensitivity plays a major role in organophosphate insecticides resistance in T. Urticae (Acari: Tetranychidae). In this study, toxicological and biochemical resistant mechanisms to chlorpyrifos in three populations of spider mites were surveyed. Mites were first collected in Isfahan (ISR), Yazd (Yz) and Guilan (GUS2) provinces and identified based on mitochondrial cytochrome oxidase sequences. The bioassay results showed that resistance ratios of ISR and Yz populations to chlorpyrifos were 176.9- and 9.78-fold compared to the GUS2 population, respectively. Determination of acetylcholinesterase activity with different substrates showed that resistant and susceptible strains have the highest and the lowest specific activity, respectively. In addition, AChE zymogram analyses were investigated in all populations. Lower acetylcholinesterase electrophoretic mobility in ISR population and high acetylcholinesterase band intensity of ISR population in presence of chlorpyrifos-oxon showed that resistance population has altered AchE. For determining the role of acetylcholinesterase insensivity in resistant mechanism, inhibitory effect of 11 inhibitors including OPs and carbamates on this enzyme were investigated in this study. IC50 of all inhibitors on acetylcholinesterase from ISR and Yz populations were higher than GUS2 population respectively. The results suggest that some modification occurred at the active site of the enzyme that reduces the AChE affinity to substrates and subsequently led to differences in electrophoretic mobility and insensivity of enzyme to OPs and carbamate inhibitors as competitive inhibitors.

کلیدواژه‌ها [English]

  • Tetranychus urticae
  • chlorpyrifos
  • acetylcholinesterase
  • inhibitors

بررسی ویژگیهای بیوشیمیایی و سم شناسی آنزیم استیل کولین استراز در کنه­های دو لکه ای مقاوم و حساس به کلرپایریفوس

پریچهر زمانی1، رضا حسن­ساجدی1، محمد قدمیاری2* و نرگس معماری­زاده2 

1 تهران، دانشگاه تربیت مدرس، دانشکده علوم زیستی، گروه بیوشیمی 

2 رشت، دانشگاه گیلان، دانشکده کشاورزی، گروه گیاه پزشکی 

تاریخ دریافت: 18/11/91             تاریخ پذیرش: 7/6/92 

چکیده 

غیرحساس شدن آنزیم استیل کولین استراز به ترکیبات فسفره آلی در کنه دو لکه ای T. urticae، نقش اساسی در مقاومت به این ترکیبات دارد. در این مطالعه، ویژگیهای بیوشیمیایی و سم شناسی این آنزیم در کنه­های مقاوم و حساس به کلرپایریفوس مورد بررسی قرار گرفت. کنه های مورد مطالعه از اصفهان (ISR)، یزد (Yz) و رشت (GUS2) جمع­آوری و بر اساس ژن کدکننده آنزیم سیتوکروم اکسیداز Ι (COI) میتوکندریایی شناسایی شدند. آزمونهای زیست سنجی نشان داده بود که نسبت مقاومت به کلرپایریفوس در جمعیتهای ISR وYz در مقایسه با جمعیت GUS2 به ترتیب 9/176 و 78/9 می­باشد. تعیین فعالیت ویژه AChE با استفاده از سوبستراهای مخثلف نشان داد که جمعیت مقاوم دارای بیشترین و جمعیت حساس دارای کمترین فعالیت ویژه آنزیمی است، همچنین تغییر در تحرک الکتروفورزی استیل کولین استراز ISR و شدت بیشتر باند مربوطه در حضور کلرپایریفوس اکسان در این جمعیت، وجود تغییر در این آنزیم را تأیید کرد. در ادامه، اثر بازدارندگی 11 آفت کش فسفره آلی و کاربامات به منظور تأیید نقش این آنزیم در مقاومت مورد بررسی قرار گرفت. نتایج حاکی از این بود که IC50 مهارکننده ها در AChE جمعیت مقاوم و نیمه مقاوم به ترتیب از جمعیت حساس بالاتر می باشد. در نتیجه نتایج نشان می­دهد که تغییراتی در مکان هدف این آنزیم و یا در اطراف آن ایجاد شده که موجب تحرک الکتروفورزی متفاوت، تمایل کمتر آنزیم به سوبسترا و به تبع آن حساسیت کمتر به آفت کشهای فوق که به صورت رقابتی با سوبسترا عمل می کنند، شده است.

واژه های کلیدی: Tetranychus urticae، کلرپایریفوس، استیل کولین استراز و مهارکننده ها

* نویسنده مسئول، تلفن: 01333690453 ، پست الکترونیکی: mghadamyari@gmail.com 

مقدمه

 

کنه تارتن دولکه­ای Tetranychusurticae Koch از زیر رده Acari و متعلق به راسته Prostigmata و خانواده Tetranychidae است. این کنه پلی فاژ بوده و حدود 1200 گونه گیاهی به عنوان میزبانهای این کنه گزارش شده است که بیش از 150 گونه از این تعداد مانند پنبه، ذرت، گوجه فرنگی، فلفل شیرین، درختان میوه و گیاهان زینتی دارای اهمیت اقتصادی می باشند(10). از آنجایی که که قدرت تولید مثل این کنه بسیار زیاد و سیکل زندگی آن کوتاه است، سموم مختلفی به دفعات زیاد علیه این کنه استفاده می شود و به مرور زمان مقاومت به این آفت کشها ایجاد شده است (18). مقاومت علیه این آفت کشها به دو دسته مقاومت متابولیکی و مقاومت در جایگاه هدف تقسیم می شود. آنزیمهای استراز، گلوتاتیون اس- ترانسفراز و اکسیژناز ها در مقاومت متابولیکی نقش عمده ای دارند (19).  این آفت کشها، برحسب مکان هدف به چند نوع تقسیم می شوند. یک گروه از این آفت کشها، ترکیبات فسفره آلی و کارباماتها هستند. ترکیبات فسفره آلی (OPs)، از جمله اولین گروههای مواد شیمیایی استفاده شده در کنترل T. urticae هستند که این گونه به آنها مقاوم شده است. اولین مورد مصرف و بروز مقاومت به این ترکیبات به وسیله هل در 1962 گزارش شد (8).  تغییر ساختاری در مکان هدف آنزیم استیل کولین استراز مکانیسم عمده مقاومت در ترکیبات فسفره آلی است (12). ویژگی بیوشیمیایی AChE غیرحساس، ایجاد برخی تغییرات در جایگاه فعال آنزیم را تأیید می­کند (20). مشخص نمودن سازوکار‌های بیوشیمیایی زیر بنایی می‌تواند نقش مهمی در غلبه بر مشکلات ناشی از مقاومت به آفت­کشها ایفاء نماید و علاوه بر کمک در انتخاب منطقی مخلوط آفت­کشها و تناوب آنها، فرصتی برای گسترش آزمونهای سریع و کارآ برای تشخیص مقاومت و پایش (monitoring) تغییرات در پاسخ به کاربرد آفت­کشهای بعدی فراهم ‌کند. گزارش شده است که مقاومت تقاطعی منفی بینN  - دی متیل کاربامات وN  -  متیل کاربامات در شته سبز هلو (Myzuspersicae) وجود دارد (9) .نومورا و همکاران بر اساس مطالعات بازدارندگی استیل کولین استراز زنجرک سبز برنج، گزارش کردند که مقاومت تقاطعی منفی بین مونوکروتوفوس و MTMC و همچنین مقاومت تقاطعی بین پروپاکسور و MTMC وجود دارد (11). در این تحقیق سعی خواهد شد تا مقاومت تقاطعی منفی بین ترکیبات N-متیل کاربامات (اسرین، آلدیکارب، کاربوفوران، کارباریل و MTMC) و N-دی متیل کاربامات (نئواستیگماین بروماید) در کولین استراز کنه مقاوم به کلرپایریفوس مورد بررسی قرار گیرد.

گزارش مقاومت کنه دو لکه ای به ترکیبات آلی فسفره از کشورهای یونان، بلژیک، نیوزیلند گزارش شده است (1، 13، 16 و 17) و این اولین مورد گزارش مقاومت به کلرپایریفوس (ترکیب فسفره) از ایران است.

در این مطالعه،مکانیسم مقاومت مکان هدف (غیرحساس شدن جایگاه فعال آنزیم استیل کولین استراز) به کلرپایریفوس در جمعیتهای ایرانی کنه دولکه ای مورد بررسی قرار گرفت. همچنین ویژگیهای بیوشیمیایی و سم شناسی این آنزیم در جمعیتهای حساس و مقاوم با استفاده از مهارکننده­های فسفره و کاربامات، سوبستراهای سنتزی و زایموگرام مورد مقایسه قرار گرفت.

مواد و روشها 

مواد شیمیایی و آفت کشها: استیل تیوکولین آیوداید  (ATC)، بوتیریل تیوکولین آیوداید ((BTC، پروپیونیل تیوکولین آیوداید (PTC) و کلرپایریفوس از Wako Pure Chemical Industries Ltd.  (ژاپن)، کلرپایریفوس و دیگر مهارکننده ها از شرکت سیگما (Sigma, St. Louis, MO. USA)  ترایتون X-100، تریس، اکریل آمید، بیس اکریل آمید، تمد، سدیم دودسیل سولفات((SDS و بقیه مواد از شرکت مرک(Merck, Darmstadt Germany) ، کیت استخراج DNA از ژل آگارز ازشرکت فرمنتاز (MBI Fermetas, Vilnius, lithuania) وPCR master kit از شرکت کیاژن (Hilden, Germany) تهیه شدند.

جمع­آوری جمعیتهای حساس و مقاوم کنه دولکه­ای: جمعیت مقاوم در سال 1386 از گلخانه رز واقع در اصفهان جمع آوری شد. جمعیت نیمه مقاوم در سال 1387 از گلخانه رز واقع در یزد وجمعیت حساس در سال 1388 از روی بوته­های رز در شهرستان رشت جمع­آوری گردید. پرورش جمعیتهای کنه روی گیاه لوبیای چشم بلبلی (Vignaunguiculata (L.)) در اتاقهای مجزا به صورت انبوه صورت می­گرفت.

شناسایی جمعیتهای کنه تارتن دو­لکه­ای به روش مولکولی: شناسایی جمعیتها بر اساس کلید شناسایی با استفاده از شکل ادیاگوس کنه های نر صورت گرفت. همچنین به منظور شناسایی مولکولی جمعیتها، از ژن کدکننده آنزیم سیتوکروم اکسیداز Ι (COI) میتوکندریایی کنه تارتن دولکه­ای استفاده شد.

استخراجDNA: استخراج DNA از 10 عدد کنه ماده بالغ با استفاده از روش تغییر یافته CTAB انجام شد بدین ترتیب که کنه­ها در محلولی حاوی 5 میکرولیتر پروتئیناز K  20 mg/ml و 100 میکرولیتر بافر CTAB) CTAB 2 درصد (w/v) در تریس اسیدی 100 میلی مولار و EDTA 20 میلی مولار و NaCl 42/1 میلی مولارهموژنایز شدند و بقیه مراحل طبق پروتوکل انجام شد (15).

واکنش زنجیره ای پلیمراز(PCR): واکنش PCRبااستفاده از  Master Mixو با پرایمر های ggaggatttggaaattgattagttcc (reverse) و(forward)  tacagctcctatagataaaac تحت سیکلهای حرارتی مقابل انجام شد. مرحله واسرشت سازی اولیه در دمای 94 درجه سانتی گراد به مدت 4 دقیقه، سپس 35 سیکل در دمای 93 درجه سانتی گراد به مدت 1 دقیقه (واسرشت سازی)، 1 دقیقه در دمای 49 درجه سانتی گراد (اتصال)، 90 ثانیه در دمای 72 درجه سانتی گراد (بست) و 5 دقیقه در دمای 72 درجه سانتی گراد (بست نهایی) انجام گرفت. پس از انجام PCR، الکتروفورزر و ژل آگارز 1 درصد انجام شد و محصول، توسط کیت استخراج DNA از ژل آگارز استخراج شد.

تعیین توالی نوکلئوتیدی و آنالیزهای فیلوژنتیکی COI: تعیین ترادف نوکلئوتیدی در هر دو جهت توسط (Eurofins MWG operan, Germany) MWG  صورت گرفت. به منظور‌ به دست آوردن توالیهای نوکلئوتیدی مربوط به توالیCOI ، کاوشهایی در بانکهای اطلاعاتی GenBank/EBI انجام شد (5) و با استفاده از BLASTN جستجوهای همولوژی به عمل آمد (3). توالیها به ‌کمک برنامه آنلاین MAFFT(Kyushu university) مقایسه و تطبیق گردیدند. به منظور تعیین ارتباط بین جمعیتهای مورد مطالعه و رسم درخت فیلوژنتیکی، از نرم افزار PAUP(version 4.0b10) و روش Maximum Parsimony (MP) استفاده شد. تعداد تکرار در آنالیز Bootstrapping، 10000 تکرار در نظر گرفته شد.

همسن سازی کنه ها: برای انجام آزمونهای بیوشیمیایی باید جمعیتی همسن از کنه فراهم می شد. برای این منظور ساقه سه برگی لوبیا از در چوب پنبه ای شیشه های حاوی آب عبور داده شد و سپس روی هر برگ 15 عدد کنه ماده بالغ قرار داده و به داخل انکوباتور منتقل شد. 18 تا 24 ساعت به این کنه ها فرصت تخم ریزی داده شد سپس کنه های بالغ از روی برگ حذف و تخمها تا زمان ظاهر شدن جانور بالغ به داخل انکوباتور بادمای 2±24 درجه سانتی گراد، رطوبت نسبی 10±70 درصد و دوره روشنایی خاص (تاریکی8 : روشنایی16) منتقل شدند. به این ترتیب جمعیت همسن برای آزمونها فراهم گردید.

سنجش فعالیت ویژه استیل کولین استراز: عصاره آنزیمی با استفاده از روش تغییرات یافته خواجه علی و همکاران (12) تهیه شد. بدین ترتیب که 1000 کنه ماده در 3 میلی لیتر بافر تریس اسیدی (10 میلی مولار، 5/7 =pH) حاوی 1/0 درصد ترایتون X-100 هموژنیزه و به مدت 20 دقیقه روی یخ انکوبه شد. بعد از انکوباسیون، محلول هموژنیزه به مدت 15 دقیقه در دمای 4 درجه سانتی گراد و دور Хg10000 سانتیریفیوژ گردید سپس فعالیت AChE به روش المان با استفاده از سوبسترای ATC ، BTC ، PTC اندازه گیری شد (7) و جذب محلول به مدت 20 دقیقه در طول موج 412 نانومتر توسط اسپکتروفتومتر به صورت کاینتیک خوانده شد.

الکتروفورز ژل پلی­اکریل­آمید و آنالیز زایموگرام آنزیم استیل کولین استراز: الکتروفورز ژل پلی­اکریل­آمید غیرتغییر ماهیت دهنده به روش دیویس (Davis) با استفاده از ژل 5/7 درصد انجام شد (6). لازم به ذکر است که ژل و بافر الکتروفورز، هر دوحاوی 1/0 درصد ترایتون X-100 بوده و به ژل، 02/0 میلی مولار  ATCافزوده شد. بعد از آماده شدن ژل، 5 میکرولیتر بافر نمونه و25 میکرولیتر آنزیم (به ازای هر کنه 3 میکرولیتر بافر) در داخل چاهکها بارگذاری گردید. الکتروفورز در دمای 4 درجه سانتی گراد و با ولتاژ 180 ولت انجام گردید. پس از اتمام الکتروفورز، 100 میلی گرم ATC در 4 میلی لیتر آب مقطر خنک حل و سپس 7 میلی لیتر محلول سولفات مس 1/0 مولار قطره قطره به آن اضافه گردید. سپس محلول حاصل به مدت 7 دقیقه در دورg10000 سانتریفیوژشد و به 10 میلی لیتر از محلول رویی 50 میلی گرم گلایسین افزوده شد و با استات سدیم 1 مولار به 6/4pH= رسید. سپس با سولفات سدیم 1 مولار محلول حاصل به حجم  نهایی 40 میلی لیتر رسانده و فیلتر شد. ژل تا ظاهر شدن کامل باندها در این محلول قرار داده شد (14).

تعیین IC50 تعدادی از سموم روی آنزیم استیل کولین استراز: برای محاسبه  IC50ترکیبات فسفره آلی و کارباماتها، محلول آنزیمی به مدت 10 دقیقه در غلظتهای 2-10، 3-10، 4-10، 5-10، 6-10، 7-10 و 8-10 مولار از هر یک از آفت کشهای Eserine، Aldicarb، Monocrotophos، Chlorpyrifosoxon، Neostigmine، MTMC، Dimethoate، Phosphamidon، ‍Carbofuran، Carbaryl و Paraoxon انکوبه شد. سپس فعالیت باقیمانده آنزیم اندازه­گیری گردید و نتایج با نرم افزار POLO-PC  (LeOra Software,1987) آنالیز شد.

نتایج

شناسایی مولکولی جمعیتها: قطعه­ای از ژن سیتوکروم اکسیداز Ι (COI) میتوکندریایی به اندازه حدود bp900 در جمعیتهای اصفهان، یزد و رشت با PCR تکثیر گردید. مقایسه توالیهای به دست آمده در این تحقیق با نمونه های موجود در بانکهای ژنی نشان داد که جمعیتهای مورد نظر همولوژی بالایی با گونه T.urticae دارند (99 درصد مشابهت با  AJ316605T. urticaeو مشابهت 90 درصد > با T. urticaeAJ316598). با توجه به مطابقت توالی DNA گونه­های شناسایی شده با گونه T. urticae شناسایی شده در بانکهای توالی (T. urticae AJ316605)، اختلافات بسیار ناچیزی در توالی COI این نمونه ها مشاهده شد.  درخت فیلوژنتیک با استفاده از روشmaximum parsimony و به کمک نرم افزار  PAUP(version 4.0b10) رسم شد (شکل1). نتایج نشان می دهد که هر سه جمعیت مورد مطالعه در یک کلاد خواهری بزرگ (a) که تمام گونه های T. urticae در آن قرار گرفته اند، واقع شده است. همچنین با توجه به درخت فیلوژنتیکی، ارتباط نزدیکی بین توالی DNA گونه­های شناسایی شده با گونه T. urticae (AJ316598) و T. urticae (AJ316605) وجود دارد که با نتایج حاصل ازmultiple alignment مطابقت دارد. نتایج حاصل ازتطبیق توالی و رسم درخت فیلوژنتیک  نشان می دهد که هر سه جمعیت، T. urticae هستند.

بررسی فعالیت استیل کولین استراز: نتایج حاصل از فعالیت آنزیم استیل کولین استراز با استفاده از سه سوبسترایATC ،BTC  و PTC در جدول 1 آورده شده است. با استفاده از هر سه سوبسترا به ویژه ATC، مقدار فعالیت ویژه در جمعیت مقاوم و نیمه مقاوم نسبت به جمعیت حساس بالاتر است.

الگوی پراکنش باندهای استیل کولین استراز: الگوی پراکنش باندها در جمعیتهای مورد آزمایش در شکل 2 آمده است. در هر سه جمعیت، تنها یک باند دیده می شود که مکان قرارگیری آن در جمعیت مقاوم با دو جمعیت دیگر متفاوت است و تحرک الکتروفورزی کمتری در آن مشاهده می شود که احتمالا می تواند ناشی از  تغییرات ساختاری در جمعیت ISR باشد. اثر مهارکننده کلرپایریفوس بر فعالیت آنزیم AChE، با انکوبه کردن ژل در محلول حاوی کلرپایریفوس در حین رنگ آمیزی مورد بررسی قرار گرفت. باندهای دو جمعیت نیمه مقاوم و حساس به طور کامل مهار شدند در حالی­که باند استیل کولین استراز جمعیت مقاوم هنوز روی ژل مشاهده می شود.

 

 

Clade a

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 


 

69

 62

 92

 70

   93

   66

     100

    74

  98

     77

  100

     89

  100

  100

 

 

 

شکل 1 -  شناسایی جمعیتهای مورد مطالعه با رسم درخت فیلوژنتیکی 

Tetranychus urticae: AB116573, AB041257, AB079045, AJ414582, AB066449, AB116574, AB079044, EU556754, X80855, AJ316605, AJ316598, AJ316606, AJ316599, AB066469, AJ316597, X74571, DQ017588, Tetranychus turkestani: GQ141913, AJ316600, AJ414583, AJ316604, Tetranychus cinnabarinus: GQ141907, HM753535, DQ437552, Tetranychus kanzawai: AB079103, AB079037, AY044645, AB079051, AY044643, AB116566, AB079105, AB079049, AB079035, AB079033, Tetranychus trancatus: AB257315, AB257316, AB257317, Tetranychus evansi: FJ440675, FJ440677, FJ440678, Tetranychus piercie: AB257313, Tetranychus gloveri: X80860, Tetranychus mcdanieli: X80857, Tetranychus neocaledonicus: X80859, Amphitetranychus viennensis: X99875, Amphitetranychus quercivorus: X99874, Panonychus citri: AB041252, Panonychus osmanthi: AB041254, Panonychus ulmi: AB041253, Panonychus mori: AB041255, Eotetranychus banski: AY320030, Eotetranychus carpini: X80863, Eotetranychus coryli: X80867, Eotetranychus tiliarium: X80864, Mononychellus progresivus: X79901, Oligonychus gossyppi: X79901. Outgroups: Bryobia kissophila (X80871) and Eotetranychus buxi (X80872))

جدول 1 - مقایسه فعالیت ویژه آنزیم AChE در سه جمعیت مورد مطالعه

Specific activity (nmol/min.mg protein)

 

 

 

GUS2

 

Yz

 

ISR

 

Substrate

Enzyme

4.56 c ±0.09

5.28b ±0.13

5.72a* ±0.32

ATC

 

4.10 b ±0.06

 

4.25 b ±0.09

 

4.56 a ±0.17

 

BTC

AChE

4.63 c ±0.1

 

5.43 b ±0.07

 

5.54 a ±0.01

 

PTC

 










 

AchE 2

ب 

الف 

AchE 1  

        GUS2                     ISR                 YZ                    ISR                   YZ              GUS2

                                                                                                                      +inhibitor       +inhibitor    +inhibitor                                     

a* حروف مختلف نشان دهنده معنی دار بودن اختلافات بر اساس (p < 0.05) Tukey’s test می باشد.

 

 

 

 

 

 

شکل 2 - مقایسه الگوی پراکنش باندهایAChE  در جمعیتهای کنه دولکه ای


تعیین IC50 تعدادی از سموم مهارکننده آنزیم استیل کولین استراز: نتایج به دست آمده از اندازه گیری IC50 11 مهارکننده مختلف برای سه جمعیت در جدول 2 و نمودارهای دز پاسخ آنها در شکل 3 آورده شده است. نتایج نشان داد که میزان IC50 در جمعیت مقاوم و نیمه مقاوم برای سموم phosphamidon،chlorpyrifosoxon، paraoxon و monocrotophos بیشتر از جمعیت­ حساس بود. نسبت غیرحساس شدن (IR) به آفت کش کلرپایریفوس به ترتیب 30/23 و 96/2 برابر به ترتیب برای جمعیتهای مقاوم و نیمه مقاوم تخمین زده شد.

 نتایج نشان می دهد که جمعیت مقاوم، در مقایسه با دو جمعیت دیگر حساسیت کمتری به سموم مورد مطالعه دارد و در دز بالاتری مهار می شود و به عبارتی حساسیت کمتر آنزیم استیل کولین استراز نسبت به این سموم به ترتیب در جمعیت مقاوم و نیمه مقاوم کاملا مشهود می باشد.

بحث

نتایج آزمایشهای زیست سنجی روی جمعیتها نشان داده بود که نسب مقاومت به کلرپایریفوس در جمعیتهای  ISR و Yz به ترتیب برابر 9/176 و 78/9 می باشد (23). همچنین نتایج آزمونهای بیوشیمیایی نشان داد که میزان فعالیت استرازی و گلوتاتیون اس ترنسفراز در جمعیتهای ISR و Yz بالاتر از حساس است (23). لیکن میزان فعالیت این آنزیمها در حدی نبود تا میزان مقاومت بالا به کلرپایریفوس را توجیه نماید (23). به همین دلیل در این تحقیق ویژگیهای بیوشیمیایی کولین استراز در این جمعیتها مورد مقایسه قرار گرفت.

 

 

Log (Inhibitor Conc. (M))



 
 

 


 

شکل 3 – بررسی IC50 تعدادی سموم فسفره آلی و کاربامات در جمعیت های مورد مطالعه

 

جدول2 - بررسی IC50 تعدادی از سموم فسفره آلی و کاربامات


IC50 (M)

Inhibitor

 

IR b

IR a

GUS2

YZ

ISR


2.4

1.52

5.16

2.96

3.24

1.35

1.004*

5.11

0.98*

1.003*

5.48 

3.16

2.2

15.19

23.3

6.14

4.4

5.12

24.88

1.05*

1.01*

19.4

1.25 (1.03-2.5) ×10-5

3.07 (2.38-4.21)×10-5

5.29 (3.9-6.1)×10-4

3.11 (1.9-6.11) ×10-6

7.71 (<9.03) ×10-6

6.35(<8.2) ×10-5

8.76 (>4.6) ×10-5

3.95 (1.7-5.2) ×10-4

8.47 (6.1-9.5) ×10-7

8.12 (5.6-9.49) ×10-6

4.36 (3.5-9.3) ×10-6

3.01 (1.8-6.7) ×10-5

4.69 (3.87-5.21) ×10-5

2.73 (1.3-6.8) ×10-4

9.23(7.01-13.5) ×10-6

2.5(1.7-3.2) ×10-5

8.61(5.9-12.4) ×10-5

8.8 (7.13-10.2) ×10-5

2.02 (1.2-6..31) ×10-3

8.32 ( 6.5-10.13) ×10-7

8.15 (>5.2) ×10-6

2.39 (1.41-6.5) ×10-5

3.96 (1.8-5.20×10-6

6.82 (5.27-8.56)×10-5

8.04 (6.05-10.8)×10-3

7.26 (5.9-9.12) ×10-5

4.74 (3.5-9.5) ×10-5

2.8 (>1.7) ×10-4

4.49 (1.9-7.9) ×10-4

9.83 (6.3-14.5) ×10-3

8.95 (6.32-11.1)×10-7

8.21(>6.98) ×10-6

8.48 (5.4-11.23)×10-5

Eserine

Aldicarb

monocrotophos

Chlorpyrifos

Neostigmine

MTMC

Dimetoate

phosphamidon

carbofuran

carbaryl

paraoxon










IR) Insensitivity Ratios(  a =  IC50 of ISR population / LC50 of GUS2 population      

IR b =  IC50 of  Yz population / LC50 of GUS2 population  

*  اختلاف ها معنی دار نمی باشند.

 

 

استیل کولین استراز آنزیمی منحصر به فرد با ویژگیهای خاص می باشد که تفاوتهای بارزی با دیگر هیدرولازها دارد. این تفاوتها منجر به کارآیی بالای این آنزیم شده است. از آن جمله می­توان به وجود یک پیوند هیدروژنی بیشتر بین آنزیم و سوبسترا در جایگاه فعال اشاره کرد. همچنین وجود اسید آمینه های آروماتیک اضافی، در دهانه جایگاه فعال و نیروهای الکترواستاتیک بیشتر آن در طی مسیر، منجر به کارآیی بالای آنزیم در اتصال به سوبسترای خود شده است (24). غیر حساس شدن جایگاه فعال AChE، به برخی از ترکیبات فسفره آلی و کارباماتها در آفات مختلف از جمله کنه دو لکه ای گزارش شده است (2، 4 و 18). در این تحقیق، به منظور مطالعه غیر حساس شدن آنزیم AChE و تعیین نقش آن در مکانیسم مقاومت، فعالیت ویژه این آنزیم، همچنین پراکنش باندهای الکتروفورزی و اثر مهارکنندگی 11 آفت کش از جمله کلرپایریفوس مورد بررسی قرار گرفت.  فعالیت ویژه این آنزیم با تمام سوبستراها در جمعیت مقاوم و نیمه مقاوم به ترتیب بیشتر از جمعیت حساس مشاهده شد که نشان­دهنده نقش آنزیم AChE در مقاومت به کلرپایریفوس است. در ادامه زایموگرام استیل کولین استراز مورد بررسی قرار گرفت (شکل 2). آنالیز زایموگرام نشان داد که تحرک الکتروفورزی در جمعیت ISR با جمعیت حساس کمی متفاوت است که حاکی از این است که جمعیت مقاوم دارای AChEای است که به طور کیفی تغییر یافته است. همچنین مهارکننده کلرپایریفوس، سبب مهار باندهای جمعیت حساس شده در حالی که این باند در جمعیت مقاوم همچنان باقی است. در نهایت برای اثبات غیرحساس شدن آنزیم استیل کولین استراز، IC50 چندین مهارکننده این آنزیم، اندازه گیری شد. نتایج نشان داد که در همه این ترکیبات، جمعیت مقاوم در غلظت بالاتری از مهارکننده، مهار می شود. به خصوص در تعدادی از این ترکیبات فسفره آلی، تفاوتها آشکارتر می باشد (جدول 2). بیشترین و کمترین نسبت غیرحساس شده (IR) به ترتیب در phosphamidon و carbaryl برای جمعیت مقاوم و phosphamidon و carbofuran برای جمعیت نیمه مقاوم به دست آمد. مقدار IC50 کلرپایریفوس در جمعیتهای ISR، Yz و GUS2 به ترتیب 5-10×26/7، 6-10×23/9 و 6-10×11/3 مولار تخمین زده شد. فعالیت بالای AChE در جمعیت مقاوم و نیمه مقاوم و همچنین نتایج حاصل از زایموگرام و تعیین IC50 مهارکننده روی این آنزیم، ایجاد برخی تغییرات ساختاری در آنزیم را تأیید می­کند. مطالعات بیوشیمیایی نشان داد که غیرفعال شدن جایگاه هدف، مکانیسم عمده مقاومت در این آفت، نسبت به تعدادی از ترکیبات فسفره آلی می باشد (19) و تاکنون در ژاپن و نیوزیلند و بلژیک و آلمان گزارش شده است (2، 4، 21 و 22). مطالعات مولکولی نشان داد جایگزینی یک یا تعدادی اسید آمینه در جایگاه کاتالیتیک آنزیم و یا اطراف آن رخ داده که این جهشها منجر به حساسیت کمتر به سموم و مهارکننده ها و در نتیجه ایجاد مقاومت درT. urticae می شود (2 و 12).

در نهایت، نتایج حاصل از این تحقیق نشان می دهد که ارتباط منطقی بین نسبت مقاومت و نسبت غیرحساس شدن استیل کولین استراز نسبت به کلرپایریفوس وجود دارد (جدول 2). نسبت مقاومت و نسبت غیرحساس شدن به ترتیب 9/176 و 3/23 در جمعیت مقاوم و 78/9 و 96/2 در جمعیت نیمه مقاوم برآورد شد. داده ها نشان دهنده استیل کولین استراز تغییر در جمعیت مقاوم (ISR) و نیمه مقاوم (YZ) می باشد که به احتمال زیاد مکان جهش در این دو جمعیت متفاوت می باشد. بنابراین مطالعات مولکولی تکمیلی روی مکان جهش می تواند اطلاعات با ارزشی در مورد برهمکنش بازدارنده ها با مکان فعال در اختیار بگذارد.

1. Ay, R. and Yorulmaz, ES. (2010) Inheritance and detoxification enzyme levels in Tetranychus urticae Koch (Acari: Tetranychidae) strain selected with chlorpyrifos. Journal of Pest Science. 83: 85-96.

2. Anazawa, Y., Tomita, T., Aiki, T., Kozaki, T. and Kono, Y.)2003( Sequence of a cDNA encoding acetylcholinesterase from susceptible and resistant two-spotted spider mite, Tetranychusurticae. Insect Biochemistry and Molecular Biology. 33: 509-514.

3. Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W. and Lipman, D. J. )1997( Gapped BLAST and PSI- BLAST: a new generation of protein database search programs. Nucleic Acids Research. 25: 3389-3402.

4. Ballantyne, G. H., Harrison, R. A. )1967( Genetic and biochemical comparisons of organophosphate resistance between strains of spider mites (Tetranychusspecies: Acari). EntomologiaExperimentalisetApplicata. 10: 231–239.

5. Benson, D. A., Mizrachi, I. K., Lipman, D. J., Ostell, J., Rapp, B. A. and Wheeler, D. L. )2004(GenBank. Nucleic Acids Research. 32: 23-26.

6. Davis, B. J. 1964. Disc electrophoresis II.Method and application to human serum proteins, Annals of the New York Academy of Sciences. 121: 404-427.

7. Ellman, G. L., Courtney, K. D., Anres, V. and Featherstone R. M. )1961( A new and rapid colorimetric determination of acetylcholinesterase activity. Biochemical Pharmacology. 7: 88-95.

8. Georghiou, G. P., Lagunes-Tejeda, A. )1991( The Occurrence of Resistance to Pesticides in Arthropods: an Index of Cases Reported through 1989. Food and Agricultural Organisation of the United Nations, Rome, Italy. 318p.

9. Ghadamyari, M., Talebi, K., Mizuno H. and Kono, Y. (2008) Oxydemeton-methyl resistance, mechanisms, and associated fitness cost in green peach aphids (Hemiptera: Aphididae). Journal of Economic Entomology. 101: 1432-1438.

10. Hiroi, T., Miyazaki, Y., Kobayashi, Y., Imaoka, S. and Funae, Y. )1995( Induction of hepatic P450 s in rat by essential wood and leaf oils. Xenobiotica. 25: 457-467.

11. Kato, Y., Nomura, M. and Miyata, T. (1999) Negatively correlated cross-resistance between N-Methyl carbamate and monocrotophos in green rice leafhopper, Nephotettix cincticeps. Uhler. Journal of Pesticide Science, 24: 364-368.

12. Khajehali, J., van Leeuwen, T., Grispou, M., Morou, E., Alout, H., Weill, M., Tirry, L., Vontas, J. and Tsagkarakou, A. )2009( Acetylcholinesterase point mutations in European strains of Tetranychusurticae (Acari: Tetranychidae) resistant to organophosphates. Pest Management Science. 66:220-228.

13. Kwon, DH., Choi, JY., Je, YH. and Lee, SH. (2012) The overexpression of acetylcholinesterase compensates for the reduced catalytic activity caused by resistance-conferring mutations in Tetranychus urticae. Insect Biochemistry and Molecular Biology.42: 212-21

14. Lewis, P. R. and Shute, C. C. )1966( The distribution of cholinesterase in cholinergic neurons demonstrated with the electron microscope. Journal of Cell Science. 1: 381-390.

15. Ros, V. I. D. and Breeuwer, J. A. J. )2007( Spider mite (Acari: Tetranychidae) mitochondrial COI phylogeny reviewed: host plant relationships, phylogeography, reproductive parasites and barcoding. Experimental and Applied Acarology. 42: 239-262.

16. Stumpf, N. and Nauen, R. (2001) Cross-resistance, inheritance and biochemistry of mitochondrial electron transport inhibitor acaricide resistance in Tetranychus urticae (Acari: Tetranychidae). Journal of Economic Entomology. 94: 1577–1583.

17. Tsagkarakou, A., Navajas, M., Cuany, A., Chevillon, C. and Pasteur, N. (2002) Mechanisms of resistance to organophosphates in Tetranychus urticae (Acari: Tetranychidae) from Greece. Insect Biochemistry and Molecular Biology. 32: 417–424.

18. van Leeuwen, T., Vontas, J., Tsagkarakou, A. and Tirry, L. )2009( Mechanisms of acaricide resistance in the two-spotted spider mite Tetranychusurticae. pp. 347-393. In:Ishaaya, I. and Horowitz, A. R. (eds.). Biorational Control of Arthropod Pests, Springer Science and Business Media.

19. van Leeuwen, T., J. Vontas, A. Tsagkarakou, W. Dermauwa and L. Tirry.)2010(Acaricide resistance mechanisms in the two-spotted spider mite Tetranychusurticaeand other important acari: A review. Insect Biochemistry and Molecular Biology. 40: 563-72.

20. Voss, G. and Matsumura, F. )1964( Resistance to organophosphorus compounds in the two-spotted spider mite: two different mechanisms of resistance. Nature. 202: 319-320.

21. Voss, G. and Matsumura, F. )1964( Resistance to organophosphorus compounds in the two-spotted spider mite: two different mechanisms of resistance. Nature. 202: 319-320.

22. Zahavi, M. and Tahori, A. S. )1970( Sensitivity of acetylcholinesterase in spider mites to organophosphorous compounds. Biochemistry and Pharmacology.19: 219-225.

23. Zamani, P., H. Sajedi, R., Ghadamyari, M. and Memarizadeh, N. (2014). Resistance mechanisms to chlorpyrifos in Iranian populations of the two-spotted spider mite, Tetranychus urticae (Acari: Tetranychidae). Journal of Agricultural Science and Technology. 16: 277-289.

24. Zhang, Y., Kua, J. and McCammon, A. )2002( Role of the catalytic triad and oxyanion hole in acetylcholinesterase catalysis. Journal of American chemical society. 124: 10572-10577.