نوع مقاله: مقاله پژوهشی

نویسندگان

دانشگاه مازندران

چکیده

هدف این تحقیق بررسی قدرت نشانگر کلروپلاستی trnL-F در تمایز ژنتیکی و ارتباط فیلوژنتیکی سپیدار (Populus alba) و سفیدپلت (Populus caspica) است. تعداد 15 نمونه برگی از هفت رویشگاه مختلف جنگل های هیرکانی ایران؛ استان های گیلان و مازندران، جمع آوری شدند. DNAی ژنومی از برگ ها با استفاده از روش ترکیبی CTAB و SDS- پتاسیم استات استخراج گردید. واکنش PCRی با استفاده از پرایمرهای جهانی انجام شد و قطعات trnL-F تکثیر شده توالی یابی گردید. نتایج نشان دادند که طول منطقه trnL-F تقریبا برای جمعیت های هر دو گونه در حدود 392-394 نوکلئوتید است. در مقایسه با توالی های موجود در بانک ژنی، تعداد نوکلئوتیدهای آدنین و تیمین در سفیدپلت و سپیدار بیش تر از دیگر نوکلئوتیدها است. ترکیب نوکلئوتیدی این دو گونه بسیار مشابه با حداقل فاصله ژنتیکی از یکدیگر (= 005/0) می باشد. آنالیز پارسیمونی از 582 جایگاه نوکلئوتیدی؛ 178 جایگاه محافظت شده، 197 جایگاه متغیر، 151 جایگاه پارسیمون و 46 جایگاه انحصاری را نشان داد. رسم درخت فیلوژنی براساس نشانگرtrnL-F نیز نشان داد که توالی این نشانگر نمی تواند تمایز بین پایه های دو گونه سپیدار و سفیدپلت ایجاد کند چراکه نمونه های بررسی شده در یک گروه مشترک قرار گرفتند. از نتایج این تحقیق می توان استنتاج نمود که نشانگر کلروپلاستی trnL-F نتوانست دو گونه سپیدار و سفیدپلت را از یکدیگر متمایز نماید. بنابراین برای شناخت دقیق این گونه ها، بازسازی فیلوژنی با استفاده از سایر نشانگرهای کلروپلاستی و یا هسته ای پیشنهاد می گردد.

کلیدواژه‌ها

عنوان مقاله [English]

The investigation of chloroplast marker trnL-F in determination of different between two species of Populus: Populus caspica and Populus alba

نویسندگان [English]

  • Abasalt Hosseinzadeh Colagar
  • Arman Mahmodi Otaghvari
  • Maryam Badbar

چکیده [English]

The purpose of this study is to evaluate of the choloroplast trnL-F marker’s power in genetic differentiation and phylogenetic relationships between Populus caspica and Populus alba. The 15 leaf samples collected from seven different growthing areas of hyrcanian forests, Iran; Guilan and Mazandaran provinces. Genomic DNA extracted from leaves using the CTAB and SDS-potassium acetatate combined method. PCR performed by universal primers and amplified trnL-F fragments sequenced. Results showed that, the entire length of the trnL-F region was 392-394 nucleotides in both species. In compaire to available sequences of the GenBank, Adenin and Thimine nucleotides in P. caspica and P. alba are more than other nucleotides. These two species have shown high similarity in nucleotide composition of trnL-F spacer region with minimum gegetic distance (=0.005). Parsimony analysis of 582 characters revealed 178 constant, 56 variable, 151 parsimony informative and 46 characters are unique positon. Too, bootstrap consensus trees showed that the trnL-F sequence data cannot distinguish P. caspica from P. alba because, investigated samples have located in common group. Therefore, for accurate recognition of this species, phylogenetic reconstruction using other choloroplastic and nuclear markers suggested.

کلیدواژه‌ها [English]

  • Populus caspica
  • Populus alba
  • trnL-F molecular marker

بررسی نشانگر کلروپلاستی trnL-F در تعیین تمایز دو گونه صنوبر: سفیدپلت و سپیدار

اباصلت حسین زاده کلاگر1،2*، آرمان محمودی اطاقوری3، مریم بادبر1،3

1 بابلسر، دانشگاه مازندران، دانشکده علوم پایه، گروه زیست شناسی سلولی و مولکولی

2 بابلسر، دانشگاه مازندران، دانشکده علوم پایه، گروه پژوهشی نانو و بیوتکنولوژی

3 بابلسر، دانشگاه مازندران، دانشکده علوم پایه، گروه زیست شناسی

تاریخ دریافت: 23/9/91               تاریخ پذیرش: 11/6/92 

چکیده

هدف این تحقیق بررسی قدرت نشانگر کلروپلاستی trnL-F در تمایز ژنتیکی و ارتباط فیلوژنتیکی سپیدار (Populus alba) و سفیدپلت (Populus caspica) است. تعداد 15 نمونه برگی از هفت رویشگاه مختلف جنگلهای هیرکانی ایران، استانهای گیلان و مازندران، جمع آوری شدند. DNAی ژنومی از برگها با استفاده از روش ترکیبی CTAB و SDS- پتاسیم استات استخراج گردید. واکنش PCR با استفاده از پرایمرهای جهانی انجام شد و قطعات trnL-F تکثیر شده توالی یابی گردید. نتایج نشان دادند که طول منطقه trnL-F تقریباً برای جمعیتهای هر دو گونه در حدود 392-394 نوکلئوتید است. در مقایسه با توالیهای موجود در بانک ژنی، تعداد نوکلئوتیدهای آدنین و تیمین در سفیدپلت و سپیدار بیشتر از دیگر نوکلئوتیدها است. ترکیب نوکلئوتیدی این دو گونه بسیار مشابه با حداقل فاصله ژنتیکی از یکدیگر (= 005/0) می باشد. آنالیز پارسیمونی از 582 جایگاه نوکلئوتیدی، 178 جایگاه محافظت شده، 197 جایگاه متغیر، 151 جایگاه پارسیمون و 46 جایگاه انحصاری را نشان داد. رسم درخت فیلوژنی براساس نشانگرtrnL-F  نیز نشان داد که توالی این نشانگر نمی تواند تمایز بین پایه های دو گونه سپیدار و سفیدپلت ایجاد کند چرا که نمونه های بررسی شده در یک گروه مشترک قرار گرفتند. از نتایج این تحقیق می توان استنتاج نمود که نشانگر کلروپلاستی  trnL-Fنتوانست دو گونه سپیدار و سفیدپلت را از یکدیگر متمایز نماید. بنابراین برای شناخت دقیق این گونه ها، بازسازی فیلوژنی با استفاده از سایر نشانگرهای کلروپلاستی و یا هسته ای پیشنهاد می گردد.

واژه­های کلیدی: سفیدپلت، سپیدار، نشانگر مولکولی trnL-F.

* نویسنده مسئول، تلفن: 01135302452، پست الکترونیکی: ahcolagar@umz.ac.ir

مقدمه 

 

خانواده بید (Salicaceae) از دو جنس صنوبر
(L. Populus) با 30 -40 گونه و بید (Salix L.) با 350-450 گونه تشکیل شده است (8). اهمیت صنوبرها به دلیل اینکه یک مدل مناسب و پیشگام و دارای پتانسیل بالا (ژنوم کوچک، توان بالای شکل پذیری، تولید مثل غیرجنسی، رشد سریع) جهت انجام تحقیقات زیستی برای درختان جنگلی هستند مورد توجه دانشمندان می باشند (24، 42 و 45). بدیهی است که به کارگیری صنوبرها در فعالیتهای اقتصادی و احیایی مستلزم شناخت گونه های موجود از این جنس در هر اکوسیستم طبیعی است. دورگه ای شدن فراوان و تنوع ریختی بالا سبب ایجاد اختلاف نظر در تشخیص صحیح گونه های جنس صنویر در دنیا شده است. برخی محققین 29 گونه از این جنس در شش بخش (Abaso, Aigeiros, Leucoides, Populus, Tacamahaca, Turanga) گزارش نمودند (18)، این در حالی است که برخی دیگر از محققین حدود 40 گونه از این جنس در دنیا گزارش نمودند (5، 8 و 12).

صنوبرها معمولاً درختانی نورپسند و نم پسند بوده که در زمینهای آبدوست حاشیه رودخانه ها و در مناطقی با خاک آبرفتی مرطوب رشد می کنند (5). صنوبرها به خوبی در نیمکره شمالی زمین (در جنوب، مرکز، شرق اروپا، آسیای میانه و شمال آفریقا) گسترده شده اند (8) و همچنین تعداد اندکی از آنها در نیمکره جنوبی زمین نیز پراکنده شده اند و تاکنون هیچ صنوبر بومی در افریقای مرکزی و جنوبی گزارش نشده است (21). سفید پلت (Populus caspica Bornm.) تنها گونه بومی از جنس صنوبر و بخشه Leuce (Populus) و زیر بخش Albidae است که در جنگلهای هیرکانی از حوالی آستارا تا گلیداغی در شمال ایران پراکنش دارد (1، 4 و 35). البته حضور سفید پلت در سایر مناطق ایران از جمله آذربایجان، کرمانشاه، فارس، کرمان و تهران نیز گزارش شده است (6). شباهت ریختی بالای سپیدار با سفید پلت محققان را در شناسایی و مجزا ساختن این دو گونه از یکدیگر مورد تردید قرار داده است (6 و 35). سپیدار (.Populus alba L) از جنس صنوبر و بخشه Leuce و زیر بخشه Albidae است که رویشگاه اصلی آن مناطق استپی و مرکزی ایران است (1، 6، 35 و 39). تفاوت سپیدار با سفیدپلت تنها در داشتن کرکهای نمدی (زیرین برگ) که به صورت یکنواخت خاکستری هستند، دمبرگ به طول کم و بیش 10 سانتیمتر، در درختان مسن غالباً در مقایسه با سفیدپلت کوچکتر، گل آذین کوتاهتر به طول 10-15 سانتیمتر، دمگل با کرکهای کوتاه ولی در بقیه موارد این گونه مشابه سفیدپلت می باشد (6 و 35). متداول بودن دورگه گیری بین گونه های مختلف جنس صنوبر (43)، سبب ایجاد شباهتهای ریختی بین گونه های نزدیک به هم شده و در نتیجه محققان را در شناسایی و طبقه بندی صحیح آنها دچار اشتباه می سازد. از طرفی مشخصه های ریختی برای تعیین تمایز درختان نیز می تواند تحت تأثیر عوامل محیطی باشد که تأثیر این عوامل باعث ایجاد اختلافات مورفولوژیک و فنولوژیک در اغلب گونه ها می گردد. بنابراین اختلاف مورفولوژیک صرفاً نمی تواند منشاء ژنتیکی داشته باشد (4) از این رو استفاده از روشهای مولکولی و یا بیوشیمیایی اگرچه با افزایش هزینه همراه است ولیکن با توجه به دقت بالا در تمایز گونه ها از یکدیگر، امروزه کاربرد فراوانی در تاکسونومی گیاهی دارد.

از سیستماتیک مولکولی به طور گسترده در شناسایی گونه های گیاهی به ویژه برای جنسهایی که دورگه گیری در بین گونه های مختلف آن رایج و شباهت ریختی زیاد است، به کار گرفته شده است برای مثال Keim و همکاران (1989) از مارکر مولکولی RFLP برای بررسی و آنالیز فرآیند دخول در یک منطقه هیبریدی موجود در بین صنوبرهای P. fremontii Watson وJames P. angustifolia. استفاده کردند (28) و همچنین بر روی این دو گونه صنوبر، Woolbright و همکاران (2008) به منظور تهیه یک نقشه ژنی جهت بررسیهای اکولوژیکی و مقایسه ژنوم آنها به عنوان یک مدل مناسب برای سایر درختان جنگلی مطالعاتی را بر اساس AFLP و SSR انجام دادند (45). Alba و همکاران (2000) به منظور بررسی تنوع ایزوزایم در P. alba از 18 لوکوس ایزوزایم بهره گرفتند (8) و همچنین تلاشهایDouhovinkoff  و Dodd (2003) به منظور تعیین هویت و تشخیص آستانه شباهت در کلونهای بید Salix exigua Nutt با استفاده از نشانگر مولکولی AFLP با موفقیت انجام شد (15). استفاده از DNA بارکدینگ یک مفهوم نسبتاً جدید با هدف دستیابی سریع و دقیق برای شناسایی گونه ها با به کارگیری منطقه استانداردی از DNA به عنوان یک علامت می باشد (35). جهت بررسی روابط فیلوژنی استفاده از تکنیک DNA بارکدینگ، روز به روز در حال افزایش است و چند سالی است که مورد توجه قرار گرفته است (23 و 33). همان طور که Chase و همکاران در سال 2005 اشاره کرده اند دو دسته از کاربران از DNA بارکدینگ بهره می برند که شامل تاکسونومیستها و دانشمندان در زمینه های دیگر (برای مثال علم پزشکی قانونی، بیوتکنولوژی، صنعت مواد غذایی و رژیم غذایی حیوانات) می باشند (11). در واقع در علم تاکسونومی استفاده ترکیبی از توالی یابی DNA و ویژگیهای ریختی، سرعت طبقه بندی و شناسایی گونه‌ها را در سطح جهانی افزایش داده است (9، 14، 20، 38 و 44). DNA کلروپلاستی به دلیل محافظت شدگی بالا، عدم تغییر نوترکیبی و جهش (37) و نیز میزان جانشینی اندک نوکلوتیدی (25)، از جمله نشانگرهایی است که برای جنسهای مختلف گیاهی به عنوان DNA بارکد مورد استفاده قرار گرفته است (17، 27، 32 و 34). از جمله توالیهای کلروپلاستی مورد استفاده گسترده در مطالعه های فیلوژنتیک، توالی فاصله انداز درون ژنی trnL-F و اینترون trnL است که در سطوح درون گونه ای و در سطح جنس برای گیاهان مطرح می گردد (10، 17،29، 31، 40 و 46). مناطق غیر کد کننده نسبت به مناطق کد کننده پروتئینها کمتر مورد توجه و اهمیت در انتخاب طبیعی هستند از این رو بیشتر برای مطالعه تاریخ تکاملی و بررسی روابط فیلوژنتیک مورد استفاده هستند (22). منطقه غیر کدکننده DNA کلروپلاستی trnL-F تمایل بیشتری به تکامل با تجمع حذف/ دخول و به همان اندازه تعویض نوکلئوتیدی نسبت به توالیهای کد کننده را دارا می باشند، چون ارزش مولکولی بالایی جهت بررسیهای فیلوژنتیک دارند از این رو از آنها می توان در مطالعات در سطح زیر خانواده استفاده کرد (19). از آنجایی که گزارشی مبنی بر بررسی سفیدپلت و سپیدار با استفاده از نشانگر فیلوژنتیکی trnL-F در دست نبوده، تحقیق حاضر در نظر دارد تا با توالی یابی قطعه درون ژنی trnL-F از این دو گونه نزدیک به هم، تمایزی را بین آنها مشخص سازد و توانایی این نشانگر را در حل این اختلاف مورد ارزیابی قرار دهد.

مواد و روشها

انتخاب رویشگاه: برای این تحقیق هفت رویشگاه طبیعی سفید پلت از مناطق پراکنش این گونه در جنگلهای هیرکانی ایران؛ استانهای مازندران وگیلان، انتخاب شدند (جدول 1). سپس از هر رویشگاه دو درخت به فاصله حداقل 100 متر از یکدیگر انتخاب و تعدادی برگ از هر درخت جمع آوری گردید.

استخراج DNA ژنومی و تکثیر قطعه ژنیtrnL-F: برای استخراج DNA ابتدا نمونه های برگی با استفاده از نیتروژن مایع پودر شدند. سپس استخراج DNA ژنومی از برگها، با استفاده از CTAB و SDS- پتاسیم استات که روشی ترکیبی ازDoyle and Doyle  (1987) و Dellaporta و همکاران (1983) است (13، 16، 26 و 47)، انجام شد. کیفیت DNA به دست آمده با استفاذه از الکتروفورز ژل آگارز 1 درصد بررسی شد و کمیت DNA نیز با استفاده از رابطه عمومی [dsDNA]ug/ml=OD260*P*50، که در این رابطه P رقت می باشد، محاسبه گردید (36). سپس قطعه ژنی trnL-F با استفاده از پرایمرهای جهانی (40 و 41) کلروپلاستی UEUFF با توالی 5/GGTTCAAGTCCCTCTATCCC به عنوان پرایمر مستقیم و پرایمر UEUFR با توالی 5/ATTTGAACTGGTGACACGAG به عنوان پرایمر معکوس با استفاده واکنش زنجیره ای پلیمراز (PCR) تکثیر شدند. فرآیند تکثیر DNA با حجم نهایی 50 میکرولیتر شامل 5/0 میکرولیتر از هر پرایمر، PCR بافر 1X، MgCl2 2mM ، از هر داکسی نوکلئوزید تری فسفات (dNTPs) 200 µM و 1 میکروگرم DNA ژنومی و در نهایت U 25/0 از Taq DNA polymerase انجام گردید.

برای این منظور از برنامه دمایی 94 درجه سانتی گراد به مدت 90 ثانیه، دمای 94 درجه سانتی گراد به مدت 45 ثانیه، دمای 57 درجه سانتی گراد به مدت 135 ثانیه، دمای 72 درجه سانتی گراد به مدت 1 دقیقه، در 32 تکرار و در دمای 72 درجه سانتی گراد به مدت 4 دقیقه در انتهای برنامه PCR استفاده شد.

استخراج توالی trnL-F و آنالیز آنها: قطعات تکثیری PCR بعد از الکتروفورز در ژل آگارز 1 درصد و حصول اطمینان از صحت انجام مراحل تکثیر، توسط شرکت MWG آلمان، تعیین توالی شدند. استخراج توالی از کروماتوگرامهای دریافتی از شرکت با استفاده از نرم افزار  Chromas ver. 2 صورت گرفت. پس از دریافت توالیها، با به کارگیری نرم افزار Blast در بانک ژنی، اختصاصی بودن قطعه مورد نظر به سپیدار و سفید پلت تأیید شد. توالی به دست آمده از منطقه trnL-F نمونه های سفیدپلت و سپیدار به همراه توالیهای همین منطقه در صنوبرهای موجود در بانک ژن و یک نمونه از توالی  trnL-Fبید به عنوان برون گروه (جدول 2) توسط برنامه آنلاین موجود در سایت NCBI (http://blast.ncbi.nlm.nih.gov/Blast) همردیف سازی شدند. در مطالعه بعدی توالی های بدست آمده به کمک برنامه Clustal W2 در نرم افزار Mega 5، با همردیف شدند، سپس بر اساس جایگاههای نوکلئوتیدی که دارای تغییر (جهش) بودند، میزان جهشهای Transation و Transversion در بین نمونه ها بر اساس بیشینه صرفه جویی (Maximum Parsimony) تعیین گردید، در مرحله بعد با استفاده از نرم افزار  Mega 5درختهای فیلوژنی با استفاده از روش بیشینه صرفه جویی ترسیم شد. البته قبل از رسم درخت فیلوژنی بهترین الگوی تکاملی انتخاب می شود. جهت اطمینان از صحت درختهای رسم شده از پشتوانه تکرار 1000 استفاده گردید.

 

جدول 1- محلهای جمع آوری گروههای مورد مطالعه سفیدپلت و سپیدار در مناطق شمال و غرب جنگلهای هیرکانی ایران

شماره هرباریمی*

تاکسون

کد

استان و محل جمع آوری

مختصات جغرافیایی

1536

P. caspica 

G1 

G2

مازندران- جویبار

N /28َ°36؛ / Eَ20°53

1537 

P. caspica

SD1

SD2

مازندران- ساری- چهاردانگه

N /21َ°36؛ / Eَ70°54

1539 

P. caspica

N1

NY3

مازندران- نور- پارک جنگلی

N /28َ°36؛ / E96ََ°52

1538 

P. caspica

CH1 

مازندران- چالوس

N /25َ°36؛ / E19ََ°51

1542 

P. caspica

RH1

RH2

گیلان- رودبار- حلیمه جان

 N/ 50ََ°36؛ / E َ27°49

1543 

P. caspica

RT1

RT2

گیلان- تالش- رضوانشهر

 N/ 28ََ°37؛ / E َ07°49

1540

P. caspica 

SC1

SC2

گیلان– آستانه اشرفیه- مرکز تحقیقات صنوبر کشور

N / 79ََ°37؛ / E َ27°49

1541 

P. alba

SA1

SA2

گیلان– آستانه اشرفیه- مرکز تحقیقات صنوبر کشور

N / 79ََ°37؛ / E َ27°49

*شماره هرباریمی دانشکده علوم پایه دانشگاه مازندران

جدول 2- نمونه های صنوبر ثبت شده در بانک ژن (NCBI)

تاکسون

کد

شماره ثبت نمونه های بانک ژن

Populus nigra

P.ni

GenBank, accession number: FJ490818 

Populus tremuloides 

P.tr

GenBank, accession number: AY757054 

Populus deltoides 

P.de

GenBank, accession number: AY757053 

Salix babylonica

S.ba

GenBank, accession number: AY757063 

 


نتایج

پس از استخراج DNA کلروپلاستی و تکثیر قطعه مورد نظر، محصول PCR از قطعه trnL-F (شکل 1) هر یک از نمونه ها توسط شرکت MWG تعیین توالی گردید. کروماتوگرامهای دریافتی با استفاده از نرم افزار Chromas ver 2 مشاهده شدند و توالی trnL-F، استخراج گردید (شکل2). نتایج نشان داد پرایمرها دو طرف محصول PCR را در برگرفته اند و آنالیز Blast توالی به دست آمده نیز نشان داد توالی محصول تکثیری همان توالی trnL-F است.

 

 

 

 

شکل 1- نمودار شماتیک از ناحیه trnL-F و محصولات PCR پرایمرهای آن از دو گونه سپیدار و سفیدپلت در ژل آگارز: فاصله بین ژنی trnL-F (trnL–F intergenic spacer) ژنوم پلاستیدی و موقعیت پرایمرهای مستقیم و معکوس (در بالا) و ستون1 محصول PCR قطعه trnL-F سپیدار؛ ستون2 نشانگرDNA؛ و ستون 3 محصولات PCR قطعه trnL-F سفید پلت در ژل آگارز 1 درصد.

 

 

شکل 2- کروماتوگرام توالی قطعه trnL-F 

 

 

نتایج همسان سازی توالی نمونه ها با همدیگر و با سایر نمونه های موجود در بانک ژن نشان داد تعداد نوکلئوتیدهای منطقه trnL-F تقریباً برای جمعیتهای هر دو گونه در حدود 392-394 نوکلئوتید است. ترادف متغییر هر یک از نمونه های مورد مطالعه که دارای تغییر نوکلئوتیدی نسبت به دیگری بودند در (جدول 3) آورده شد که حاکی از تفاوت سپیدار در 3 موقعیت نوکلئوتید های شماره 55 جانشینی (Transversion) (A→T)، در موقعیت نوکلئوتید 68 حذف (deletion) نوکلئوتید آدنین، و در نوکلئوتید 201 اضافه شدن (Insertion) نوکلئوتید آدنین مشاهده گردید. تعداد جایگاههای متغیر، تک متغیر، پارسیمون و محافظت شده برای توالی قطعه  trnL-Fبه ترتیب 197، 46، 151، 178 محاسبه گردید. الگوی جابه جایی نوکلئوتیدی در کل قطعه trnL-F و میزان جایگزینی همجنس (Transation) و ناهمجنس (Transversion) جهشها و میزان تغییرات (حذف و اضافه) به روش بیشینه صرفه جویی تخمین زده شد (جدول 4). ترکیب و درصد نوکلئوتیدهای تشکیل دهنده قطعه trnL-F برای هر یک از نمونه های مطالعه شده بر روی نمودار رسم شد که مشخص گردید از نظر تعداد نوکلئوتیدی سفیدپلت و سپیدار دارای آدنین بیشتر و تیمین کمتر در مقایسه با سایر صنوبرهای مورد مطالعه در این تحقیق بودند (شکل 3). این موضوع حاکی از ترکیب نوکلئوتیدی مشابه برای دو گونه سفیدپلت و سپیدار را در بر داشت.


 

 

 

شکل3- مقادیر نوکلئوتیدی نمونه های سفیدپلت و سپیدار و نمونه های بانک ژن

 

 

نتایج درخت فیلوژنی بر اساس کل قطعه trnL-F به روش بیشینه صرفه جویی (Straight consensus) نشان داد که گونه های جنس صنوبرتک نیاء می باشند و نمونه­های مورد بررسی از جنگلهای هیرکانی در یک کلاد تقسیم شده اند اما در کلاد اول، دو گروه شناسایی شده اند که شامل سه نمونه به ترتیب پایه  SC1از رویشگاه گیلان منطقه آستانه اشرفیه و پایه RH2 از رویشگاه گیلان منطقه رودبار و پایه SD2 از رویشگاه مازندران منطقه ساری بودند ولی سایر نمونه های بررسی شده از سفید پلت به همراه سپیدار در گروه اول قرار گرفته اند که حاکی از قرابت بیشتر این دو در مقایسه با سایر گونه ها مطالعه شده از این جنس در این تحقیق می باشند. (شکل 4). حداقل و حداکثر فاصله ژنتیکی بین نمونه ها به روش توزیع گاما محاسبه گردید (جدول 5).

 

 

 

جدول 4- تخمین الگوی جابه جایی نوکلئوتید در کل قطعه trnL-F (بیشینه صرفه جویی) 

G

C

T

A

نوکلئوتید

6

3

4

95

A

5

6

76

10

T

1

42

3

4

C

45

2

2

7

G

 

 

Overall

Pyrimidines

Purines

 

 

052/0

24/0

03/0

Transition/transversion rate

Transitionsal pairs/ Transversional pairs

Transversional pairs

Transitionsal pairs

Identical pairs

trnL-F

68/0

31

21

258

 

شکل4- بررسی روابط بین نمونه های مورد بررسی از جنس صنوبر بر اساس توالی trnL-F به روش درخت (Straight consensus) اعداد کنار شاخه ها نشان دهنده ارزش حمایتی شاخه ها بوده و به صورت درصد بیان شده است.


بحث

محققین از نشانگر مولکولی trnL-F برای مطالعه روابط فیلوژنتیکی در سطح بین گونه ای، در بین دسته های خاص و در سطح داخل گونه ای، استفاده می کنند (34). مناطق غیر کد کننده همچون اینترونها و فضاهای بین ژنی اغلب تنوع بیشتری را در جایگاه بازی نسبت به مناطق کد کننده DNA نشان می دهند که احتمالاً محدودیتهای عملکردی کمتری را منجر می شوند (34). جمع آوری و افزایش داده ها از توالیهای منطقه trnL-F اطلاعات زیادی از گیاهان را جهت مطالعه بیشتر ساختار، عملکرد و تکامل گیاهان گل دهنده فراهم می سازد (10). نتایج این تحقیق نیز براساس نشانگر مولکولی trnL-F با نتایج سایر محققین (9، 21 و 30) تک نیایی بودن سفیدپلت و سپیدار جمع آوری شده از جنگل هیرکانی را تأیید می نماید. در نتیجه رسم درخت فیلوژنی و با توجه به تعلق سپیدار به بخشه Populus و گونه دیگر از این بخشه با نام P. tremuloides و یک گونه از بخشه Aigeiros با نام P. nigra و از بخشه Tacamahaca گونه ای با نام P. deltoids که در این مطالعه مورد بررسی قرار گرفتند، مشخص گردید که، سفیدپلت براساس نشانگر کلروپلاستی trnL-F مطابق با سایر مطالعات محققین (3) به بخشه Populus تعلق دارد و قرابت ژنتیکی نزدیکی را با سپیدار جمع آوری شده در این تحقیق نشان می دهد. در این بین سه نمونه از بین نمونه های مورد بررسی (SC1، RH2، SD2) با قرار گرفتن در گروهی مجزا، دارای الگوی نوکلئوتیدی و فاصله ژنتیکی متفاوت تر با سپیدار و سفید پلت بودند و حالت پلی تومی در آنها دیده می شود. از آنجایی که در بین صنوبرها دو رگه گیری و پلی پلوئیدی بدلیل دو پایه بودن زیاد است به همین جهت پایه های بینابینی در بین گونه ها فراوان است. لذا بین دانشمندان در اینکه صنوبر یک درخت واریته ای از یک گونه است و یا خود گونه ای مجزایی است اختلاف نظر وجود دارد (2). بنابراین با اینکه P. alba و
P. tremuloides هر دو به بخشه  Populusتعلق دارند ولی در جایگاه جداگانه ای قرار گرفته اند در واقع وجود هیبریداسیون طبیعی در بین بخشه های Populus با سایر بخشه ها مثلاً P. alba و P. termula امکان پذیر می باشد (21). در بررسیهای انجام شده براساس RFLP بر روی cpDNA و rDNA نشان دادند که P. nigra در اثر دخول بین اجداد P. alba و برخی از اجداد والدینی ناشناخته از بخشه Populus ایجاد شد. بنابراین غیر منطقی نخواهد بود اگر فرض شود که مجال و فرصتی برای تبادل ژنی بین گونه های همجا (Sympatric) و یا حتی بین تاکسونهایی از بخشهای مختلف وجود داشته است (8 و 9) در نتیجه این احتمال که P. alba  یا P. caspica جمع آوری شده از مناطق هیرکانی تحت این شرایط باشند نیز وجود دارد.

نتایج حاصل از تحقیق فلاح و همکاران (1390) که به بررسی اکوتیپهای سفیدپلت براساس نشانگر مورفولوژیک برگ و ایزوآنزیمی پراکسیداز پرداخته بودند، نشان داد که تنوع درون جمعیتی سفیدپلت در جوامع بزرگ بیشتر از جوامع کوچک تر بوده که دلیل آن را به خاطر کاهش پدیده درون لقاحی و ایزوله شدن جمعیتها، وجود جریان ژنی متنوع و ازدیاد هتروزیگوتی مطرح ساختند. در مطالعه حاضر نیز حضور نمونه های SC1،RH2 ،SD2  که در کلادی جداگانه در بین جمعیتهای سفیدپلت قرار گرفته اند نیز بر صحت وجود تنوع درون جمعیتی در بین جوامع سفیدپلت اشاره دارد. در واقع سه عامل تنوع جغرافیایی و اقلیمی و تاریخ تکاملی گونه ها و ویژگیهای گونه از مهم ترین عوامل مؤثر در ایجاد تنوع و تمایز ژنتیکی هستند (4).

بررسی پتانسیل نشانگر trnL-F به عنوان یک منطقه غیر کد کننده کلروپلاستی برای تفکیک این دو گونه نزدیک به هم حاکی از این بود، که این نشانگر، قدرت تفکیکی کمی در مقابل سایر مناطق غیر کد کننده کلروپلاستی را دارا می باشد. علت انتخاب نشانگر trnL-F، این است که معمولاً قدرت تفکیکی کم این نشانگر در مقابل چندین فایده آن تا حدی جبران می شود. چرا که اولاً، این مناطق به شدت حفاظت شده (Conserve) بود (37 و 40). ثانیاً آغازگرهای جهانی این نشانگر در دسترس هستند و براحتی امکان سنتز آغازگرها و همچنین شرایط بهینه شده تکثیر این نشانگر در منابع موجود است. ثالثاً اطلاعات زیادی از توالیهای مناطق غیر کد کننده (trnL-F) در پایگاه داده ها در بانک ژن در دسترس می باشد که اجازه شناسایی بسیاری از گونه ها و جنسها را امکان پذیر می سازد.

وجود تنوع درون جمعیتی در جوامع سفیدپلت، دورگه گیری و امکان پراکنش گسترده بذر توسط باد و در نتیجه سطوح مختلف پلی پلوئیدی و همچنین شرایط اکولوژیک و جغرافیایی ناهمگون منطقه هیرکانی می تواند حاکی از اختلافات ژنتیکی زیاد این گونه نسبت به گونه هایی که امکان حرکت ژن در داخل جوامعشان وجود ندارد باشد (4). با توجه به این مسائل اکوتیپهای زیادی برای سفیدپلت پیش بینی می شد که با نتایج حاضر نیز سازگاری دارد. از آنجایی که تنوع زیستی یکی از شاخصهای خودتنظیمی محیط و کلید پایداری و سلامت محیط زیست طبیعی است و همگام با پیشرفت فنی و علمی در علوم زیست محیطی و آشکار شدن اهمیت تنوع زیستی، اهداف مدیریت کلان جنگل نیز به سمت افزایش تنوع زیستی گرایش یافته است (7)، از این رو به خاطر حضور اکوتیپهای متعدد و وجود تنوع ژنتیکی در بین رویشگاههای مختلف این گونه بومی مورد مطالعه هیرکانی، لزوم حفظ و مدیریت این ذخایر ژنتیکی مطرح می گردد، از طرفی استفاده از سایر نشانگرهای مولکولی و طراحی پرایمرهای اختصاصی برای استنباط فیلوژنتیکی این گونه و نقشه برداری کل ژنوم در چنین تحقیقاتی ضروری به نظر می رسد.

1- ثابتی، ح. 1387. جنگلها، درختان و درختچه های ایران. مرکز نشر دانشگاهی، یزد.

2- زرین بال ماسوله، الف. 1383. اصلاح ساختار صنوبر سفیدپلت از طریق تولید دو رگه های بین گونه ای با استفاده از روش نجات جنین. (پایانامه کارشناسی ارشد). دانشگاه تهران.

3- ضیایی ضیابری، س. ف. 1371. ذخایر ژنتیکی گونه های صنوبر در ایران و روش حفاظت ار آنها. فصلنامه پژوهش و سازندگی، 16 :31-28.

4- فلاح، ح. طبری، م. آزادفر، د. جلالی، غ. 1390. پراکنش و ویژگیهای اکولوژی گونه در حال انقراض سفیدپلت در جنگل های هیرکانی، فصلنامه علمی و پژوهشی اکوسیستم های طبیعی ایران، سال دوم، شماره اول.

5- قهرمان، الف. 1383. کورموفیت های ایران (سیستماتیک گیاهی). جلد 1، مرکز نشر دانشگاهی، تهران.

6- مظفریان، و. 1383. درختان و درختچه های ایران. مرکز نشر فرهنگ معاصر، تهران.

7- مجربی، م. مفتخر جویباری، م. کوچ، ی. جلیلوند، ح. 1390. مقایسه تراکم زادآوری و تنوع گونه های گیاهی در جنگل کاریهای صنوبر دلتویید (Acer velutinum Boiss. ) و پلت (Populus deltoides Marsh.) دلاکخیل مازندران، مجله زیست شناسی ایران جلد 24، 4: 614-621. 

 

8- Alba, N. and Agundez, D. 2000. Characterisation of populus alba L. by isozymes. Inv. Agr 92: 305- 315.

9- Azuma, T., Kajita, T., Yokoyama, J. and Ohashi, H. 2000. Phylogenetic relationships of Salix based on rbcL sequence data. American Journal of Botany 87: 67– 75.

10- Bakker, F. T., Culham, A., Gomez, M. R., Carvalho, J., Compton, J., Dawtrey, R. and Gibby, M. 2000. Patterns of nucleotide substitution in angiosperm cpDNA trnL (UAA) –trnF (GAA) regions. Molecular Biology and Evolution 17: 1146- 1155.

11- Chase, M. W., Salamin, N., Wilkinson, M., Dunwell, J. M., Kesanakurthi, R. P., Haidar, N. and Savolainen, V. 2005. Land plants and DNA barcodes: short-term and long-term goals. Biological Sciences 360 (1462):1889–1895.

12- Cullen, B. R. 2006. Viruses and microRNAs. Nat Genet 38: 25–30.

13- Dellaporta, S. L. Wood, J. and Hicks, J. B. 1983. A plant DNA minipreparation version II. Plant Molecular Biology Report. 1(4): 19- 21.

14- Desalle, R. 2006. Species discovery versus species identification in DNA barcoding efforts: response to Rubinoff. Conservation Biology 20 (5): 1545– 7.

15- Douhovnikoff, V. and Dodd, R. S. 2003. Intra-clonal variation and a similarity threshold for identification of clones: application to Salix exigua using AFLP molecular markers. Theor Appl Genet 106: 1307– 1315.

16- Doyle, J. J. and Doyle, J. L. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue Phytochem 19: 11- 15.

17- Drabkova, L., Kirschner, J., Vlcek, C. and Paces, V. 2004. TrnL–trnF Intergenic Spacer and trnL Intron Define Major Clades Within Luzula and Juncus (Juncaceae): Importance of Structural Mutations. Journal of Molecular Evolution 59: 1– 10.

18- Eckenwalder, J. E. 1996. Systematics and evolution of Populus. In Biology of Populus and its implications for management and conservation (ed. Stettler, R. F) 7–32. Ottawa, Ontario, Canada.

19- Gielly, L. and Taberlet, P. 1994. The Use of Chloroplast DNA to Resolve Plant Phylogenies: Noncoding versus rbcL Sequences. Molecular Biology Evolution 11(5):769-777.

20- Hajibabaei, M ., Singer, G. A. C., Hebert, P. D. N. and Hickey, D. A. 2007. DNA barcoding: how it complements taxonomy, molecular phylogenetics and population genetics. Trends in Genetics 23(4): 167- 172.

21- Hamzeh, M. and Dayanandan, S. 2004. Phylogeny of Populus (Salicaceae) based on nucleotide sequences of chloroplast trnT-trnF region and nuclear rDNA. American Journal of Botany 91: 1398- 1408.

22- Hao, D. C., Huang, B. L., Chen, S. L. and Mu, J. 2009. Evolution of the Chloroplast trnL-trnF Region in the Gymnosperm Lineages Taxaceae and Cephalotaxaceae Evolution of the Chloroplast trnL-trnF Region. Biochem Genet 47:351– 369.

23- Hebert, P. D. N., Ratnasingham, S. and deward, J. R. 2003. Barcoding animal life: cytochrome c oxidase subunit divergences among closely related species. Proc. R. Soc 270: 96– 99.

24- Hidalgo E. and Herguedas, D. A. L. 2009. Populus alba L. and P. x canescens (Ait.) Sm. In the Douro basin (Spain), identification, hybridization and clonality. MS.c. Thesis, University Valladolid, INIA.

25- Holt, H. S. D., Horova, L. and Bures, P. 2004. Indel patterns of the plastid DNA trnL–trnF region within the genus Poa (Poaceae). J Plant Res 117: 393– 407.

26- Hosseinzadeh Colagar, A., Saadati M., Zarea M. and Ahmadi Talei, S. 2010. Genetic variation of the Iranian Sclerotinia sclerotiorum isolates by standardizing DNA polymorphic fragments. Biotechnology (Pakistan) 9(1): 67- 72.

27- Johnson L. A., Chan L. M., Weese, T. W. L., Weese, L. D. and Mcmurry, S. 2008. Nuclear and cpDNA sequences combined provide strong inference of higher phylogenetic relationships in the phlox family (Polemoniaceae). Molecular Phylogenetics and Evolution. 48: 997–1012.

28- Keim, P., Shoemaker, R. C. and Palmer, R. G. 1989. Restriction fragment length polymorphism diversity in soybean. Theor Appl Genet 77: 786- 792.

29- Kojoma, M., Kurihara, K., Yamada, K., Sekita, S., Satake, M. and Iida, O. 2002. Genetic identification of cinnamon (Cinnamomum spp.) based on the trnL- trnF chloroplast DNA. Planta Medicine 68(1): 94– 96.

30- Leskinen, E. and Alstrom, C. 1999. Molecular phylogeny of Salicaceae and closely related Flacourtiaceae: evidence from 5.8S, ITS1 and ITS2 of the rDNA. Plant Systematics and Evolution 215: 209– 227.

31- Mes, T. H. M., Fritsch, R. M., Pollner, S. and Bachmann, K. 1999. Evoulation of the choloroplast genome and polymorphi ITS regions in Allium subg. Melanocrommyum. Genome. 42, 237- 247.

32- Pirie M. D., Vargas M. P. B. Z., Botermans, M., Bakker, F. T. and Chatrou, L.W. 2007. Ancient paralogy in the cpDNA trnL-F region in Annonaceae: implications for plant molecular systematics. American Journal of Botany 94(6): 1003– 1016.

33- Qing Ren, B., Guo xiang, X. and Duan chen, Z. 2010. Species identification of Alnus (Betulaceae) using nrDNA and cpDNA genetic markers. Molecular Ecology Resources 10: 594– 605.

34- Randal, L., Small, a., Edgar, B., Lickey, A., Shaw, J. A., Warren, D. and Hauk, A. 2005. Amplification of noncoding chloroplast DNA for phylogenetic studies in lycophytes and monilophytes with a comparative example of relative. Molecular Phylogenetics and Evolution 36: 509– 522.

35- Rechinger, K. H. 1969. Flora Iranica. Salicaceae. Graz: Akademische Druck – u Verlagsanstatlt, Wien: Naturhistorisches Museum . pp 1-12.

36- Sambrook, J. and Russell, D. W. 2001. Molecular cloning: A laboratory manual, 3nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.

37- Shaw, J., Lickey, E., Beck, J., Farmer, S., Liu, W., Miller, J., Siripun, K., Winder, C., Schilling, E. and Small, R. 2005. The tortoise and the hare II: relative utility of 21 noncoding chloroplast DNA sequences for phylogenetic analysis. American Journal of Botany 92: 142- 166.

38- Smith, M. A . and Green, D.M. 2005. Dispersal and the metapopulation paradigm in amphibian ecology and conservation: are all amphibian populations metapopulations? Ecography 28: 110– 128.

39- Stettler, E. R. F., Bradshaw, H. D., Heilman, P. E. and Hinckley, T. M. 1996. Biology of Populus and its Implications for Management and Conservation. NRC Research Press, Ottawa, pp 515– 539.

40- Taberlet, P., Coissac, E., Pompanon, F., Gielly, L. and Miquel, C. 2007. Power and limitations of the chloroplast trnL (UAA) intron for plant DNA barcoding. Nucleic Acids Research 35 (3): 3-14.

41- Taberlet, P., Gielly, L., Pautou, G. and Bouvet, J. 1991. Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Molecular Biology 17: 1105– 1109.

42- Tuskan, G. A., Wullschleger, S. D., Bradshaw, H. D. and Dahlman, R. C. 2002. sequencing the Populus genum: Application to the energy related mission of DOE. Plant, Animal and Microbial Genomes, San Diego, CA, 40 p.

43- Whitham, T. G., Floate, K. D., Martinsen, G. D., Driebe, E. M. and Keim, P. 1996. Ecological and evolutionary implications of hybridization: Populus–herbivore interactions. NRC Research Press, Ottawa, Canada.

44- Will, K. W., Mishler, B. and Wheeler, Q. D. 2005. The perils of DNA barcoding and the need for integrative taxonomy. Syst. Biol 54: 844– 851.

45- Woolbright, S. A., DiFazio, S. P., Yin, T., Martinsen, G. D., Zhang, X., Allan, G. J., Whitham, T. G. and Keim, P. 2008. A dense linkage map of hybrid cottonwood (Populus fremontii-P. angustifolia) contributes to long-term ecological research and comparison mapping in a model forest tree. Heredity 100: 59– 70.

46- Yi, T., Miller, A. J. and Wen, J. 2004. Phylogenetic and biogeographic diversification of Rhus (Anacardiaceae) in the Northern Hemisphere. Moleculare Phylogenetic and Evolution 33: 861- 879.

47- Yosefzadeh, H., Hosseinzadeh Colagar, A., Tabari M., Sattarian A. and Assadi, M. 2012. Utility of ITS region sequence and structure for molecular identification of Tilia species from Hyrcanian forests. Iran Plant Systematics and Evolution 298(5): 947- 941.