نوع مقاله: مقاله پژوهشی

نویسندگان

1 هیات علمی دانشگاه حکیم سبزواری

2 هیات علمی پژوهشگاه ملی مهندسی ژنتیک و زیست فن آوری

چکیده

با هدف دستیابی به کلون های پایدار از سلول های S2 بیان کننده فاکتور 9 انعقادی انسانی (S2-hFIX)، در این مطالعه تاثیر عوامل مختلف بر تراآلایی و بیان پروتئین نوترکیب در سامانه بیانی S2 قابل القاء ،با استفاده از یون فلزی به عنوان القاء کننده، مورد ارزیابی قرار گرفت. پس از تراآلایی یک سازه بیان کننده EGFP تحت کنترل پروموتر متالوتیونین(pMT-EGFP) به سلولهای S2 با روش های لیپوفکشن و کلسیم فسفات، بررسی نتایج بیانی نشان داد که انتقال سازه به این سلولها با روش کلسیم فسفات در06/7pH= و غلظت µg/ml 10 کارآیی بالاتری دارد. الگوی الکتروفورزی محصولات RT-PCR فاکتور 9 ترشح شده از سلولهای S2-hFIX نشان داد که پروموتر متالوتیونین دروزوفیلایی بدنبال القا با سولفات مس از دقت تنظیمی بالایی برخوردار است و قادر به هدایت نسخه برداری در سطح بالا است. جداسازی کلون پایدار در دو محیط واجد میتومیسین (روش غیر مستقیم) و فاقد آن (روش مستقیم) مورد مقایسه قرار گرفت که در هر دو روش زمان تهیه کلون پایدار حدود 3 هفته است که نسبت به زمان تهیه کلون پایدار در سلولهای پستانداران بسیار کوتاهتر است.

کلیدواژه‌ها

عنوان مقاله [English]

Optimization of transfection and stable expression of human factor IX in Drosophila S2 cells

نویسنده [English]

  • Jafar Vatandoost 1

چکیده [English]

Our data point to optimized experimental conditions for high expression of heterologous proteins by Drososphila melanogaster S2 cells. Following construction of pMT-EGFP and transfection of S2 cells with calcium phosphate or lipofection methods, the EGFP expression analysis showed that the transfection efficiency with calcium phosphate method with pH=7.06 and 10 μg/ml of DNA is more than that of lipofection method. The electrophoresis pattern of the RT-PCR products of S2 driven hFIX indicated that the Drosophila metallothionein promoter is tightly regulated and capable of driving high-level heterologous transcription upon induction by CuSO4. Nevertheless, the two methods were designed for construction of a recombinant stable S2 cell. In both methods, with and without Mitomycin, stable clones were recovered after only 3 weeks of hygromycin selection that is shorter than selection time in the mammalian cells. Therefore, our results show that Drosophila S2 cells do not have the limitations mentioned for mammalian cells.

کلیدواژه‌ها [English]

  • Drososphila S2 cells
  • Coagulation factor IX
  • calcium phosphate
  • lipofection

بهینه سازی تراآلایی و بیان پایدار فاکتور9 انسانی در رده سلولی دروزوفیلا

جعفر وطن دوست1* و علیرضا زمردی پور2

1 سبزوار، دانشگاه حکیم سبزواری،گروه زیست شناسی

2 تهران، پژوهشگاه ملی مهندسی ژنتیک و زیست فنآوری 

تاریخ دریافت: 13/10/91             تاریخ پذیرش: 28/3/92

چکیده

با هدف دستیابی به کلونهای پایدار از رده سلولی S2 از دروزوفیلا بیان کننده فاکتور 9 انعقادی انسانی (S2-hFIX)، در این مطالعه تأثیر عوامل مختلف بر تراآلایی (Transfection) و بیان پروتئین نوترکیب در سامانه بیانی S2 قابل القاء، با استفاده از یون فلزی به عنوان القاء کننده، مورد ارزیابی قرار گرفت. پس از تراآلایی یک سازه بیان کننده EGFP تحت کنترل پروموتر متالوتیونین (pMT-EGFP) به سلولهای S2 با روشهای لیپوفکشن و کلسیم فسفات، بررسی نتایج بیانی نشان داد که انتقال سازه به این سلولها با روش کلسیم فسفات در06/7pH= و غلظت µg/ml 10 کارآیی بالاتری دارد. الگوی الکتروفورزی محصولات RT-PCR فاکتور 9 ترشح شده از سلولهای S2-hFIX نشان داد که پروموتر متالوتیونین دروزوفیلایی به دنبال القاء با سولفات مس  از دقت تنظیمی بالایی برخوردار است و  قادر به هدایت نسخه برداری در سطح بالا است. جداسازی کلون پایدار در دو محیط واجد میتومیسین (روش غیر مستقیم) و فاقد آن (روش مستقیم) مورد مقایسه قرار گرفت که در هر دو روش زمان تهیه کلون پایدار حدود 3 هفته است که نسبت به زمان تهیه کلون پایدار در سلولهای پستانداران بسیار کوتاه تر است.  

واژه های کلیدی: سلولهای S2 دروزوفیلایی، فاکتور 9 انعقادی، کلسیم فسفات، لیپوفکشن

* نویسنده مسئول، تلفن: 05714003329، پست الکترونیکی: j.vatan@hsu.ac.ir

مقدمه

 

استفاده از رده های سلولی پستانداران برای تولید انبوه پروتئینهای نوترکیب عموماً با محدودیتهایی مواجه است. در واقع رده های سلولی پستانداران پایدار تنها بعد از یک دوره زمانی طولانی به دست می آیند و از طرفی بعد از ساخت رده سلولی نیاز است تا سلولها به طور مداوم تحت فشار انتخابی حفظ شوند و حتی ممکن است در کشت طولانی مدت ناپایدار شوند (2). آلودگی احتمالی با ویروسها، یک محدودیت دیگر در استفاده از سامانه های بیانی پستانداران برای تولید انبوه پروتئین است (21). از طرفی اغلب پروموترهای القایی نیز در این سامانه ها، یک سطح فعالیت پایه مداوم را نشان می دهند.

سامانه های بیانی حشرات که به طور فزآینده ای برای پروتئینهای مختلف استفاده می شود، یک روش سریع و ساده برای تولید پروتئین در سطح میلی­گرم را فراهم نموده است (2). یکی از سامانه های بیانی که از سلولهای حشرات بهره می برد سامانه بیانی باکولوویروس است (13). اصلی ترین عیب این سامانه این است که  بیان پروتئین مورد نظر معمولاً بوسیله پروموترهای ژنهای تأخیری از قبیل پلی هیدرین هدایت می شود، بنابراین حداکثر تولید پروتئین در نقطه ای است که سلولها به خاطر عفونت ویروسی می­میرند و در شرایط مرگ سلول میزبان تغییرات بعد از ترجمه که می بایست بر روی پروتئین بیان شده اتفاق بیفتد دچار اخلال می گردد. از طرفی لیز سلولی در این سامانه باعث آلودگی شدید پروتئین هدف با پروتئینهای سلولی از قبیل پروتئازها می شود. لذا زمان برداشت محصول در این سامانه خیلی حیاتی  و در عین حال محدود است (21). همچنین چون ژنوم باکلوویروس وارد ژنوم میزبان نمی شود، برای سنتز پروتئین نوترکیب در سلول جدید نیاز به عفونتهای مکرر می باشد و از آنجایی که سلولهای میزبان سرانجام می میرند، ژن نامتجانس نمی تواند به صورت مداوم بیان شود (21). برای مقابله با این مشکلها، در سالهای اخیر رده سلولی اشنایدر 2 (S2) از دروزوفیلا به عنوان میزبان برای بیان پروتئینهای نامتجانس معرفی شده و تاکنون بیان موفق شماری از پروتئینها توسط این سیستم گزارش شده است (2، 4، 9 و 19). این سامانه بیانی یک سامانه غیرلیتیک و برپایه وکتورهای پلاسمیدی است (16). بررسیها نشان داده اند که وکتورهای بیانی این نوع سامانه به صورت چند نسخه به داخل کروموزوم سلولهای S2 دروزوفیلا وارد می شوند (5 و 12) و این سلولها توانایی ورود بالغ بر 100 نسخه از یک کاست بیانی را به ژنوم خود در یک رخداد تراآلایی دارند (13). به این ترتیب برای تثبیت رده سلولی پایدار با سطح بیان بالا نیاز به دوره زمانی طولانی تکثیر پلاسمید نیست (13).

یکی از اولین گزارشها در به کارگیری این سامانه، بیان دوپامین بتا هیدروکسیلاز (DBH) به میزان mg/L 16 (14) و اینترلوکین 5 انسانی به میزان mg/L 22 در سلولهای S2 بوده است (8). اما تاکنون بیان پروتئینهای وابسته به ویتامین K از جمله فاکتور 9 انعقادی که برای فعالیت خود نیازمند کربوکسیلاسیون اسید آمینه های گلوتامیک در انتهای آمینوی خود هستند در این سامانه صورت نگرفته است. زیرا تصور می شد سلولهای حشرات از جمله سلولهای S2 دروزوفیلایی فاقد فعالیت گاما کربوکسیلازی هستند و یا آنزیم گاما کربوکسیلاز قابلیت شناسایی پروپپتید این نوع پروتئینها را ندارد (15). به دنبال آزمایشات Bandyopadhyay در شرایط in vitro (1) و مطالعات قبلی در شرایط  in vivo  (19)، مشخص گردید که سلولهای S2 نه تنها برخلاف سایر حشرات واجد فعالیت گاما کربوکسیلازی اند بلکه می توانند فاکتور 9 را به عنوان سوبسترا شناسایی و کربوکسیله کنند. از آنجایی که مطالعات قبلی با هدف بررسی بیان و فعالیت فاکتور 9 انسانی در رده سلولی S2 بوده است بنابراین بیان موقت فاکتور 9 و کربوکسیلاسیون آن مورد بررسی قرار گرفت. اما در این پژوهش با هدف بیان در سطح بالا، ابتدا شرایط بهینه تهیه کلونهای پایدار سلولهای S2 بیان کننده فاکتور 9 انعقادی انسانی (S2-hFIX) و همچنین تأثیر عوامل  مختلف بر بیان پروتئین نوترکیب در سامانه بیانی S2 قابل القاء با یون فلزی  مورد ارزیابی قرار گرفت.

مواد و روشها  

پلاسمید های pcDNA3 و pMT-V5-HisA از شرکت Invitrogene و پلاسمید pIRES2-EGFP از شرکت بن یاخته تهیه گردید. اولیگونوکلئوتیدها به وسیله شرکت Bioneer سنتز شدند. محیط کشت دروزوفیلایی، پنی سیلین G و استرپتومایسین از شرکت سیگما خریداری گردید. محیط کشت RPMI-1640، سرم جنین گاوی (FBS)،L-glutamine، sodium pyruvate و اسید آمینه های غیرضروری از شرکت Gibco (BRL Life Technology (Karlsruhe)) خریداری شد. همه آنزیمهای مورد استفاده و همچنین کیتهای تخلیص PCR، تخلیص پلاسمید، تهیه RNA و سایر مواد شیمیایی از قبیل جنتیسین (G418) و مهار کننده های پروتئازها از شرکت Roche خریداری شد. کیت InsT/Aclone از شرکت فرمنتاز،کیت الایزای مخصوص فاکتور 9 و مواد مربوط به آزمون انعقاد یک مرحله ای از شرکت  (Diagnostica Stago-France) تهیه گردید. سلولهای دروزوفیلایی اشنایدر 2 (S2) از پروفسور M. Matsuda در دانشگاه Kyorin (Tokyo, Japan) اهدا شد. این سلولها در دمای 28 درجه سانتی گراد و بدون نیاز به CO2 و FBS رشد می کنند.  همه آزمایشات در دو یا سه تکرار انجام شد و مقایسه میانگینها با استفاده از آنالیز واریانس (ANOVA) و آزمون دانکن در سطح 5 درصد انجام شد.

کشت سلولهای S2: برای کشت سلولهای S2 به ازای هر میلی لیتر از محیط کشت، 1-2 میلیون سلول اضافه گردید و بسته به حجم ظرف کشت به آنها محیط کشت اختصاصی Ex-Cell 400 همراه باFBS 10 درصد یا بدون آن افزوده شد. سلولها در انکوباتور با دمای 28 درجه سانتی گراد و بدون CO2 قرار داده شد. هر چهار الی پنج روز محیط سلولها تعویض گردید تا سلولها به اندازه کافی رشد کنند. در این موقع سلولها در ظروف جدید پاساژ داده می شد.

ساخت سازه های بیانی:  وکتور pIRES2-EGFP حاوی cDNA-EGFP با آنزیمهای KpnI و NotI برش داده شد و پس از خالص سازی، برای کلون سازی در پلاسمید pMT-V5-His A که با آنزیمهای KpnI و NotI بریده شده بود، مورد استفاده قرار گرفت. عمل اتصال بین cDNA و پلاسمید pMT-V5-His A منجر به ساخت پلاسمیدpMT-EGFP گردید. برای دستیابی به فاکتور 9 با انتهاهای 5' Kpn I و 3' Xho I، cDNA فاکتور 9 با پرایمرهای hFIX-KpnI (5'GGGGTAC/CGCCACCATGCAGCGCGTGAAC3') و hFIX-XhoI (5'CCGC/TCGAGATCCATCTTTCATTAAGTGAGC3') تکثیر و در T- وکتور کلون گردید. بعد از برش پلاسمید حاصله (T.V-hFIX) با آنزیمهای XhoI و KpnI، خروج cDNA فاکتور 9، تخلیص از ژل و همچنین برش پلاسمید pMT-V5-His A با آنزیمهای XhoI و KpnI، عمل اتصال بین cDNA و پلاسمید pMT-V5-His A صورت گرفت که منجر به ساخت پلاسمید pMT-hFIX گردید. همچنین برای تأیید کلونینگ و بررسی عدم وجود جهش در فاکتور 9 کلون شده، این پلاسمید نوترکیب با استفاده از یک جفت پرایمر عمومی T7 promoter  و BGH-r تعیین توالی گردید. بررسی توالی نشان دهنده صحت کلونینگ و عدم وجود جهش در فاکتور 9 می باشد.

بهینه سازی شرایط تراآلایی: جهت بهینه سازی شرایط تراآلایی، پلاسمیدpMT-EGFP  با دو روش کلسیم فسفات و لیپوفکشن به سلولهای S2 منتقل شد. بر این اساس سلولهای S2 با غلظتهای مختلف از فیوژن-6 و یا با روش کلسیم فسفات در pH های مختلف از HEPES (06/7، 08/7و 1/7) تراآلوده گردیدند. تعداد و درصد سلولهای زنده قبل و بعد از کشت تعیین گردید. برای شمارش سلول، یک حجم از سلولها با 9 حجم رنگ متیل گرین رقیق گردید و برای تعیین درصد سلولهای زنده به 9 حجم از سلولها یک حجم رنگ تریپان بلو اضافه شد. بلافاصله وضعیت آنها در زیر میکروسکوپ مورد بررسی قرار گرفت. سلولهای مرده در اثر نفوذ رنگ به داخل آنها به رنگ آبی درآمده ولی سلولهای زنده بی رنگ باقی می مانند.

برای تراآلایی سلولهای S2 با فیوژن-6، 2 ساعت قبل از تراآلایی، سلولها در 1 میلی لیتر از محیط بدون سرم و با تراکم سلولی 106 ×4 پاساژ داده شدند. سپس  تراآلایی مطابق روش ذیل انجام شد. در یک ویال 100 میکرولیتر از محیط کشت بدون سرم و لیپوفکتامین و در ویال دیگر 100 میکرولیتر از محیط کشت بدون سرم و DNA را ریخته، سپس با هم مخلوط و به مدت 15 دقیقه در دمای آزمایشگاه تیمار شد. محلول فیوژن-6 و DNA مورد نظر با نسبتهای 3:1، 3:2 و 6:1 اضافه شدند. به مخلوط فوق، 300 میکرولیتر از محیط کشت بدون سرم اضافه شد و مخلوط حاصل قطره قطره به ظرف کشت سلولی اضافه گردید. 12-16 ساعت پس از تراآلایی محیط سلولها با محیط تازه و گرم تعویض شد.

در روش کلسیم فسفات، 24 ساعت قبل از  تراآلایی 3 میلی لیتر از سلولها را با تراکم سلولی 106 سلول برای هر میلی لیتر به ظرف کشت 6 خانه­ای منتقل و به مدت 24 ساعت در دمای 28 درجه سانتی گراد در انکوباتور قرار داده شد. قبل از تراآلایی، 300  میکرولیتر از مخلوط  تراآلایی شامل 36 میکرولیتر از CaCl2 دو مولار، 10-5 میکروگرم از DNA  و آب تزریقی در یک لوله استریل فراهم  شد. سپس یک حجم از این مخلوط را با یک حجم از HEPES 2 x   قطره قطره خوب مخلوط و هوا دهی و تا 20 دقیقه در دمای آزمایشگاه قرار گرفت. به ازای هر 1 میلی لیتر ازمحیط کشت 2/0 میلی لیتر از مخلوط  تراآلایی به محیط کشت سلولی اضافه شد و به آرامی حرکت داده تا خوب مخلوط شود ( این مرحله باید به سرعت انجام گیرد). پس از انجام  تراآلایی سلولها به مدت 16-6 ساعت در دمای 28 درجه سانتی گراد انکوبه و پس از آن محیط سلولها با محیط تازه و گرم تعویض شد.  

پروموتر متالوتیونین و ارزیابی نسخه برداری فاکتور 9: برای ارزیابی عملکرد پروموتر متالوتیونین در بیانcDNA  فاکتور 9 در سلولهای S2 ترانسفکت شده، استخراج RNA و آزمایشRT-PCR  انجام گرفت. به این منظور RNA تام از سلولهای نوترکیب القاء شده و القاء نشده استخراج شد. به منظور حذف DNA که احتمالاً همراه با RNA از سلولها استخراج شده است، قبل از ساخت cDNA، RNA‌های تهیه شده تحت اثر آنزیم DNase فاقد RNase قرار گرفتند. cDNA توسط آنزیم رونوشت بردار معکوس M-Mulv با استفاده از  RNA تیمار شده با DNAase عاری از RNAase به عنوان الگو ساخته شد. برای تهیه cDNA از پرایمرهای هگزامری و برای تکثیر آن توسط PCR، از پرایمرهای hFIX-KpnI  و  hFIX–XhoIاستفاده گردید.

تهیه کلون های پایدار: برای دستیابی به رده سلولی پایدار از سلولهای S2، پلاسمید مورد نظر همراه با پلاسمید انتخابی pCoHygro که ژن مقاومت به هایگرومایسین را دارد تراآلایی شد. به منظور انتخاب سلولهای نوترکیب، 48 ساعت پس از تراآلایی، هایگرومایسین با غلظت μg/ml 300 به محیط کشت سلولها افزوده شد. 10-7  روز پس از تیمار با هایگرومایسین در سلولهای تراآلوده شده، کلنیهای مقاوم از طریق دو روش مستقیم (استفاده از پلیت 96 خانه) و غیرمستقیم (استفاده از میتومیسین) جدا شدند.

جداسازی کلون های پایدار به روش مستقیم و در پلیتهای 96 خانه صورت گرفت بدین صورت که بعد از  تراآلایی سلولها با پلاسمید نوترکیب در روز اول و تعویض محیط در روز دوم، سلولهای تراآلوده شده در پلیتهای 96 خانه در معرض محیط انتخابی واجد هایگرومایسین قرار گرفتند. لذا در روز سوم، سلولهای تراآلوده شده به گونه ای در محیط انتخابی واجد هایگرومایسین رقیق می شود که در هر 100 میکرولیتر تنها به طور میانگین 104×2 یا 104×5 سلول وجود داشته باشد. به هر خانه از پلیتهای 96 تایی، 100 میکرولیتر از محیط حاوی سلولهای فوق اضافه کرده و 2 روز بعد از انتقال سلولها نیز، 100 میکرولیتر محیط انتخابی دیگر به هر خانه اضافه گردید. بعد از 2 هفته از کشت سلولها در محیط واجد هایگرومیسین، سلولهای پایدار از نظر بیان و فعالیت فاکتور 9 بررسی و به پلیت 48 خانه منتقل شدند. بعد از رشد و بررسی مجدد از نظر بیان، سلولهای مقاوم به پلیت 12 و در نهایت 6 خانه منتقل شدند.

در روش غیر مستقیم، حدود 150 میلیون سلول عادی تراآلوده نشده به مدت 4 ساعت در مجاورت با میتومیسین قرار داده می شوند. میتومیسین به طور کوالانتی به DNA متصل می شود و از تکثیر آن جلوگیری می کند هر چند که سلولها زنده می مانند. پس از سانتریفیوژ و شستشو با PBS (3 بار)، این سلولها با تراکمcell/ml    106 × 3 در پلیت های 24 خانه منتقل شدند. از طرفی سلولهای تراآلوده شده مخلوط سلولی پایدار به گونه ای رقیق می شود که در هر 100 میکرولیتر به طور میانگین تنها یک سلول وجود داشته باشد. لذا این مقدار به سلولهای عادی تراآلوده نشده و تیمار شده با میتومیسین در پلیت 24 خانه اضافه می گردد. بعد از 2 هفته از کشت سلولها در محیط واجد هایگرومایسین، سلولهای پایدار که از یک کلون رشد کرده اند از نظر بیان و فعالیت فاکتور 9 بررسی و به پلیت 12 خانه منتقل شدند.

ارزیابی بیان و فعالیت فاکتور 9 نوترکیب: به منظور بررسی وجود فاکتور 9 در محیط کشت سلولهای تراآلوده شده، محیط کشت سلولها در روزهای اول، دوم و سوم پس از افزودن ویتامین K1 (µg/ml5) (6 و 7) و القاء با سولفات مس (µg/ml500)، جمع آوری شد و پس از سانتریفیوژ، محلول رویی در 20- درجه سانتی گراد فریز گردید. آنتی ژن فاکتور 9 نوترکیب انسانی بیان شده در محیط کشت سلولهای تراآلوده شده با روش ساندویچی الایزا بر روی میکروپلیت‌ها که با آنتی بادیهای پلی کلونال ضد فاکتور 9 که در کیت الایزا مهیا شده بود آشکار شد. آشکار سازی کمپلکس آنتی ژن-آنتی بادی بر اساس فعالیت آنزیم پراکسیداز بر روی سوبسترا (OPD) در حضور پراکسید اوره انجام شد. بعد از اینکه واکنشها با اضافه کردن هیدروکلریک اسید متوقف شد رنگ به دست آمده در طول موج 490 نانومتر اندازه‌گیری شد. OD مشاهده شده نسبت مستقیم با غلظت فاکتور 9 انسانی دارد.

از آزمایش APTT (Activated partial thromboplastine time) برای بررسی فعالیت بیولوژیکی فاکتور 9 در محیط کشت استفاده گردید (6 و 7). برای اندازه گیری میزان فعالیت انعقادی فاکتور 9 از پلاسمایی استفاده می شود که واجد تمامی فاکتورهای لازم در این مسیر انعقادی بوده ولی فاقد فاکتور 9 باشد. بنابراین زمان انعقاد این پلاسما در مقایسه با استاندارد طولانی بوده، ولی در صورت اضافه کردن نمونه مورد آزمایش به این پلاسما و وجود فاکتور 9 در این نمونه مدت این زمان کاهش می یابد. در این روش از پلاسمای سیتراته افراد نرمال ( حدود 30 نفر) که با یکدیگر مخلوط گردیده بود به عنوان استاندارد استفاده گردید. فعالیت این فاکتور در پلاسمای این افراد که به نسبت 1 به 10 رقیق شده باشد  mU/ml 100 (100 درصد) در نظر گرفته می شود.

 

 

 


 


شکل 1- نقشه پلاسمید pMT-EGFP و الگوی الکتروفورزی حاصل از هضم برشی. ردیف 1 و 5: مارکر III، ردیف 2: پلاسمید نوترکیب pMT-EGFP، ردیف 3: برش پلاسمید نوترکیب pMT-EGFP با آنزیم NcoI و ردیف 4: برش پلاسمید نوترکیب pMT-EGFP  با آنزیمهای KpnI و NotI.


برای تعیین فعالیت بیولوژیک فاکتور 9 بیان شده توسط سلولهای  تراآلوده شده100 میکرولیتر از محیط کشت جمع‌آوری شده از هر نمونه با100 میکرولیتر از پلاسمای فاقد فاکتور 9 و 100 میکرولیتر از PTT فعال شده مخلوط و دقیقاً 3 دقیقه در درجه حرارت 37 درجه سانتی گراد قرار داده شد. سپس 100 میکرولیتر کلسیم کلرید mM 25 از قبل گرم شده در 37 درجه سانتی گراد به آن اضافه و زمان انعقاد اندازه‌گیری گردید. فعالیت انعقادی هر نمونه بر اساس نمودار استاندارد تعیین شد. اندازه‌گیری زمان انعقاد به صورت چشمی انجام شد.

نتایج

ساخت سازه های بیانی: برای تأیید ساخت پلاسمید pMT-EGFP، برش همزمان آن با آنزیمهای KpnI و NotI  انجام شد. انتظار می رفت در صورت کلون شدن cDNA-EGFP در پلاسمید pMT-V5-His A و هضم با این دو آنزیم، ایجاد قطعات 3538 و 717 جفت باز نماید که به ترتیب معادل با وکتور  pMT-V5-His Aو cDNA EGFP می باشد. از طرفی هضم با آنزیم NcoI، حالت خطی شده وکتور نوترکیب مورد انتظار بود  و نتایج الکتروفورز محصولات حاکی از آن بود که پلاسمید مورد نظر ساخته شده است (شکل 1). 

در خصوص پلاسمید بیانی pMT-hFIX  نیز انتظار می رفت که اندازه پلاسمید نوترکیب،  4927 جفت بازی باشد که این موضوع بعد از برش پلاسمید نوترکیب با آنزیمهای XhoI و KpnI  تأیید شد. همچنین صحت کلون شدن قطعه مذکور  پس از برش پلاسمید pMT-hFIX با آنزیمهای DraI وHind III نیز تائید شد. طبق انتظار برش با DraI قطعات 19، 230، 692، 1177، 1183 و 1517 جفت بازی حاصل  و پیرو برش با Hind III، قطعات 1984 و 2887 جفت بازی حاصل شد (شکل 2).

 

 

 

 

 


 


شکل2- نقشه پلاسمید pMT-hFIX و الگوی الکتروفورزی حاصل از هضم برشی. برش پلاسمید pMT-hFIX با آنزیمهای DraI  (ردیف 1) و Hind III  (ردیف 2). ردیف 3 مارکر kb 1.


تراآلایی سلولهای S2 با پلاسمید pMT-EGFP : یک روز پس از  تراآلایی سلولهای S2 با دو روش کلسیم فسفات و لیپوفکشن، سلولها با میکروسکوپ فلورسنت بررسی گردیدند. نتایج بیان EGFP نشان داد که واکنش تراآلایی سلولهای S2 به وسیله کلسیم فسفات در مقایسه با  فیوژن-6 موفقیت‌آمیزتر است. همان طور که در شکل 3 مشاهده می شود بیان EGFP در سلولهای S2 با روش کلسیم فسفات و در 06/7pH= و با غلظت  µg/ml 10 از DNA کارآیی بالاتری دارد.

 

 

 


 


 


3

2

1

 


 


 


6

5

4

شکل 3- تراآلایی سلولهای S2 با پلاسمید pMT-EGFP به روش لیپوفکشن وکلسیم فسفات. بیان EGFP در سلولهای S2 تراآلوده شده با روش لیپوفکشن با غلظتهای مختلف از فیوژن-6 /DNA (3:1، 3:2 و 6:1)  (بترتیب ردیف 1،2 و3) و با روش کلسیم فسفات در pH های مختلف  از HEPES (06/7، 08/7 و 1/7) (به ترتیب تصاویر 4، 5 و6).


تراآلایی سلولهای S2 با پلاسمید pMT-hFIX : از آنجایی که غلظت DNA بر کارآیی تراآلایی مؤثر است (10)، برای انتقال pMT-hFIX به سلولهای S2  از غلظتهای مختلف DNA استفاده گردید و بیان فاکتور 9 در شرایط انتقالی  24-120 ساعت پس از تراآلایی به روش الایزا سنجیده شد. نتایج به دست آمده  نشان داد که کارآیی ترانسفکشن با افزایش غلظت DNA افزایش می یابد ولی در غلظتهای بالاتر از µg/ml 10، کارآیی ترانسفکشن روند کاهشی دارد(شکل 4).

رشد و بقا سلولهای تراآلوده : رشد و بقای سلولهای S2  قبل و بعد از تراآلایی با روش کلسیم فسفات  مورد بررسی قرار گرفت. رشد سلولها قبل از تراالایی حالت عادی  و روند افزایشی داشت و هر 16-24 ساعت دو برابر می شد (شکل 5). این در حالی است که تراکم سلولی و دانسیته بالای آنها باعث مرگ سلولی نشده و بقای سلولها در حالت عادی بیشتر از 95 درصد است (شکل 6). بعد از  تراآلایی با کلسیم فسفات در روز دوم، یک کاهش موقتی در رشد سلولها (شکل 5) و همچنین بقا آنها (شکل 6) اتفاق افتاد و در طی روزهای بعد به حالت نرمال برگشت. به نظر می رسد این کاهش بخاطر استرس و شوک وارد شده به سلولها باشد.

 

 

شکل 4 -بررسی تأثیر غلظت  DNA استفاده شده در  تراآلایی سلولهای S2 با روش کلسیم فسفات بر بیان فاکتور 9  بر اساس اندازه گیری آنتی ژن فاکتور 9  بیان شده در محیط کشت 120-24 ساعت پس از تراآلایی  در سه غلظت µg/ml 5 (FIX 5)، µg/ml 10 (FIX 10) و µg/ml 20  (FIX 20) از DNA پلاسمیدی

 

شکل 5- نمودار رشد سلولهای S2  قبل و بعد از  تراآلایی. فلش نشان دهنده  تراآلایی در روز دوم است.

 

شکل 6- نمودار بقای سلولهای S2  قبل و بعد از  تراآلایی. فلش نشان دهنده  تراآلایی در روز دوم است.


بررسی عملکرد پروموتر متالوتیونین: یکی از مزایای ذکرشده برای سلولهای S2 در بیان بهتر پروتئینهای نوترکیب، عدم نشتی در حالت غیر القاء می باشد. برای اثبات این مسئله، استخراج RNA و انجام آزمایشRT-PCR  برای ارزیابی پروموتر متالوتیونین در بیان cDNA  فاکتور 9 در سلولهای S2 ترانسفکت شده انجام گرفت. RT-PCR بر روی نمونه‌های به دست آمده از سلولهای تراآلوده و القاء شده، منتج به تولید قطعه مورد انتظار ‌گردید در حالی که در آزمایش RT-PCR از سلولهای تراآلوده شده و القا نشده، باند مربوط به فاکتور 9 به دست نیامد (‌شکل7). همچنین به عنوان کنترل از RNA سلولهای نوترکیب که باDNAase  مواجه شده بودند بدون انجام RT-PCR به عنوان الگو برای PCR استفاده گردید که هیچ محصولی مشاهده نشد (‌شکل7). لازم به ذکر است که برای بررسی نشتی پروموتر متالوتیونین، سلولهای تراآلوده شده یکسان به دو قسمت تقسیم شدند و القاء بر روی یک قسمت صورت گرفت و نمونه دیگر القاء نگردید. این آزمایش تأیید کرد که پروموترمتالوتیونین به طور قوی تنظیم شده است به طوری که در شرابط القایی روشن و در شرایط غیر القایی خاموش می گردد.

تهیه کلون های پایدار  S2-hFIX: کلنی های پایدار از طریق دو روش مستقیم (استفاده از پلیت 96 خانه) و غیرمستقیم (استفاده از میتومیسین) جدا شدند. نتایج الایزا نشان داد که از میان 24 کلون کشت داده شده در محیط میتومیسین، تنها 2 کلون 1 و21 از سلولهای تراآلوده شده، فاکتور 9 را بیان می کنند (جدول 1). از طرفی بررسی بیان فاکتور 9 از میان 48 کلون رشد داده شده در روش مستقیم با الایزا صورت گرفت که در این میان 36 کلون بیان فاکتور 9 را نشان دادند. 12 کلون که بالاترین بیان فاکتور 9 را داشتند به پلیت 48 خانه منتقل شدند که از این میان 6 کلون با بالاترین بیان برای تست انعقاد انتخاب گردیدند. در این میان کلونهای 2 و 12 که بیشترین فعالیت را داشتند انتخاب گردیدند (جدول 1).  برای انتخاب بهترین کلون برای کشت در مقیاس بالا، دو کلون 2 و12 به همراه دو کلون 1 و21 به  طور جداگانه به فلاسکهای T25 انتقال داده شدند بعد از رسیدن به تراکم 106 × 6 و با انجام آزمونهای الایزا و انعقاد، کلونهای 1 و 21  به عنوان بهترین کلون ها از نظر بیان بیشتر فاکتور 9 فعال انتخاب گردیدند (جدول 1).  

 

شکل 7- بررسی رونوشت فاکتور 9 ایجاد شده توسط پروموتر متالوتیونین در سلول های S2 با روش RT-PCR. ردیف 1: کنترل منفی، ردیف 2: RT-PCR از سلول های S2 تراآلوده و القا نشده. ردیف 3: RT-PCR از سلول های S2 تراآلوده و القا شده و ردیف 4: مارکر III.

جدول 1-  انتخاب بهترین کلون برای کشت در مقیاس بالا با انجام آزمونهای الایزا و انعقاد

# clone

hFIX )ng/ml(

Activity (mU/ml)

hFIX-2

312

48/1

hFIX-12

264

91/0

hFIX-1 (Mit)

804

10/9

hFIX-21 (Mit)

1098

4/16

بحث

وقتی تولید پروتئینهای دارویی مورد هدف باشد، سلولهای CHO بهترین کاندید برای بیان آنها می باشند چرا که تغییرات بعد از ترجمه را به طور صحیح تری انجام می دهند. اما با توجه به مشکلات ذکر شده برای سلولهای پستانداران از جمله آهستگی رشد، پایین بودن بقای سلولی و ناپایداری آنها، سامانه های بیانی حشرات و به ویژه سلولهای دروزوفیلا می توانند جایگزین مناسب تری برای تولید در سطح بالا باشند. در مطالعات قبلی، اولین گزارش از بیان موقتی  فاکتور 9 فعال در سیستم حشره S2 ارائه گردید (19). در ادامه مطالعات با هدف دستیابی به کلونهای پایدار S2 بیان کننده فاکتور 9 انعقادی انسانی، ضمن بررسی تأثیر عوامل مختلف بر تراآلایی و بهینه سازی تراآلایی روشهای دستیابی به کلون پایدار S2  بیان کننده فاکتور 9 نوترکیب پس از القاء با یون فلزی  مورد ارزیابی قرار گرفت.

انتخاب روش مناسب و مؤثر در تراآلایی سلولها نقش به سزایی در ایجاد کلنی های پایدار دارد. نتایج مطالعات حاضر نشان داد که تراآلودگی سلولهای دروزوفیلایی S2 با پلاسمید نوترکیب براساس روش کلسیم فسفات نسبت به روش لیپوفکشن موثرتر است. این نتایج قابل انتظار است زیرا هرچند که ترآلایی سلولهای حشرات بخاطر سادگی معمولاً با روشهای مبتنی بر لیپوزوم انجام می شود اما تعداد کپی وکتور نوترکیب در سلولهای تراآلوده شده با این روشها کم است (17). از طرفی نتایج تراآلایی یک نوع سلول دروزوفیلایی به نام سلولهای Kc167 با روش کلسیم فسفات نیز نشان داده است که این سلولها توانایی ورود بالغ بر 100 کپی از یک کاست بیانی را به ژنوم خود در یک رخداد تراریخت سازی دارند (13 و 17). به این ترتیب در روش کلسیم فسفات نیاز به دوره زمانی طولانی تکثیر پلاسمید برای تثبیت رده سلولی پایدار با سطح بیان بالا نیست (13).

از طرفی در روش تراآلایی کلسیم فسفات، pH بافر تراآلایی نیز یک عامل اساسی است که بر حلالیت فسفات تأثیرگذار است و تغییرات کوچک pH می تواند بر کارآیی تراآلایی تأثیرگذار باشد (11 و 20). همچنین از آنجایی که pH بافر با pH محیط کشت (4/6pH=) متفاوت است، pH بافر HEPES باید به دقت کنترل شود نتایج بررسی pH های متفاوت بافر تراریخت سازی نشان داد که بهترین pH برای تراریخت سازی،06/7 pH= است.  

نتایج بررسی کارآیی تراآلایی سلولهای S2 در ارتباط با غلظت DNA نشان داد که با افزایش غلظت DNA در روش کلسیم فسفات، کارآیی تراآلایی افزایش می یابد ولی در غلظتهای بالاتر از µg/ml 10، کارآیی تراآلایی روند کاهشی دارد. این نتایج به این دلیل است که مقدار بهینه DNA برای استفاده در تراآلایی به طور گسترده ای بستگی به نوع DNA، روش و مواد تراآلایی، نوع رده سلولی و تعداد سلولها دارد (10، 11 و 20).  

به دنبال تراآلایی سلولهای S2 براساس روش کلسیم فسفات، یک کاهش موقتی در رشد و بقای سلولی اتفاق می افتد که در روزهای بعد به حالت نرمال برمی گردد. به نظر می رسد که این کاهش به خاطر استرس و شوک وارد شده به سلولها باشد. همچنین از آنجایی که القاء یک روز بعد از  تراآلایی صورت می گیرد تا سلولها به حالت عادی برگردند، نتایج حاضر نشان داد که سلولهای S2 دروزوفیلایی پس از القاء با سولفات مس رشد خوبی دارند و بقای آنها نیز حدود 95 درصد است که تأیید کننده نتایج Bernard  و  همکارانش است (2) .

یکی از موارد ضروری در تهیه کلونهای پایدار و بیان در سطح بالا، کنترل زمان بیان پروتئین نوترکیب برای تهیه بیشترین مقدار محصول است. استفاده از پروموترهای القایی با کنترل کردن زمان بیان، کمک زیادی به حفظ فرآیندهای طبیعی سلول می کنند زیرا بیان بالای پروتئینهای نوترکیب، انرژی سلول را به سمت تولید خودشان می کشند که باعث بار متابولیکی برای سلول میزبان می گردد (18). هر چند که این بار متابولیکی برای سلول سمی نیست اما در فرآیندهای معمول سلول از قبیل رشد و تکثیر سلولی مؤثر است (3 و 18). استفاده از پروموتر متالوتیونین دروزوفیلایی در پلاسمیدهای نوترکیب که به طور بالایی تنظیم شده است، باعث می شود تا بیان پروتئین نوترکیب در طول دوره قبل از القاء صورت نگیرد و رشد بقای سلولی به طور معمول انجام شود. نتایج RT-PCR بعد از تراآلایی سلولهای S2 با پلاسمید نوترکیب pMT-hFIX که در آن cDNA فاکتور 9 به دنبال پروموتر متالوتیونین کلون شده است نشان می دهد که نسخه برداری از ترانس ژن فقط بعد از القاء صورت می گیرد. در حقیقت الگوی الکتروفورزی محصولات RT-PCR حضور mRNA فاکتور 9 را در سلولهای تراآلوده و القاء شده و عدم حضور آن در سلولهای تراآلوده شده ولی القاء نشده نشان می دهد. بنابراین این آزمایش تأیید می کند که پروموترمتالوتیونین از دقت تنظیمی بالایی برخوردار است و نسخه برداری از cDNA‌ فاکتور 9 در سلولهای تراآلوده فقط بعد از القاء می باشد.

جداسازی کلنی های مقاوم و دستیابی به تک کلون S2 از میان جمعیت نامتجانس، مشابه روش ذکر شده برای سلولهای پستانداران نمی باشد زیرا سلولهای S2 به صورت چسبنده نیستند باشند و رشد آنها به حالت سوسپانسیون است. از طرفی این سلولها در دانسیته کمتر ازcell/ml   106× 2/0 رشد نمی کنند. لذا برای فایق آمدن به این مشکلها از دو روش جداسازی کلون پایدار به روش مستقیم یا غیرمستقیم استفاده شد. در هر دو روش زمان تهیه کلون پایدار حدود 3 هفته می باشد که نسبت به زمان تهیه کلون پایدار در سلولهای پستانداران (حدود 2 ماه) بسیار کوتاه تر است. همچنین می توان تک کلونهای پایدار از سلولهای غیرچسبنده S2 را با استفاده از روش میتومیسین تهیه کرد. لذا نتایج حاضر نشان می دهد که سلولهای S2 محدودیتهای موجود برای تهیه کلون پایدار و بیان بالا در سلولهای پستانداران را ندارند.  

1.   Bandyopadhyay, P.K., K., B.J. Stevenson, J.E. Rivier, B.M. Olivera, K.G. Golic, and Y.S. Rong, 2006, Biochemical characterization of Drosophila gamma-glutamyl carboxylase and its role in fly development. Insect Molecular Biology. 15(2): p. 147-156.

2.   Bernard, A.R., T.A. Kost, L. Overton, C. Cavegn, J. Young, M. Bertrand, Z. Yahiacherif, C. Chabert, and A. Mills, 1994, Recombinant protein expression in a drosophila cell-line - comparison with the baculovirus system. Cytotechnology. 15(1-3): p. 139-144.

3.   Bunch, T.A., Y. Grinblat, and L.S. Goldstein, 1988, Characterization and use of the Drosophila metallothionein promoter in cultured Drosophila melanogaster cells. Nucleic Acids Res. 16(3): p. 1043-61.

4.   Chang KH, P.J., Chung HY, Hwang-Bo J, Lee HH, Kim do H, Soh Y, Chung IS., 2012, Enhanced expression of recombinant human cyclooxygenase 1 from stably-transfected Drosophila melanogaster S2 cells by dimethyl sulfoxide is mediated by up-regulation of nitric oxide synthase and transcription factor Kr-h1. Biotechnol Lett. 34((7)): p. 1243-50.

5.   Cherbas, L. and P. Cherbas, 1997, ''Parahomologous'' gene targeting in Drosophila cells: An efficient, homology-dependent pathway of illegitimate recombination near a target site. Genetics. 145(2): p. 349-358.

6.   Haddad Mashadrizeh A.A , Z.A., Hosseini S. J, Sabouni. F, 2009, In silico investigation and synchronous application of introns 1 and 2 of human beta-globin to increase the expression of human coagulation Factor IX Iranian Journal of Biology. 21(4): p. 918.

7.   Haddad Mashadrizeh A.A. , Z.A., Sabouni F , and Hemmat J.   , 1387, Analysis of the Non-Coding Region of the Human Factor VIII Gene in Comparison with Selected Regions of the Intron 1 of Human Factor IX Iranian journal of Biology. 21(3): p. 549.

8.   Johanson, K., E. Appelbaum, M. Doyle, P. Hensley, B. Zhao, S.S. Abdelmeguid, P. Young, R. Cook, S. Carr, R. Matico, D. Cusimano, E. Dul, M. Angelichio, I. Brooks, E. Winborne, P. McDonnell, T. Morton, D. Bennett, T. Sokoloski, D. McNulty, M. Rosenberg, and I. Chaiken, 1995, Binding interactions of human interleukin-5 with its receptor-alpha subunit - large-scale production, structural, and functional, studies of drosophila-expressed recombinant proteins. Journal of Biological Chemistry. 270(16): p. 9459-9471.

9.   Johansson DX, K.T., Andersson O., 2012, Production of recombinant antibodies in Drosophila melanogaster S2 cells. Methods Mol Biol. 907: p. 359-70.

10. Jong Hwa Park, H.Y.K., Kyu Hyung Han, In Sik Chung, 1999, Optimization of transfection conditions for expression of green fluorescent protein in Drosophila melanogaster S2 cells. Enzyme and Microbial Technology 25 p. 558 -563.

11. Jordan M. and F. Wurm, 2004, Transfection of adherent and suspended cells by calcium phosphate. Methods 33 p. 136-143.

12. Jorge, S.A.C., A.S. Santos, A. Spina, and C.A. Pereira, 2008, Expression of the hepatitis B virus surface antigen in Drosophila S2 cells. Cytotechnology. 57(1): p. 51-59.

13. Kim, K.R., Y.K. Kim, and H.J. Cha, 2008, Recombinant baculovirus-based multiple protein expression platform for Drosophila S2 cell culture. Journal of Biotechnology. 133(1): p. 116-122.

14. Li, B., S. Tsing, A.H. Kosaka, B. Nguyen, E.G. Osen, C. Bach, H. Chan, and J. Barnett, 1996, Expression of human dopamine beta-hydroxylase in Drosophila Schneider 2 cells. Biochemical Journal. 313: p. 57-64.

15. Li, T., C.T. Yang, D.Y. Jin, and D.W. Stafford, 2000, Identification of a Drosophila vitamin K-dependent gamma-glutamyl carboxylase. Journal of Biological Chemistry. 275(24): p. 18291-18296.

16. Moraes AM, J.S., Astray RM, Suazo CA, Calderón Riquelme CE, Augusto EF, Tonso A, Pamboukian MM, Piccoli RA, Barral MF, Pereira CA., 2012, Drosophila melanogaster S2 cells for expression of heterologous genes: From gene cloning to bioprocess development. Biotechnol Adv. 30(3): p. 613-28.

17. Pfeifer, T.A., 1998, Expression of heterologous proteins in stable insect cell culture. Current Opinion in Biotechnology. 9(5): p. 518-521.

18. Valdez-Cruz, N.A., L. Caspeta, N.O. Perez, O.T. Ramirez, and M.A. Trujillo-Roldan, 2010, Production of recombinant proteins in E. coli by the heat inducible expression system based on the phage lambda pL and/or pR promoters. Microb Cell Fact. 9: p. 18.

19. Vatandoost, J., A. Zomorodipour, M. Sadeghizadeh, R. Aliyari, M.H. Bos, and F. Ataei, 2012, Expression of biologically active human clotting factor IX in Drosophila S2 cells: gamma-carboxylation of a human vitamin K-dependent protein by the insect enzyme. Biotechnol Prog. 28(1): p. 45-51.

20. www.Bio-Rad.com, Transfection Methods Overview.

21. Yin, J.C., G.X. Li, X.F. Ren, and G. Herrler, 2007, Select what you need: A comparative evaluation of the advantages and limitations of frequently used expression systems for foreign genes. Journal of Biotechnology. 127(3): p. 335-347.