نوع مقاله: مقاله پژوهشی

نویسندگان

1 مربی هیات علمی انستیتو پاستور

2 تبریز، دانشگاه علوم پزشکی، دانشکده فناوریهای نوین، گروه زیست فناوری پزشکی

3 بندر جاسک، دانشگاه آزاد اسلامی، واحد بندر جاسک، گروه زیست شناسی

چکیده

فلاو آنزیم پرولین دهیدروژناز (EC 1.5.99.8) نقش مهمی را در زیست حسگرها و کیتهای غربالگری به منظور تشخیص بیماریهای متابولیک مرتبط با نقص پرولین ایفاء می نماید. هدف از این تحقیق، جداسازی و تعیین مشخصات میکروارگانیسم های تولید کننده آنزیمهای دخیل در متابولیسم پرولین از نمونه های خاک ایران بود. غربالگری آنزیم های تخریب کننده L-پرولین از نمونه های خاک در سه مرحله شامل تکنیک کشت غنی، کروماتوگرافی لایه نازک و سنجش فعالیت آنزیمی، انجام شد. میکروارگانیسم جداسازی شده توسط واکنشهای بیوشیمیایی، آنالیز ژنهای RNA ریبوزومی s16، 16S-23S rRNA Internal Transcribed Spacer (ITS) و رسم درخت فیلوژنتیکی تعیین مشخصات گردید. مطالعات کینتیکی بر روی آنزیم شناسایی شده انجام شد و ساختار سه بعدی آن توسط روشهای بیوانفورماتیکی، شبیه سازی گردید. در بین 150 میکروارگانیسم جداسازی شده از 30 نمونه خاک، تنها یک سویه باکتری، فعالیت قابل ملاحظه ای نسبت به اسید آمینه L-پرولین (U/ml10) از خود نشان داد. پارامترهای ثابت میکائیلیس-منتن و سرعت ماگزیمم به ترتیب 12/0 میلی مولار و 11/0 میلی مولار بر دقیقه محاسبه شدند. سویه باکتری با استفاده از آنالیز فیلوژنتیکی ژنهای RNA ریبوزومی s16 و ITS به عنوان Biotype جدیدی از سودوموناس پوتیدا شناسایی شد. ساختاز سه بعدی شبیه سازی شده از آنزیم مذکور نیز قرار داشتن پرولین دهیدروژناز جداسازی شده در آنزیمهای خانواده سودوموناس پوتیداها را تایید نمود. این تحقیق اولین گزارش از تولید پرولین دهیدروژناز توسط باکتری سودوموناس پوتیدا جداسازی شده از نمونه خاک می باشد.

کلیدواژه‌ها

عنوان مقاله [English]

Phylogenic Study of Proline Dehydrogenase Producing Pseudomonas putida Bacterium and Bioinformatics Analysis of Isolated Enzyme

نویسندگان [English]

  • hamid shahbaz mohammadi 1
  • Rahman Mahdizadeh 3

چکیده [English]

Proline dehydrogenase falvoenzyme (ProDH; EC 1.5.99.8) plays an important role in the biosensors and diagnostic kits for the diagnosis of proline related metabolic disorders. The purpose of this research was to isolate and characterize proline metabolizing enzymes producing microorganisms from Iranian soil samples. Isolation and screening of L-proline degradative enzymes from soil samples was carried out in three steps employing enrichment culture technique, thin layer chromatography (TLC) and enzyme activity assay. The isolate was characterized by biochemical reactions, 16S rRNA gene analysis and 16S-23S rRNA Internal Transcribed Spacer (ITS) sequencing. Kinetic studies were performed and 3-D structure of the enzyme of interest was predicted through bioinformatics methods. Among the 150 soil isolates recovered from 30 samples, only one strain displayed the highest enzyme activity toward L-proline (10 U/ml) than others. The Km and Vmax values were calculated as 0.12 mM and 0.11 mM/min. The strain was characterized as a new biotype of Pseudomonas putida using phylogenetic analysis of 16s rRNA and 16S-23S rRNA ITS. The predicted 3-D structure of target enzyme also confirmed the similarity of isolated ProDH to the family of P. putida enzymes. This is the first report concerning the ProDH production by a P. putida bacterium isolated from soil sample.

کلیدواژه‌ها [English]

  • Proline dehydrogenase (ProDH)
  • Pseudomonas putida
  • Phylogentic Analysis
  • Screening

مطالعه فیلوژنتیکی باکتری سودوموناس پوتیدا تولید کننده پرولین دهیدروژناز و آنالیز بیوانفورماتیکی آنزیم جداسازی شده

انور سادات کیان مهر1 و رحمان مهدی زاده دهوسطی2*

1 تبریز، دانشگاه علوم پزشکی تبریز، دانشکده علوم نوین پزشکی تبریز، گروه زیست فناوری پزشکی

2 بندرجاسک، دانشگاه آزاد اسلامی، واحد بندر جاسک، بخش زیست­شناسی دریا

تاریخ دریافت: 25/4/90               تاریخ پذیرش: 18/7/91 

چکیده

فلاوآنزیم پرولین دهیدروژناز (EC 1.5.99.8) نقش مهمی را در زیست حسگرها و کیتهای غربالگری به منظور تشخیص بیماریهای متابولیک مرتبط با نقص پرولین ایفاء می­نماید. هدف از این تحقیق، جداسازی و تعیین مشخصات میکروارگانیسم های تولید کننده آنزیمهای دخیل در متابولیسم پرولین از نمونه­های خاک ایران بود. غربالگری آنزیمهای تخریب کننده L-پرولین از نمونه­های خاک در سه مرحله شامل تکنیک کشت غنی، کروماتوگرافی لایه نازک و سنجش فعالیت آنزیمی انجام شد. میکروارگانیسم جداسازی شده توسط واکنشهای بیوشیمیایی، آنالیز ژنهای RNA ریبوزومی s16، 16S-23S rRNA Internal Transcribed Spacer (ITS) و رسم درخت فیلوژنتیکی تعیین مشخصات گردید. مطالعات کینتیکی بر روی آنزیم شناسایی شده انجام شد و ساختار سه بعدی آن توسط روشهای بیوانفورماتیکی شبیه­سازی گردید. در بین 150 میکروارگانیسم جداسازی شده از 30 نمونه خاک، تنها یک سویه باکتری، فعالیت قابل ملاحظه­ای نسبت به اسیدآمینه L-پرولین (U/ml10) از خود نشان داد. پارامترهای ثابت میکائیلیس-منتن و سرعت ماگزیمم به ترتیب 12/0 میلی مولار و 11/0 میلی مولار بر دقیقه محاسبه شدند. سویه باکتری با استفاده از آنالیز فیلوژنتیکی ژنهای RNA ریبوزومی s16 و ITS به عنوان بیوتایپ جدیدی از سودوموناس پوتیدا شناسایی شد. ساختاز سه بعدی شبیه­سازی شده از آنزیم مذکور نیز قرار داشتن پرولین دهیدروژناز جداسازی شده در آنزیمهای خانواده سودوموناس پوتیداها را تأیید نمود. این تحقیق، اولین گزارش از تولید پرولین دهیدروژناز توسط باکتری سودوموناس پوتیدا جداسازی شده از نمونه خاک می­باشد.

واژه­های کلیدی: آنالیز فیلوژنتیکی، غربالگری، پرولین دهیدروژناز، سودوموناس پوتیدا

* نویسنده مسئول، تلفن: 09177612925، پست الکترونیکی: Rahman.biochem@gmail.com 

مقدمه

 

میکروارگانیسم ها مهمترین و ایده آل ترین منبع تولید کننده آنزیمهای مختلف با دامنه کاربردهای گسترده به شمار می­آیند. از مزایای آنزیمهای میکروارگانیسم ها می توان به امکان کنترل فیزیولوژیکی و فیزیکو شیمیایی، تنوع آنزیمی و مقادیر بالای تولید اشاره نمود (1). در این راستا، جداسازی و غربالگری آنزیمهای جدید با خصوصیات موثر و بهینه از میکروارگانیسمهای ساکن طبیعت به عنوان اولین مرحله در مسیر تحقیق و توسعه محصولات آنزیمی محسوب می­شود (2). گروه مهمی از آنزیمها که مطالعات غربالگری گسترده­ای بر روی آنها انجام شده است، کاتالیزور زیستی پرولین دهیدروژناز می باشد (13 و 14). این آنزیم که نقش مهمی در مسیر متابولیسم پرولین به گلوتامات ایفاء می­نماید از منابع مختلف باکتریایی، گیاهی و حیوانی گزارش شده است (5). در اولین مرحله از این مسیرمتابولیکی، پرولین دهیدروژناز در حضور کوفاکتور FAD پرولین را به ترکیب حدواسط ∆-پیرولین-5-کربوکسیلات تبدیل می­نماید. FADH2 تولید شده نیز الکترونهای خود را به پذیرنده های زنجیره انتقال الکترون منتقل می­کند. در دومین مرحله، ∆-پیرولین-5-کربوکسیلات در یک واکنش غیر آنزیمی به گلوتامات-γ-سمی آلدئید هیدرولیز شده و سپس توسط آنزیم ∆-پیرولین-5-کربوکسیلات دهیدروژناز و در حضور کوآنزیم NAD+ به گلوتامات تبدیل می­شود (14). در تمام یوکاریوتها و برخی از باکتریها نظیر ترموس ترموفیلوس (thermus thermophilus) ، دو دومن این فلاوآنزیم توسط دو ژن جداگانه کد می­شوند (6). نقص ژنتیکی در مسیر متابولیکی پرولین به گلوتامات باعث بروز بیماری هایپرپرولینمیا در انسان می­شود (7). هرچند که شواهدی نیز در خصوص ارتباط بین نقص مسیر متابولیسم پرولین و بروز بیماری اسکیزوفرنی و همچنین نقش آنزیم پرولین دهیدروژناز در مهار سرطان کشف شده است (8). هدف از این تحقیق، جداسازی و شناسایی باکتریهای تولید کننده پرولین دهیدروژناز با خصوصیات کینتیکی مناسب بود. برای این منظور نمونه های مختلفی از شهر تهران جمع آوری شده و مطالعات غربالگری گسترده­ای بر روی آنها صورت گرفت. بدیهی است که این آنزیمهای باکتریایی می­توانند مدلهای مناسبی برای انجام مطالعات ساختاری و درک آنزیمهای همتای آنها در انسان باشند. این مطالعه، اولین گزارش از جداسازی سودوموناس پوتیدا (Pseudomonas putida ) تولید کننده پرولین دهیدروژناز می باشد.

مواد و روشها

مواد: L-پرولین و پلیتهای TLC سیلیکاژل 20 ´20cm از شرکت Merck آلمان تهیه شدند. INT (2-(p-iodophenyl)-3-(p-nitrophenyl)-5-phenyltetrazolium chloride)، Phenazine methosulfate (PMS) و NAD+ از شرکت Sigma-Aldrich خریداری گردیدند.

جمع آوری نمونه­های خاک: نمونه­های خاک از مناطق مختلف شهر تهران در درکه، دربند و فرحزاد در طی فصول پاییز و زمستان سال 1386 جمع آوری شدند. نمونه­ها در کیسه های فریزر استریل قرارداده شده و تا زمان آزمایش در 4 درجه سانتی گراد نگهداری شدند.  

غربالگری آنزیمهای تخریب کننده L-پرولین:‌ روشهای اصلی غربالگری برای تولید کنندگان آنزیم­های متابولیزه کننده پرولین، به شرح زیر بودند:

تکنیک کشت غنی: غربالگری اولیه باکتریهای تولید کننده آنزیمهای دخیل در متابولیسم پرولین توسط تکنیک کشت غنی در محیط کشت حاوی پرولین به عنوان تنها منبع کربن و نیتروژن، انجام شد. یک گرم از هر نمونه خاک به 5 میلی لیتر محیط انتخابی PYP که حاوی 5 درصد (w/v) L-پرولین، یک گرم در لیتر کلرید سدیم، دو گرم در لیتر دی پتاسیم هیدروژن فسفات، نیم گرم در لیتر سولفات منیزیم، ، 5/0 گرم در لیتر عصاره مخمر و 5 گرم در لیتر پلی پپتون با 0/7 =pH بود اضافه شد و به مدت 48 ساعت در دمای 37 درجه سانتی گراد و دور rpm140  انکوبه گردید. از هر نمونه تا 4-10 سریال رقت تهیه شده و پس از کشت در پلیتهای آگار در دمای 37 درجه سانتی گراد و به مدت 24 ساعت انکوبه شدند. تک کلنیهای رشد کرده براساس خصوصیات مورفولوژیکی متمایز گردیده و سپس هر کلنی به یک محیط آگار جدید انتقال داده شد (2).

کروماتوگرافی لایه نازک: در غربالگری ثانویه، توانایی تخریب L-پرولین در میکروارگانیسمهای جداسازی شده توسط روش کروماتوگرافی لایه نازک، بررسی شد. به مقدار دو ماکرولیتر از هر یک از محیطهای کشت میکروارگانیسمهای رشد کرده بر روی پلیتهای سیلیکاژل کروماتوگرافی لایه نازک قرار داده شد و تخریب پرولین توسط قراردادن پلیت در حلال فاز متحرک تشکیل شده از آب واتانول، بررسی و شناسایی گردید. پلیتها پس از خشک شدن برروی Hot plate در محلول نین هیدرین 2 درصد قرار داده شدند. ظهور لکه صورتی بر روی پلیت به منزله عدم تخریب پرولین و ترشح نشدن آنزیم پرولین دهیدروژناز در سویه­ها بود که به عنوان نتیجه منفی در غربالگری تلقی می­شد. میکروارگانیسمهایی که لکه های صورتی رنگ بر روی پلیتها تشکیل ندادند به منزله نتیجه مثبت در غربالگری محسوب شده و جهت انجام آزمایشات بعدی انتخاب گردیدند (9).

کشت باکتری و تولید آنزیم: تولید آنزیم در محیط مشابه استفاده شده برای غربالگری انجام شد با این تفاوت که در آن آگار اضافه نشد. سویه­های انتخاب شده در محیط تولید تلقیح شده و در دمای 37 درجه سانتی گراد و دور rpm150 به مدت 18 ساعت در انکباتور شیکردار (Kühner shaker Switzerland ISF-1-W) انکوبه شدند. سلولهای رشد کرده در اواخر فاز لگاریتمی در g 5000 و دمای 4 درجه سانتی­گراد به مدت 30 دقیقه سانتریفیوژ شدند و بعد از خارج کردن محلول روئی، رسوب حاصل دو مرتبه با محلول سوم فیزیولوژیکی، شستشو داده شد. سلولهای شستشو داده شده پس از حل شدن در  50 میلی لیتر از بافر 100 میلی مولار (0/8 =pH) Tris-Hcl توسط سونیکاتور  و به مدت 20 دقیقه در دمای 4 درجه سانتی­گراد لیز شدند. سپس سلولها و مواد نامحلول توسط سانتریفیوژ جدا شده و از محلول رویی در ادامه آزمایشات استفاده گردید.

سنجش فعالیت آنزیمی: فعالیت آنزیمی پرولین دهیـدروژنـاز با احیاء INT در حضور L-پرولین در طول موج 490 نانومتر توسط اسپکتروفتومتر Shimadzu uv-visible-1601PC-spectrophotometer, Japan)) مورد سنجش قرار گرفت. مخلوط واکنش با حجم 1 میلی لیتر شامل محلول 200 میلی مولار پرولین، 5/0 میلی مولار INT، 2/0 میلی مولار PMS، بافر 200 میلی مولار (5/7=pH) Tris-HCl، 2/0 میلی مولار FAD و محلول آنزیم بود. در شاهد، سوبسترای اسید آمینه به وسیله آب جایگزین گردید. 

شناسایی سوش جدا شده: شناسایی باکتری توسط مشخصات مورفولوژیکی، روشهای بیوشیمیایی و تکثیر اختصاصی PCR انجام شد (10و11).

مشخصات مورفولوژیکی: بررسی خصــوصیات مورفــولوژی کلونی باکتـریها به وسیلـه کشت آنها در سه محیـط Nutrient agar, Blood agar  و MacConkey agar(MAC) انجام شد (11).

روشهای بیوشیمیایی: مهم ترین تستهای بیوشیمیایی به شرح زیر بودند:Triple Sugar Iron Agar (TSIA)، مصرف سیترات، متیل قرمز، Voges –Proskauer test (VP)، تست حرکت، هیدرولیز اوره، تولید ایندول، اکسیداز، کاتالاز، تولید سولفید هیدروژن و تولید پلی ساکارید لوان که به این منظور سوش مورد نظر در محیط PYP حاوی 5/1 درصد آگار و 10 درصد ساکاروز کشت داده شد. تشکیل کلونیهای بزرگ و موکوئیدی نشان دهنده سودوموناس فلورسانس بودن و عدم تشکیل این کلونیها از ویژیگی سودوموناس پوتیدا بود (10و11).  

تخلیص DNA ژنومی برای واکنش PCR:  DNA ژنومی باکتری با استفاده از روش Dr. R.H. Doi استخراج گردید و صحت خلوص با استفاده از الکتروفورز برروی ژل آگاروز 7/0درصد تأیید گردید (12).

کلونینگ و توالی یابی ژن RNA ریبوزومی s16: ژن  RNA  ریبوزومی s16 توسط پرایمرهای اختصاصی  S-F (5´-AGAGTTTGATCCTGGCTCAG-3´)16 و S-R (5´-CTACGGCTACCTTGTTACGA-3´)16 تکثیر شد (13). تکثیر PCR در حجم 25 ماکرولیتر  حاوی 20 پیکومول از هر پرایمر، بافر PCR1x، 2/0 میلی مولار از هر dNTP، کلریدمنیزیم 5/1 میلی مولار، 3/0 میلی گرم DNA الگو و 5/2 واحد از DNA Taq پلی مراز  در دستگاه ترمو سایکلر ( (Thermal Cycler, Eppendorf, Germanyانجام شد. محصول PCR به دست آمده در ژل آگاروز 5/1 درصد افقی آنالیز شده و پس از برش از روی ژل تخلیص گردید. rDNA ریبوزومیs 16 تکثیر شده در وکتور pJETl.2 کلون شد و به داخل اشریشیا کلی (Escherichia coli JM107 ) ترانسفورم گردید. حامل پلاسمیدی توسط پروتکل استخراج پلاسمید از کلونیهای مثبت، جدا شد. توالی یابی توسط شرکت ماکروژن (سئول کره) با پرایمرهای توالی یابی مناسب انجام شد. توالی ژن rDNA  ریبوزومی s16 سویه با توالیهای مرجع rDNA  ریبوزومی s16 با استفاده از برنامه BLAST در NCBI روی هم اندازی شد. روی هم اندازی چندگانه توالیها و محاسبات میزان شباهت توالی توسط برنامه Clustalw انجام گرفت.

تکثیر PCR و توالی‌یابی 16S-23S rRNA Internal Transcribed Spacer (ITS): ناحیه ITS توسط پرایمرهای ITS-F (5´-CTTGTACACACCGCCCGTCA-3´) و TCCGGGTACTTAGATGTTTC-3) ITS-R (5´- تکثیر شد (14). مخلوطهای واکنش همچنان که در بالا شرح داده شد تهیه شدند. محصول PCR از روی ژل آگاروز خالص شد و در حامل PJET 1.2 کلون گردید. پلاسمید نوترکیب حاوی ژن ITS توسط پرایمرهای توالی‌یابی مناسب در شرکت ماکروژن توالی‌یابی شد و جستجوی شباهت DNA توسط پایگاه NCBI با استفاده از خدمات شبکه BLAST انجام شد.

آنالیز فیلوژنتیکی ژنهای  RNA ریبوزومی s 16 و ITS: توالیهای مرجع استفاده شده برای آنالیز فیلوژنتیکی از بانک ژن به دست آمدند. ژنهای ITS وRNA  ریبوزومی s 16 سویه جدا شده و سویه‌های مرتبط از گونه‌های سودوموناس با استفاده از نرم‌افزار MEGA روی هم‌اندازی شدند. درختهای فیلوژنتیکی توسط روش Neighbor joining با استفاده از نرم‌افزار MEGA رسم شد (15) و تست BootStarp به منظور تایید صحت و اعتبار درختهای به دست آمده 1000 برابر تکرار گردید.

شماره دسترسی به توالی نوکلئوتیدی: توالیهای کامل ژنهای s 16 و ITS سوش جدا شده تحت شماره‌های دسترسی GU208206 برای 16S rDNA و Gu289189 برای ITS در بانک ژن ثبت شدند.

تعیین پارامترهای کینتیکی:  مطالعات کینتیک حالت پایا به منظور محاسبه پارامترهای ثابت میکائیلیس-منتن (Km ) و سرعت ماکزیمم (Vmax ) ، انجام شد. جهت تعیین پارامترهای کینتیکی از نمودار معکوس دو طرفه که معادله لینویور- برک نامیده می­شود، استفاده شد. برای این منظور فعالیت آنزیمی درحضور غلظتهای مختلف سوبسترا مورد سنجش قرار گرفت و نمودار به صورت عکس تغییرات غلظت سوبسترا در مقابل عکس سرعت فعالیت آنزیمی تهیه شد (2).

جداسازی ژن کد کننده پرولین دهیدروژناز و شبیه سازی ساختار سه بعدی آنزیم: ژن پرولین دهیدروژناز توسط پرایمرهای POS-F (5´-TATCATATGCTGACCTCCTCGCTCACC-3´) و AGGATCCAATCGGCGATGCGG -3) POS-R (5´- تکثیر شد. مخلوطهای واکنش همچنانکه در بالا شرح داده شد تهیه شدند. محصول PCR از روی ژل آگاروز خالص شد و در حامل pET23a کلون گردید. پلاسمید نوترکیب حاوی ژن آنزیم توالی‌یابی شد و جستجوی شباهت DNA توسط پایگاه NCBI با استفاده از خدمات شبکه BIAST انجام گرفت. با استفاده از توالی نوکلئوتیدی به دست آمده، توالی پروتئینی آنزیم توسط برنامه DNASIS MAX software  (DNASIS version 2.9, Hitachi Software Engineering Co., Ltd., Japan). پیش بینی گردید و با استفاده از توالی پروتئینی، ساختار سه بعدی توسط برنامه Modeler version 9v9  شبیه سازی شد.

 

 

جدول 1- خصوصیات فنوتیپی و  بیو شیمیایی سویه باکتری جدا شده.

 

 نتایج

 

نتایج

 

خصوصیات

 

 

میله ای

شکل

صاف، گرد، برآمده، براق با قطر 1-2 میلی متر  

مورفولوژی کلنی

 

 

 

 

+ 

Blood agar   رشد بر روی محیط  

 

+ 

رشد بر روی  محیط مکانکی 

+ 

    رشد در دمای 37 درجه سانتی گراد

 

-

    رشد در دمای 41 درجه سانتی گراد

 

- 

رنگ آمیزی گرم 

محلول آبکی و غیر موکوئیدی

تست هیدروکسید پتاسیم 3 درصد

قهوه‌ای مایل به قرمز

تولید رنگدانه

آلکالن/ آلکالن 

Triple Sugar Iron Agar (TSIA) 

+ 

مصرف سیترات 

_ 

قرمز متیل         

+ 

Voges-Proskauer (VP)     

+ 

حرکت  

_ 

تولید ایندول  

_ 

هیدولیز اوره  

+ 

اکسیداز

+ 

  کاتالاز   

_ 

تولید گاز سولفید هیدروژن

 

+

آرژینین دهیدرولاز

_

لسیتیناز (واکنش زرده تخم مرغ)

+

احیاء نیترات

_ 

هیدرولیز ژلاتین

_

Levan  تولید پلی ساکارید

_ 

لیزین دکربوکسیلاز

_ 

اورنیتین دکربوکسیلاز

_ 

تریپتوفان دآمیناز

_ 

مصرف کربوهیدراتهای مانیتول، اینوزیتول، سوربیتول،ساکاروز، آمیگدال

+ 

مصرف کربوهیدراتهای گلوکز، ملیبیوز، آرابینوز 

 

 


نتایج و بحث

آمینواسید L-پرولین توسط آنزیمهای پرولین دهیدروژناز و دلتا پیرولین دهیدروژناز به گلوتامات تبدیل می‌شود. آنزیمهای باکتریایی شرکت‌کننده در متابولیسم پرولین، الگوهای مستعد جالب توجهی برای مطالعه ساختار و عملکرد هومولوگهای انسانی و همچنین اندازه­گیری اختصاصی پرولین پلاسما در کیتهای تشخیصی و زیست حسگرها می‌باشند (16).

با در نظر گرفتن کاربردهای پزشکی آنزیمهای کاتابولیزکننده پرولین در تشخیص نقایص مادرزادی متابولیسم پرولین باعث شد تا در این مطالعه تصمیم به جداسازی این کاتالیزورهای زیستی از میکروارگانیسم‌های ساکن خاک گردد. در جریان غربالگری اولیه در محیط حاوی L-پرولین به عنوان تنها منبع کربن و نیتروژن، 150 سویه جدا شدند. توانایی هر سوش جدا شده در تخریب L-پرولین نیز مورد آزمایش قرار گرفت. 20 تا از میکروارگانیسم‌های جدا شده که قادر به تخریب پرولین بودند توسط کروماتوگرافی لایه نازک تعیین شدند. ظاهر شدن لکه برروی ورقه کروماتوگرافی لایه نازک به عنوان عدم تخریب پرولین در نظر گرفته شد. به منظور تایید این انتخابها، سوشهای باکتریایی که قادر به استفاده از L-پرولین بودند در محیط تولید کشت داده شدند و فعالیت آنزیمی اندازه‌گیری شد. در مجموع از میان 20 سویه جدا شده، تنها سوش POS-F84 که از خاک آب گل‌آلود جدا شده بود، به عنوان سوش تخریب کننده L-پرولین در نظر گرفته شد. به منظور شناسایی سوش POS-F84، آنالیزهای مورفولوژیکی، بیوشیمیایی و ژنتیکی انجام شد. باکتری جدا شده، گرم منفی، میله‌ای شکل و متحرک بود. نتایج تستهای بیوشیمایی در جدول 1 نشان داده شده است. خصوصیات بیوشیمیایی نشان داد که سویه جداسازی شده  شبیه به سودوموناس پوتیدا می‌باشد.

تشخیص بیشتر توسط مقایسه توالی rDNA s 16 و دیگر باکتریها در پایگاه بانک ژن انجام شد. به این منظور ابتدا ژن DNA ریبوزومی s 16 توسط واکنش PCR تکثیر شد و توالی یابی گردید. شکل 1 محصول حاصل از PCR انجام شده بر روی ریبوزومی s 16 را نشان می دهد که طول محصول 1500 جفت باز تخمین زده شد. توالی ژن   DNA ریبوزومی s 16 سویه POS-F84 دارای 99 و 98 درصد شباهت به ترتیب با توالیهای سودوموناس پوتیدا و سودوموناس انتموفیلا بود. روی هم‌اندازی متعدد توالیها و آنالیز فیلوژنتیکی نشان داد که سوش جدا شده به سودوموناس انتموفیلا نزدیک‌تر بود (شکل2).

 
   

 

 

 

 

 

 

 

 

 

 

 

 

 


شکل 1- تصویر الکتروفورز ژل آگاروز 1 درصد از PCR انجام شده بر روی ژن RNA ریبوزومی s16 . مارکر kb 1. 1: ‍ژن  RNA ریبوزومی s16  PCR شده ( bp1500).

لیکن، با درنظرگرفتن ارتباط نزدیک بین سودوموناس پوتیدا و سودوموناس انتموفیلا (2/70 درصد از ژنهای سودوموناس انتموفیلا دارای شباهت با ژنوم سودوموناس پوتیدا هستند)، این تفاوت 1 درصدی نمی‌توانست برای تشخیص دقیق سوش مورد نظر کافی باشد (17).

 

 

شکل 2- درخت فیلوژنتیکی ترسیم شده از ژن  RNA ریبوزومی s16 سوش جدا شده و باکتریهای خانواده سودوموناس ها. درخت فیلوژنتیکی توسط روش Neighbor joining و با استفاده از نرم‌افزار MEGA رسم شد.

 

شکل 3- درخت فیلوژنتیکی ترسیم شده از ژن ITS سوش جدا شده و باکتریهای خانواده سودوموناس ها. درخت فیلوژنتیکی توسط روش Neighbor joining و با استفاده از نرم‌افزار MEGA رسم شد.

 

شکل 4- تمودار لینویور- برک ترسیم شده برای پرولین دهیدروژناز در حضور سوبسترای L-پرولین.

 

در حقیقت، تنوع ناکافی در توالیهای ژن rRNA s 16 به منظور تمایز گذاشتن در میان ارگانیسم‌های نزدیک به هم خصوصاً در سطوح بین گونه‌ای وجود دارد (18). از این رو پیشنهاد شده است که ناحیه ITS می‌تواند به دلیل تفاوت زیادتر در طول و توالی، بر این مشکل غلبه کند. در حقیقت، استفاده از پلی مورفیسم ITS یک ابزار قدرتمند در آنالیز فیلوژنتیکی است. به این دلایل، در این تحقیق به منظور تمایز دقیق سویه جدا شده POS-F84، ناحیه ITS توالی‌یابی گردید. نوکلئوتید ITS توسط برنامه BLAST آنالیز شد و به ترتیب 97 و 94 درصد شباهت با ITS سویه‌های سودوموناس پوتیدا و سودوموناس انتموفیلا نشان داد. براساس درخت فیلوژنتیکی ترسیم شده برای توالیهای ITS ( شکل3). نتیجه گیری شد که سوش POS-F84 بیشتر شبیه به سودوموناس پوتیدا بود. بنابراین، این سویه به عنوان بیوتایپ جدیدی از سودوموناس پوتیدا تشخیص داده شد. پارامترهای ثابت میکائیلیس-منتن و سرعت ماکزیمم برای آنزیم پرولین دهیدروژناز در سودوموناس پوتیدا به ترتیب 12/0 میلی مولار و 11/0 میلی مولار بر دقیقه اندازه گیری شدند. شکل 4 نمودار لینویور- برک ترسیم شده برای آنزیم مذکور را نشان می­هد. ثابت میکائیلیس-منتن پرولین دهیدروژناز جدا شده نسبت به آنزیم مشابه در سویه­های باکتریایی دیگر نظیر سودوموناس آئروجینوزا (4)، سالمونلا تیفوموریم (Salmonella typhimurium) (5) و اشریشیا کلی (7) پایین تر بود که این خصوصیت از ویژگیهای قابل توجه آنزیم جدا شده محسوب می شد. جهت مطالعات بیوانفورماتیکی بر روی آنزیم، ساختار سه بعدی توسط برنامه Modeler  شبیه سازی شد. شکل 5 تصویر ساختار سه بعدی پرولین دهیدروژناز را در دو نمایش نواری  (Ribbon) و کره ای (Sphere) نشان می دهد. ساختار شبیه­سازی شده شباهت قابل ملاحظه­ای با آنزیمهای خانواده سودوموناسها نظیر سودوموناس آئروجینوزا و سودوموناس فلورسانس داشت (19و20). آنالیز جایگاه فعال نشان داد که دنباله های تیروزین، لیزین و آسپارژین در اتصال به کوفاکتور و واکنش کاتالیتیکی دخالت دارند که این دنباله های آمینواسیدی در پرولین دهیدروژنازهای سودوموناسها حفاظت شده می باشند.

 

(الف)

 

 

(ب)

 

 

شکل 5- ساختار سه بعدی پیش بینی شده برای پرولین دهیدروژناز. الف) نمایش نواری، ب) نمایش کره ای.

 

این ویژگی نیز از دلایل دیگر قرار داشتن آنزیم جداسازی شده در گروه پرولین دهیدروژنازهای سودوموناسها بود. در مجموع، یک سوش سودوموناس پوتیدا تولیدکننده آنزیم پرولین دهیدروژناز در جریان مطالعات غربالگری بر روی نمونه های خاک جداسازی شد و با استفاده از روشهای بیوشیمیایی و مولکولی شناسایی و تعیین هویت گردید. این تحقیق، اولین گزارش از جداسازی یک سوش سودوموناس پوتیدا واجد توانایی تولید پرولین دهیدروژناز است. 

1-     شهباز محمدی، ح. و امیدی نیا، ا. 1387. جداسازی، غربالگری و تعیین خصوصیات آنزیمی میکروارگانیسمهای تولید کننده آمینواسید دهیدروژنازها از نمونه­های خاک ایران. مجله زیست شناسی ایران. جلد 21، شماره 1، ص  104-94.

2-     مشایخی، ف.، امیدی نیا، ا.، شهباز محمدی، ح.، ابراهیمی راد، م.، حسین خانی، س. و گره گوریان، آ. 1389. تخلیص و بازیافت آلکالین پروتئاز مقاوم به حرارت در سامانه­های دوفازی آبی. مجله زیست شناسی ایران. جلد 23، شماره 3، ص 376-367.

 

3-   Asano Y., Tanetani M. 1998.Thermostable phenylalanine dehydrogenase from a  mesophilic Microbacterium strain DM86-1. Arch. Microbiol. 169, 220-224.

4-     Baban B.A., Vinod M.P., Tanner J.J., Becker D.F. 2004. Probing a hydrogen bond pair and the FAD redox properties in the proline dehydrogenase domain of Escherichia coli PutA. Biochem. Biophys. Acta .1701, 49–59.

5-   Baron E.J., Finegold S.M. 1990. Bailey and Scotts's diagnostic microbiology, 8th Ed.The C .V.  Mosby Company, ST. Louis. Baltimore. Philadelphia. Toronto. pp. 363-407.

6-     Bodilis J., Calbrix R., Guerillon J., Merieau A., Pawlak B., Orange N., Barray S. 2004. Phylogentic relationships between environmental and clinical isolates of Pseudomonas fluorescens and related species deduced from 16S rRNA gene and OprF protein sequences. Appl. Microbiol. 27, 93-108.

7-   Hongpattarakere T., Seksun N., Suriya A. 2003. Isolation and screening of D-amino acidamidase producing bacteria from soil samples. Songklanakarin J. Sci. Technol. 2,255- 265.

8-     Jeng R.S., Svircev A.M., Myers A.L., Beliaeva L., Hunter D.M., Hubbes M. 2001. The use of 16S and 16S-23S rDNA to easily detect and differentiate common gram-negative orchard epiphytes. Microbiol. Methods. 44, 69-77.

9-   Krieg N.R., Holt J.G. 1984. Bergey’s Manual of systematic Bacteriology. Vol.1. Baltimore: Williams and Wilkins Co.

10-Lee Y.H., Nadaraia S., Gu D., Becker D.F. Tanner J.J. 2003. Structure of the proline dehydrogenase domain of the multifunctional PutA flavoprotein. Nat. Struct. Biol.10,  109-114.

11-  Meile L., Leisinger T. 1982. Purification and properties of the bifunctional proline dehydrogenase/1-pyrroline-5-carboxylate dehydrogenase from Pseudomonas aeruginosa. Eur. J. Biochem. 129, 67-75.

12-  Nakagawa T., Shimada M., Mukai H., Asada K., Kato I., Fujino K., Sato T. 1994. Detection of alcohol-tolerant Hiochi bacteria by PCR. Appl. Environ. Microbiol. 60, 637-640.

13-Palmer T. 2003. Enzymes: Biochemistry, Biotechnology and Clinical Chemistry. Harwood Publishing Limited, International Publishers, Coll House,  Weatergate,Chichester, Weat Sussex, England, pp. 354-355.

14-Shahbaz Mohammadia H., Omidinia E., Sahebghadam Lotfi A., Saghiri R. 2007. Preliminary report of NAD+-dependent amino acid dehydrogenases producing bacteria isolated from soil. Iranian Biomed. J. 11, 131-135.

15-  Straub P.F., Reynolids P.H.S., Althomsons S., Mett V., Zhu Y., Shearer G., Kohl DH. 1996. Isolation, DNA sequence analysis, and mutagenesis of a proline dehydrogenase gene (putA) from Bradyhizobium japonicum. Appl. Environ. Microbiol. 62, 221-229.

16-Scarpellini M., Franzetti L., Galli A. 2004. Development of PCR assay to identify Pseudomonas fluoresens and its biotype. Microbiol. Lett. 236, 257-260.

17-Satomura T., Kawakami R., Sakuraba H., Ohshima T. 2002. Dye-linked D-proline dehydrogenase from hyperthermophilic archaeon Pyrobaculum islanddicum is a novel FAD-dependent amino acid dehydrogenase. J. Bio. Chem. 227, 12861-12867.

18-Tamura K., Dudley J., Nei M., Kumar S. 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution .24,  1596-1599.

19-Vilchez S., Molina L., Ramos C., Ramos J. 2000. Proline metabolism by Pseudomonas putida: cloning, characterization, and expression of the put genes in the presence of rootexudates. J. Bacteriol. 182, 91-99.

20-White T.A., Krishnan N., Becker D.F., Tanner J.J. 2007. Structure and kinetics of monofunctional proline dehydrogenase from Thermus thermophilus. J. Biol. Chem. 282, 14316-14327.